WO2017076306A1 - Method for improving plant resistance to verticillium wilt using verticillium-wilt bacteria vdp4-atpase gene - Google Patents

Abstract

Provided is a use for an encoding VdP4-ATPase gene of Verticillium wilt P-type ATPase to improve plant resistance to Verticillium wilt. Also provided is a method for improving plant resistance to Verticillium wilt, whereby an encoding VdP4-ATPase gene of Verticillium wilt P-type ATPase is expressed in a target plant, thereby improving the resistance of said plant to Verticillium wilt.

Description

Method for improving plant resistance to Verticillium wilt by using Verticillium dahliae VdP4-ATPase gene Technical field

The invention belongs to the field of plant genetic engineering. Specifically, it relates to a method for improving plant disease resistance using genetic engineering techniques.

technical background

Verticillium wilt seriously affects the yield and quality of crops, and the annual global loss due to verticillium is billions of dollars (Pegg et al., 2002). It is reported that the annual yield of potato is reduced by more than 50% due to infection with verticillium, which usually causes 10-15% reduction (Powelson et al., 1993; Rowe et al., 1987, 2002); lettuce growing area, yellow wilt The damage caused by the disease is very easy to reach 100% (Subbarao et al., 1997); Levinet (2003) and other studies found that the reduction of olive oil caused by Verticillium wilt can reach more than 70%; Verticillium wilt is also the cotton of most cotton-growing countries Major diseases, such as Australia, Brazil, Bulgaria, China, Greece, Peru, Turkey, Uganda, the United States, and Uzbekistan, can cause more than 30% of cotton production (Bolek et al., 2005), severely affected areas or Annual production can be reduced to 100%. Verticillium wilt is a major disease that restricts cotton production in China. At present, the area of cotton in China has accounted for more than 50% of the total area of cotton planting, and the annual loss of lint is 7.5-100,000 tons. The direct economic loss is 1.6-200 billion yuan. (Xiao Songhua et al., 2006). In China, the serious disease of cotton verticillium has increased year by year, and the harm has increased year by year. It has become the main limiting factor for achieving high yield and stable yield of cotton. Verticillium wilt not only causes a large number of crops to reduce production and product quality, but the toxins produced by the pathogens can also endanger human health.

Verticillium wilt is mainly a soil vascular bundle disease caused by infection with Verticillium dahliae Kleb and Verticillium alboatrum. Once the pathogen invades the plant, there is no effective control method. Verticillium dahliae has a wide range of hosts and can infect more than 200 plants including all dicotyledonous plants. The pathogens can survive in the soil for about 20 years in the form of microsclerotia (Klosterman et al., 2009), except 2001. Kawchuk et al. cloned a disease resistance gene Ve from the tomato against Verticillium dahliae, and almost no cloned resistance genes from other plants. The mechanism of the disease resistance gene showed that the gene is only resistant to Verticillium dahliae. Some of the races are resistant (Fradin et al., 2009). Early studies suggested that after the plant was infected with Verticillium wilt, the duct was blocked by spores, hyphae and pathogens by gelatinous formation of plant cells (Agrios, 2005), but subsequent studies showed that the catheter was blocked. It is not the main cause of the wilting of Verticillium wilt. With the deepening of research, it is recognized that the toxin produced by Verticillium dahliae is an important factor leading to plant wilting (Fradin et al., 2006). Some scholars believe that the clogging of vascular bundles is also based on the inducing effect of toxins (Chen Xusheng et al., 1998).

Practice has proved that the use of resistant varieties is the only cost-effective way to control the damage of Verticillium wilt. Although the traditional breeding method can use the resistance genes of the crop itself or the relative species to breed disease-resistant varieties, there are shortcomings such as low available resources, long breeding time and high cost; the application of chemical agents is not only difficult to effectively control Verticillium wilt and pollute the environment. With the continuous development of plant genetic engineering technology and the The in-depth understanding of the interaction with pathogens makes it an effective way to introduce exogenous resistance genes into plants to improve disease resistance. Transgenic technology can break the inter-incompatibility phenomenon in traditional breeding, eliminate hybridization barriers, and greatly broaden the source and application of resistance genes (Grover and Gowthama, 2003).

Using exogenous disease resistance gene products to inhibit the growth and reproduction of Verticillium dahliae in plants can improve the resistance of plants to Verticillium wilt. On the other hand, based on the pathogenic mechanism of Verticillium dahliae toxin, improve the toxin of Verticillium dahliae The detoxification ability is also one of the effective ways to improve the resistance of plants to Verticillium wilt. However, the vast majority of researchers mainly use the former method to achieve the purpose of improving plant resistance. It has not been successfully reported that the toxin produced by the pathogen of the exogenous gene is used to improve the resistance to Verticillium wilt.

Summary of the invention

An object of the present invention is to provide a VdP4-ATPase gene encoding Verticillium dahliae P class ATPase for enhancing the resistance of plants to Verticillium wilt by integrating a VdP4-ATPase gene encoding Verticillium dahliae P class ATPase into a target plant The transgenic plants are constructed and the VdP4-ATPase gene is expressed in plants to increase the resistance of the plants to Verticillium wilt.

Another object of the present invention is to provide a method for improving resistance of plants to Verticillium wilt, which is improved in resistance to Verticillium wilt by expressing a foreign gene in a plant of interest, wherein the foreign gene is encoded VdP4-ATPase gene of Verticillium dahliae P class ATPase.

Specifically, the present invention integrates the Verticillium dahliae VdP4-ATPase gene containing the nucleotide sequence shown in SEQ ID NO. 9 into a plant to realize constitutive expression of these genes and improve detoxification of the transgenic plants to Verticillium dahliae toxin. Ability to obtain transgenic plants resistant to Verticillium wilt.

More specifically, the method of the present invention comprises the steps of:

The VdP4-ATPase gene is integrated into the target plant to construct a transgenic plant, and the VdP4-ATPase gene is expressed in the plant.

Preferably, the method comprises the steps of:

1) constructing a recombinant plant expression vector containing the VdP4-ATPase gene from Verticillium dahliae;

2) introducing the recombinant plant expression vector into a target plant such that the VdP4-ATPase gene is constitutively expressed in the target plant;

3) Obtaining transgenic plants with enhanced resistance to Verticillium wilt.

Preferably, the nucleotide sequence of the VdP4-ATPase gene is shown in SEQ ID NO.

The target plant to which the method of the invention may be applied is preferably tomato, tobacco or cotton.

In the method of the present invention, the recombinant plant expression vector in step 1) has the structure shown below:

It is still another object of the present invention to provide a method for preparing a transgenic plant having resistance to Verticillium wilt, comprising the steps of:

i) obtaining a VdP4-ATPase gene encoding Verticillium dahliae P class ATPase, and operably inserting it into a plant expression vector to construct a plant expression vector;

Ii) transforming the host with the plant expression vector obtained in step i) to obtain a transformant;

Iii) transforming the plant with the transformant obtained in the step ii) to obtain a transgenic plant.

The invention utilizes the VdP4-ATPase gene of Verticillium dahliae to improve the resistance of plants to Verticillium wilt, and specifically comprises the following steps:

1) Obtaining VdP4-ATPase gene of Verticillium dahliae: Introducing SpeI and SmaI restriction sites to design primers, then PCR amplification using Verticillium dahliae cDNA as template, the amplified product is the VdP4-ATPase gene with added restriction site sequence;

2) Construction of a plant expression vector constitutively expressing the VdP4-ATPase gene: The amplified VdP4-ATPase gene sequence was ligated into the plant expression vector pLGN-35S-Nos to construct a new plant expression vector named pLGN-35S- VdP4-ATPase;

3) Genetic transformation of plants: The plant expression vector of pLGN-35S-VdP4-ATPase obtained in the above step 2) was integrated into the plant genome by Agrobacterium tumefaciens-mediated method to realize the constitutive form of VdP4-ATPase gene in transgenic plants. Expression, increase the resistance of transgenic plants to Verticillium wilt;

4) Obtainment of VdP4-ATPase transgenic plants resistant to Verticillium wilt: The transgenic plants obtained in the step 3) were further propagated, molecularly identified and disease-resistant, and VdP4-ATPase transgenic plants with improved resistance to Verticillium wilt were obtained.

Further, the step of constructing the constitutively expressed pLGN-35S-VdP4-ATPase plant expression vector comprises: designing an upstream primer after obtaining the cDNA of Verticillium dahliae: 5'- GACTAGT ATGGCTGGACGACCCACGGG(SpeI)-3', downstream primer 5'- CCCCGGG TCAGGTTCCCTGTCCTTGTG(SmaI)-3' was subjected to PCR amplification, and the amplified product and pLGN-35S-Nos vector plasmid were digested with SpeI and SmaI, respectively, and the large fragments after digestion were separately recovered, and the fragment was recovered by ligase. Ligation was performed to construct a new plant expression vector designated pLGN-35S-VdP4-ATPase to achieve constitutive expression of the VdP4-ATPase gene in transgenic plants.

The plants of the present invention are mainly tobacco, tomato and cotton.

The method for constructing the constitutively expressing the VdP4-ATPase gene plant expression vector of the above step 2) is a conventional method in the art, and the vector used is a conventional vector for plant genetic engineering, and the constitutive expression promoter is a cauliflower leaf. The viral CaMV35S promoter can also achieve the same goal by using other promoters with constitutive properties.

The Agrobacterium tumefaciens-mediated plant transformation method according to the above step 3), wherein the method for transferring the plant expression vector into Agrobacterium is an electroporation method, and the method for integrating the plant expression vector into tobacco, tomato and cotton is root cancer Agrobacterium-mediated method.

The molecular identification described in the above step 4) is an identification technique used in the fields of molecular biology, genetic engineering, and the like, such as GUS histochemical staining, PCR amplification and the like.

The disease resistance identification described in the foregoing step 4) refers to the identification of resistance to Verticillium wilt in the artificial climate chamber or the greenhouse seedlings, and the transgenic tobacco and the tomato are all inoculated with the pathogen by the method of filling the bacteria, and the cotton is subjected to the root soaking method. Inoculate.

The method for improving the resistance of plants to Verticillium wilt by the present invention is to transfer the VdP4-ATPase gene from Verticillium dahliae into tobacco, tomato and cotton cells to realize the constitutive expression of these genes in transgenic plants. The P4 ATPase encoded by the exogenous gene is used to detoxify the toxin produced by Verticillium dahliae in the plant, and the detoxification ability of the transgenic plant to Verticillium dahliae toxin is improved, thereby improving the resistance of the transgenic plant to Verticillium wilt.

Cyclosporin A (CsA) is a lipophilic hydrophobic cyclic peptide consisting of 11 amino acids. The present invention combines the similarity of the partial structure of the toxin of CsA and Verticillium dahliae, and the characteristics of the pathogenic mechanism of Verticillium dahliae. It is creatively proposed to use the VdP4-ATPase gene of Verticillium dahliae in constitutive expression in transgenic plants to improve the detoxification ability of transgenic plants to Verticillium dahliae toxin, and to improve the resistance of transgenic plants to Verticillium wilt.

The invention mainly utilizes the detoxification ability of the transgenic product to the toxin of the genus Verticillium toxin to improve the disease resistance of the plant, and further utilizes the transgenic product in the same manner to improve the detoxification ability of the plant to the mycotoxin is also the protection scope of the present invention. Meanwhile, the plant expression vector, the transformed cell, and the like involved in the present invention are also within the scope of the present invention.

Using the VdP4-ATPase transgenic tobacco obtained by the method of the present invention, the T ₀ generation seedlings were inoculated with the highly virulent L2-1 strain 30d by the root-infusion method, and the disease index was 29.35, which was 46.34 compared with the wild type control. After 30 days of inoculation, there were still 14 transformants in the 46 VdP4-ATPase transformants without significant symptoms. VdP4-ATPase transgenic cotton T ₁ seedlings were inoculated with V991 deciduous Verticillium wilt strain 20d by immersion root inoculation method. The non-transgenic control disease index reached 82.24, and the disease index of two VdP4-ATPase strains was less than 10, respectively. For 6.25 and 8.33. The transgenic tomato T ₀ generation seedling plants obtained by the invention were inoculated with the highly virulent L2-1 strain by the root-infusion method, the disease index of the non-transgenic tomato reached 78.33, and the disease index of the VdP4-ATPase transgenic tomato was 40.83, which was higher than that of the wild. The type control was reduced by 37.5. The results of the study indicate that the transgenic cotton, tobacco and tomato obtained by the method of the present invention can significantly improve the resistance of the transgenic plants to Verticillium wilt. It is to be noted that the method for improving the resistance of plants to Verticillium wilt provided by the present invention is remarkable. This method is not only applicable to cotton, tobacco and tomato, but all plants which can be infected by Verticillium dahliae can use this method to increase resistance to Verticillium wilt.

The method provided by the invention mainly utilizes the detoxification of the pathogenic toxin to enhance the resistance of the plant, and thus has no characteristics of pathogen resistance. Therefore, it can be widely applied to improve the resistance of physiological races of different pathogenic bacteria, and there is no characteristic of small species specific resistance.

DRAWINGS

Figure 1 shows the results of sensitivity test of CsA by plant pathogens.

1: Brassica campestris; 2: Verticillium dahliae; 3: Alternaria solani; cyclosporin A (CsA) concentrations of 0 μg / mL, 10 μg / mL, 50 μg / mL and 100 μg / mL. 5 μL of different concentrations of CsA were added to each well, and cultured at 26 ° C for about one week.

Figure 2 is a flow chart showing the construction of pLGN-35S-Nos plant expression vector

LF-LF: Recombinase recognition site (LoxpRT), which is synthesized by whole gene; 35S-MCS-Nos from pBIN AR vector (GenBank: AB752377.1), obtained by PCR; NPTII gene from bacterial transposon Tn5 aphA2;

The GUS gene is a reporter gene from E. coli.

Figure 3 shows the results of pLGN-35S-VdP4-ATPase vector digestion

M: DNA molecular weight standard Marker15; VdP: pLGN-35S-VdP4-ATPase vector plasmid obtained by digestion of the VdP4-ATPase target fragment.

Figure 4 is a diagram showing the plant expression vector of pLGN-35S-VdP4-ATPase

The pLGN-35S-VdP4-ATPase vector contains a 2×35S-initiated GUS::NPTII fusion gene expression cassette, a 35S-initiated VdP4-ATPase gene expression cassette.

Figure 5 is a histochemical staining analysis of GdP4-ATPase transgenic tobacco GUS

WT: wild-type non-transgenic tobacco; VdP: VdP4-ATPase transgenic tobacco.

Figure 6 shows the results of PCR amplification and identification of VdP4-ATPase transgenic tobacco GUS-positive plants.

Bp: base pair; M: DNA standard molecular weight DL2000; 1: wild type non-transgenic negative control; 2: plasmid positive control; 3-17: GUS staining positive transgenic tobacco plant. VdP: PCR amplification results of VdP4-ATPase transgenic tobacco GUS-positive plants.

Figure 7 shows the phenotype of VdP4-ATPase transgenic tobacco plants inoculated with Verticillium dahliae for 30 days.

WT: wild-type non-transgenic tobacco; VdP: VdP4-ATPase transgenic tobacco.

Figure 8 shows the expression levels and disease levels of exogenous genes in VdP4-ATPase transgenic lines.

WT: wild type control; VdP-1, VdP-4 ... VdP-42: VdP4-ATPase transgenic tobacco lines.

Figure 9 is a histochemical staining analysis of GdP4-ATPase transgenic cotton GUS

WT: wild-type non-transgenic cotton; VdP: VdP4-ATPase transgenic cotton.

Figure 10 shows the results of PCR amplification and identification of VdP4-ATPase transgenic cotton GUS-positive plants.

Bp: base pair; M: DNA standard molecular weight DL2000; 1: wild type non-transgenic negative control; 2: plasmid positive control; 3-17: GUS positive transgenic tobacco plant. VdP: VdP4-ATPase transgenic cotton.

11 is inoculated with Verticillium dahliae 20d, VdP4-ATPase generation of transgenic cotton T ₁ stage disease, the incidence of strain (%) and the disease index

Null: Non-transgenic plant control isolated from transgenic lines; B1, B10, B50, B53, B56, B57, B58, B6, B60 and B61: BbP4-ATPase transgenic cotton independent transformants. VdP7, VdP8, VdP10, VdP15, VdP16, VdP23, VdP24, VdP33, VdP48 and VdP56: VdP4-ATPase transgenic cotton independent transformants.

12 is inoculated with Verticillium dahliae 20d, VdP4-ATPase T ₁ generation of transgenic cotton seedling phenotype

WT: wild-type non-transgenic cotton; VdP: VdP4-ATPase transgenic cotton.

Figure 13 shows the expression level of foreign genes in VdP4-ATPase transgenic cotton

Null: non-transgenic plant control isolated from transgenic lines; VdP7, VdP8, VdP10, VdP15, VdP16, VdP23, VdP24, VdP33, VdP48 and VdP56: VdP4-ATPase transgenic cotton independent transformants.

Figure 14 is a histochemical staining analysis of VdP4-ATPase transgenic tomato GUS

WT: wild type control; VdP: VdP4-ATPase transgenic tomato.

Figure 15 shows the results of PCR amplification and identification of VdP4-ATPase transgenic tomato GUS-positive plants.

Bp: base pair; M: DNA standard molecular weight; 1: wild type non-transgenic negative control; 2: plasmid positive control; 3-17: tomato plant positive for GUS staining.

Figure 16 shows the phenotype of the plant inoculated with Verticillium dahliae for 30 days.

WT: wild type control; VdP: VdP4-ATPase transgenic tomato.

detailed description

The invention will be further described in detail below with reference to the accompanying drawings, but the invention is not limited by the following description.

The pharmaceutical reagents in the examples of the present invention are all domestically produced conventional chemical reagents, and the material methods are not specifically described, and are referred to the "Molecular Cloning Experiment Guide" (Sambrook and Russell, 2001).

1. Proposal of the core strategy of invention technology

1.1 The sensitivity of Verticillium dahliae to CsA

The amino acid sequence encoded by the P-type ATPase gene from Verticillium dahliae was 78% similar to the BbP4-ATPase gene encoded by Beauveria bassiana. Therefore, we named this gene from Verticillium dahliae as VdP4-ATPase.

Previous studies have shown that the BbP4-ATPase gene disruption mutant from Beauveria bassiana is more sensitive to CsA. BbP4-ATPase is a membrane protein involved in intracellular vesicle trafficking, so we speculate that CsA may be transported to a specific site for detachment or utilization (such as vacuoles) in the form of vesicle transport, thereby enhancing spore white The resistance of the bacterium to CsA is presumed, so it is speculated that VdP4-ATPase from Verticillium dahliae may have a similar function to BbP4-ATPase. Our results also show that Verticillium dahliae is highly resistant to CsA compared to other phytopathogenic fungi (such as Brassica campestris, Alternaria solani, etc.), and Verticillium dahliae itself produces toxins. The toxin produced may have a certain effect on its own growth, so VdP4-ATPase may play a detoxifying role.

In order to verify the sensitivity of Verticillium dahliae to CsA, Verticillium dahliae (Proteillium dahliae, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Professor Jian Guiliang), Alternaria brassicae (preservation of the laboratory) ), Alternaria solani (pre-storage in the laboratory) as a research object, inoculation of Verticillium dahliae V991, Brassica chinensis, Alternaria solani, in PDA (potato solid medium) culture, Incubate for 14 days at 26 °C, take appropriate amount of each strain of conidia in 0.05% Tween-80, prepare conidia suspension with concentration of 2×10 ⁶ /mL, and take 400 μL of conidia suspension of each strain. 60mL PDA medium (cooled to about 45 °C), mix, take 20mL medium and conidia mixture in a 90mm diameter dish (3 replicates per strain), until the medium is completely coagulated After that, the holes were punched with a punch having a diameter of 5 mm, and 5 μL of different concentrations of CsA were added to each well, and cultured at 26 ° C for about one week. The specific results are shown in FIG. 1 . The results in Figure 1 indicate that Verticillium dahliae is highly resistant to CsA relative to Alternaria alternata and Alternaria solani.

1.2 Proposal of the core strategy of invention technology

The above studies showed that Verticillium dahliae is highly resistant to CsA relative to plant pathogenic fungi such as Brassica chinensis and Alternaria solani, and CsA is a lipophilic hydrophobic cyclic peptide consisting of 11 amino acids. The structure may be similar to the structure of certain pathogenic components of Verticillium dahliae toxin. Therefore, in combination with the pathogenic mechanism of Verticillium dahliae, the present invention creatively proposes the core strategy of the invention, "Utilizing Verticillium dahliae in transgenic plants The P-type ATPase to detoxify the toxin of Verticillium dahliae, thereby increasing the resistance of transgenic plants to Verticillium wilt.

2. Cloning of the VdP4-ATPase gene

2.1 Extraction of Verticillium dahliae RNA and cDNA synthesis

Take appropriate amount of Verticillium dahliae wild type strain V991 hyphae in 50mL PDB (potato liquid medium) medium, shake at 200rpm, 26 °C for 4 days, filter, collect hyphae, use liquid nitrogen grinding method, according to Aidlab The total RNA of Beauveria bassiana was extracted from the EASYspin RNA Rapid Extraction Kit Instructions, and the obtained RNA was detected by 1% agarose electrophoresis. Reusing TaKaRA

The cDNA was synthesized by RT reagent kit with gDNA Eraser kit, and the operation was carried out strictly according to the instructions.

2.2 Cloning of VdP4-ATPase gene

Using the cDNA of Verticillium dahliae obtained in Example 2.1 as a template, the VdP4-ATPase gene upstream primer 5'- GACTAGT ATGGCTGGACGACCCACGGG(SpeI)-3'/5'- CCCCGGG TCAGGTTCCCTGTCCTTGTG(SmaI)-3' was used as a primer to utilize KOD-Plus. The -Neo (TOYOBO) enzyme was subjected to PCR amplification, and the amplified product was recovered to obtain a VdP4-ATPase fragment having a SpeI/SmaI cleavage site.

PCR amplification system: 10 × PCR Buffer 5 μL, 2 mM dNTPs 5 μL, 25 mM MgSO ₄ 3 μL, 10 μM upstream and downstream primers 2 μL each, template (50 μg / μL) 4 μL, KOD-Plus-Neo 1 μL (1 U / μL), add water to 50 μL, the amplification procedure was 94 ° C for 2 min; 98 ° C for 10 s, 68 ° C for 4 min for 30 s, and 40 cycles.

3. Construction of pLGN-35S-VdP4-ATPase plant expression vector and acquisition of Agrobacterium transformants

3.1 Acquisition of pLGN-35S-Nos plant expression vector

pLGN-35S-Nos is a binary plant expression vector engineered from pCambia2300 in this laboratory. The T-DNA segment (region between RB and LB) was replaced with a fusion gene expression cassette of the constitutive promoter CaMV35S-P-controlled reporter gene GUS and the marker gene NPTII, and a LoxpFRT was added to each end of the expression cassette. Recombinase recognition site, and another expression cassette controlled by CaMV35S-P, the specific process is shown in Figure 2.

3.2 Construction of pLGN-35S-VdP4-ATPase plant expression vector

The fragment obtained by the amplification of the above Example 2.2 was recovered, digested with SpeI and SmaI, and the fragment was recovered, and the pLGN-35S-Nos plasmid was digested with SpeI and SmaI, and the large amount after digestion was recovered. The fragment was ligated to the recovered VdP4-ATPase fragment and pLGN-35S-Nos fragment by DNA ligase, and the ligated product was transformed into E. coli DH5α, and the positive clone was screened and verified by enzyme digestion (as shown in Fig. 3). The results showed that it was successful. The VdP4-ATPase gene fragment was ligated into the pLGN-35S-Nos vector. The primers were designed according to the vector sequence for sequencing analysis. The sequence of BbP4-ATPase gene obtained by sequencing was found in sequence 9 (SEQ ID NO. 9), and the positive clone of pLGN-35S-VdP4-ATPase plant expression vector was stored at -80 °C. The structure shown in 4.

3.3 Acquisition of recombinant Agrobacterium from pLGN-35S-VdP4-ATPase plant expression vector

The pLGN-35S-VdP4-ATPase plant expression vector obtained in step 3.2 was transferred into Agrobacterium tumefaciens LBA4404 competent cells by electroporation, and the antibiotic was used to screen the marker gene for resistance screening, and positive clones were obtained, and the Agrobacterium plasmid was extracted and SmaI was used. Double enzyme digestion with SpeI (verification results are identical to those of Fig. 3), and recombinant Agrobacterium containing pLGN-35S-VdP4-ATPase plant expression vector was obtained.

The E. coli or Agrobacterium plasmid transformed with pLGN-35S-VdP4-ATPase vector was extracted, and SpeI and SmaI were double-digested and electrophoresed on a 1% agarose gel to obtain a target piece of about 4128 bp. segment.

4. Molecular identification of transgenic plants

4.1 GUS histochemical staining identification of transgenic plants

Referring to Jefferson et al (1987), with the pore diameter of 9mm hole is cut reconstituted tobacco, tomato or cotton young plant leaves opposite GUS staining solution (500mg / L X-Gluc, 0.1mol / L K 3 Fe (CN) 6, 0.1 Mol/LK ₄ Fe(CN) ₆ , 1% Triton X-100 (v/v), 0.01 mol/L Na ₂ EDTA, 0.1 mol/L phosphate buffer pH 7.0, and incubated at 37 ° C for 2 h. After dyeing, 75% ethanol was decolorized, and the decolorizing solution was changed every 4 hours until the color of the uncolored portion completely faded. The regenerated material in which none of the leaves appeared in blue was a non-transgenic plant, and the transfected blue was a transgenic plant.

4.2 PCR amplification and identification of VdP4-ATPase transgenic plants

All regenerated GUS histochemical staining positive for tobacco, tomato and cotton plants, taking about 0.1 g of their seedling leaves, using Aidlab's new plant genomic DNA rapid extraction kit to extract DNA according to the protocol of the instructions, after obtaining DNA The quality of the DNA was detected by 1% agarose gel electrophoresis, and then the fragment of the VdP4-ATPase gene was amplified using the extracted DNA as a template to detect whether the regenerated plants integrated the VdP4-ATPase gene.

The PCR amplification primers for the VdP4-ATPase gene were: upstream primer: 5'-TATTCCTCTCGTTGCCGTGC-3'; downstream primer: 5'-CAATGTCTGCGGGAAAAGGC-3'.

25 μL amplification system includes: 10×LA PCR Buffer, 2.5 μL; 25 mmol/L MgCL ₂ , 2.5 μL; 2.5 mmol/L dNTP Mixture, 2 μL; template DNA, 1 μL (about 10 ng); 5 μmol/L upstream primer, 1 μL; 5 μmol/L downstream primer, 1 μL; LA Taq enzyme, 0.2 μL; ddH ₂ O, 14.8 μL.

PCR temperature cycling parameters: 94 ° C, 5 min; 94 ° C, 30 s, 57 ° C, 30 s, 72 ° C, 30 s, amplification 30 cycles; 72 ° C, 10 min. The final amplification product was detected by 1% agarose gel electrophoresis.

5, disease resistance identification of pathogenic bacteria and plant disease level statistical standards

5.1 Obtaining pathogenic bacteria for disease resistance identification

PDA solid medium activated deciduous Verticillium dahliae V991 or strong pathogenic L2-1 strain (Hebei Agricultural University, Professor Ma Yingying), pick a little hyphae inoculated into CZB (Crazy liquid medium), Incubate at 180 rpm, shaken at 26 °C for 7 days, then inoculate CZB medium at a ratio of 10% (bacterial solution/CZB medium), shake at 180 rpm, shake at 26 °C for 7 days, and remove the hyphae in the bacterial solution by four layers of sterile gauze. And impurities, deionized water to adjust the spore concentration of Verticillium dahliae to 10 ⁷ / ml, the spore suspension is the pathogen inoculation solution for disease identification and inoculation.

5.2 Statistical criteria for the disease level of transgenic plants

The disease grades of cotton, tobacco and tomato plants were counted according to Bhat and Subbarao (1999), a 5-level disease statistical method for cotton seedling disease.

Grade 0: no external appearance of the plant;

Grade 1: plants with 1/3 or less of the disease;

Grade 2: 1/3-2/3 of the leaves of the plant;

Grade 3: 2/3 of the leaves of the plant showed obvious symptoms;

Level 4: All leaves of the plant show symptoms.

5.3 Calculation formula for incidence rate and disease index

6, gene transcription and expression detection

6.1 RNA extraction and cDNA synthesis

Plant RNA was extracted using the Plant RNA Rapid Extraction Kit (Aidlab product), and all operations were carried out in strict accordance with the instructions. The obtained RNA was detected by 1% agarose electrophoresis. Reuse

The cDNA was synthesized by RT reagent Kit with gDNA Eraser kit (TaKaRa product), and the target gene was amplified by using cDNA as a template. The removal of plant genomic DNA and the synthesis of cDNA in RNA were carried out in strict accordance with the instructions.

6.2 Gene transcriptional expression detection

Real-time PCR was used to detect the expression level of transgenes in plants. To homogenize the cDNA concentration, cotton uses the GhHIS3 gene as an internal standard, and tobacco uses the 18S gene as an internal standard.

The 20 μL reaction system included 1 μL of cDNA, 1 μL of each of the upstream and downstream primers, and 10 μL of 2×iQ SYBR Green Supermix, and supplemented with 20 μL with RNase-free double distilled water.

The amplification procedure was: pre-amplification at 95 ° C for 3 min; 94 ° C for 10 s, 56 ° C for 30 s, and 72 ° C for 30 s for a total of 40 cycles. After amplification was completed, the relative expression levels of the genes were analyzed using Gene Study software.

7. Genetic transformation of tobacco and acquisition of transgenic plants

7.1 Medium for tobacco genetic transformation

MSB: MS inorganic salt (Murashige and Skoog, 1962) + B5 organic (Gamborg et al., 1968).

Seed germination medium: MSB + 30 g / L sucrose, added with 2.0 g / L Gelrite for curing, pH 6.0.

Co-culture medium: MSB + 30g / L sucrose + 0.5mg / L IAA (indole acetic acid) + 2.0mg / L 6-BA (6-benzylaminopurine), adding 2.0g / L Gelrite for curing, pH5.4 .

Callus induction medium: MSB + 30g / L sucrose + 0.5mg / L IAA + 2.0mg / L 6-BA + 400mg / L Cef (cephalosporin) + 100mg / L Km (kanamycin), added 2.0 The g/L Gelrite was cured at pH 5.8.

The shoot induction medium: MSB + 30 g / L sucrose + 2.0 mg / L 6-BA, 200 mg / L Cef + 100 mg / L Km, was added with 2.0 g / L Gelrite for curing, pH 5.8.

Rooting medium: MSB + 30g / L sucrose + 200mg / L Cef, adding 2.5g / L Gelrite for curing, pH 5.8.

7.2 Access to tobacco genetically transformed explants

Take a few grains of mature tobacco seeds, sterilize 75% alcohol for 1 min, and quickly de-alcohol; 1% sodium hypochlorite solution is sterilized for 15 min, and oscillate continuously to achieve the purpose of full disinfection; decanted sodium chlorate solution, using no The bacteria were washed with double distilled water for 7-8 times. The seeds were germinated under shaking at 120 rpm under sterile conditions, and then transferred to seed germination medium, and cultured to 4-6 true leaves under 16h light/8h dark culture conditions. The fully grown true leaves were taken and cut into 3-5 mm medium leaf discs under sterile conditions on a clean bench for use as transformed explants.

7.3 Preparation of Agrobacterium Dyeing Solution

Agrobacterium strains containing LGN-35S-VdP4-ATPase vector stored at -80 °C were streaked to obtain single colonies, and then single colonies were picked and inoculated with additional 50 mg/L Km and 125 mg/L Sm (streptomycin sulfate). In YEB medium (5g/L sucrose, 1g/L bacterial yeast extract, 10g/L bacterial tryptone, 0.5g/L MgSO ₄ ·7H ₂ O, pH 7.0), 28°C, 200rmp The culture was shaken overnight until the OD600 value of the bacterial solution reached 0.8. The bacterial solution was centrifuged, and the cells were resuspended by adding the same volume of MSB liquid medium, and the resuspension was the Agrobacterium infusion solution for transformation.

7.4 Genetic Transformation and Plant Regeneration of Tobacco

The leaf disc explant obtained in step 7.2 is inoculated in the Agrobacterium infusion solution prepared in step 7.3 for 30 min, and then the bacterial liquid is decanted, and the tobacco explants infected by Agrobacterium are inoculated into the co-cultivation medium, and the dark culture is carried out at 26 ° C. 2d, then substituting into the callus induction medium, 14d after the subculture into the induction medium, and then culture for about 14d, cutting the regenerated green buds into the rooting medium, cultivating the rooting medium to 2-3 leaf seedlings, washing the roots The surrounding agar is transplanted into a nutrient bowl containing charcoal soil and placed in a greenhouse for cultivation.

Molecular identification of 7.5 transgenic tobacco and acquisition of transgenic plants

The regenerated tobacco plants were subjected to GUS histochemical staining and PCR amplification identification according to the method of Example 4. The GUS histochemical staining of tobacco leaves can obtain the blue (right) plants shown in Figure 5 as transgenic plants. A total of 46 VdP4-ATPase transgenic lines were obtained by GUS histochemical staining. In order to further determine whether the VdP4-ATPase gene was integrated into the plants positive for GUS histochemical staining, all the regenerated plants with positive GUS staining extracted the total DNA of the leaves, and then used DNA as a template to sequence 3 and sequence 4. Amplification of the VdP4-ATPase gene fragment revealed that all VdP4-ATPase transgenic tobacco GUS-positive plants were able to amplify a target fragment of about 200 bp of the VdP4-ATPase gene (Fig. 6), indicating that the GUS-positive plants were integrated. The BbP4-ATPase or VdP4-ATPase gene. A total of 38 independent transformants of BbP4-ATPase transgenic tobacco and independent transformants of 46 VdP4-ATPase transgenic tobacco were obtained by GUS histochemical staining and PCR amplification. All of these transformants were used for disease resistance identification analysis.

8. Resistance of transgenic tobacco to Verticillium wilt

Transgenic tobacco plants obtained by carrying out the genetic transformation and molecular identification of Example 7 were grown in the greenhouse to When 6-10 leaves were used, the roots were treated with a surgical blade at about 1-2 cm from the plant, and then 30 mL of the L2-1 inoculum prepared in Example 7.1 was applied to each plant (the root-filling method), and set at 22 °C. (Night) Indoor culture in an artificial climate of -26 ° C (daytime). On the 30th day of inoculation, the disease grade of the transgenic plants was counted according to the standard of Example 7.2. The results showed that the 46 independent VdP-ATPase transformants had an average disease grade of 1.17 and a disease index of 29.25. The wild-type non-transgenic control (regenerated wild-type plants) had an average disease grade of 3.03 and a disease index of 75.65 (Table 1). The disease index of the VdP-ATPase transgenic lines was reduced by 46.34 compared with the non-transgenic controls.

At 30 days after inoculation, the VdP4-ATPase transgenic tobacco not only had a lower disease grade and disease index than the wild-type non-transgenic control, but 14 of the 46 VdP4-ATPase transformants had no obvious disease, while the non-transgenic control plants were all severely wilted. The leaves are chlorotic (Figure 7). Five non-aged transformants were randomly selected to expand and multiply by axillary buds, and then the same method was used to inoculate Verticillium dahliae for disease resistance identification. The results showed that these transformants did not show obvious symptoms after 30 days of inoculation, and further confirmed the obtained The resistance of disease-resistant transgenic tobacco to Verticillium wilt is significantly improved. The results showed that the VdP4-ATPase gene could significantly improve the resistance of transgenic tobacco to Verticillium wilt.

In order to further clarify the relationship between the improvement of the resistance level of the transgenic lines and the transgenic expression level, 20VdP4-ATPase transgenic tobacco was randomly selected as the research object, and the RNA of the leaves of the transgenic tobacco plants was extracted by the method of Example 6.1, and the method of Example 6.1 was carried out. The cDNA was synthesized, and the VdP4-ATPase gene fragment was amplified by using cDNA as a template, and then quantitative PCR amplification was carried out according to the method of Example 6.2, and the 18S rRNA gene was used as an internal standard. The results showed that the VdP4-ATPase gene in all transgenic plants could be efficiently transcribed, and the higher the level of transcriptional expression, the lower the level of transgenic plants, that is, the resistance and the transgene expression level were related. The higher the transcriptional expression level of the transgene, the better the resistance of the transgenic plants to Verticillium wilt. The expression levels and pathology of the transgenic lines are shown in Figure 8.

The transgenic plants were extracted from the leaves of transgenic tobacco plants, and the cDNA was reverse transcribed. The VdP4-ATPase gene was amplified by using sequence 3 and sequence 4 as primers. The homologous cDNA concentration was used as the 18S rRNA gene of tobacco. The target gene was amplified by using sequence 5 and sequence 6 as primers. After amplification, the relative expression level of the gene was analyzed by Gene Study software.

Table 1 Disease level and disease index of VdP4-ATPase transgenic tobacco inoculated with Verticillium dahliae for 30 days

WT: wild type plant; VdP4-ATPase: VdP4-ATPase transgenic tobacco plant.

46 VdP4-ATPase tobacco transformants transgenic full utilization of irrigation of root broth were inoculated with a spore suspension of Verticillium dahliae ⁽¹⁰⁷ spores / mL), seeded 30d, by five standard statistical 0-4 each transformant The disease grade, then the average disease and disease index for all transformants and controls were calculated separately. Non-transgenic controls all had serious onset, with an average disease level of 3.03 and a disease index of 75.69, while the VdP4-ATPase transgenic line had an average disease grade of 1.17 and a disease index of 29.35.

9. Genetic transformation of cotton:

9.1 Medium for cotton genetic transformation

Basic medium: MSB (MS inorganic salt + B5 organic);

Seed germination medium: 1/2MSB + 20g / L sucrose + 6g / L agar, prepared from tap water, natural pH;

Co-cultivation medium: MSB + 0.5 mg / L IAA + 0.1 mg / L KT (6 - mercapto aminopurine) + 30 g / L glucose + 100 μmol / L acetosyringone + 2.0 g / L Gelrite, pH 5.4;

Screening of detoxification medium: MSB+0.5mg/L IAA+0.1mg/L KT+75mg/L Km+500mg/L cef+30g/L glucose+2.0g/L Gelrite, pH5.8;

Callus induction medium: MSB + 0.5 mg / L IAA + 0.1 mg / L KT + 75 mg / L Km + 200 mg / L cef + 30 g / L glucose + 2.0 g / L Gelrite, pH 5.8;

Embryogenic callus induction medium: MSB + 0.1 mg / L KT + 30 g / L glucose + 2.0 g / L Gelrite, pH 5.8;

Liquid suspension medium: MSB + 1.91g / L potassium nitrate + 0.1mg / L KT + 30g / L glucose, pH 5.8;

Somatic embryo maturation medium: MSB + 15g / L sucrose + 15g / L glucose + 0.1mg / L KT + 2.5g / L Gelrite, pH6.0;

Seedling medium: SH + 0.4 g / L activated carbon + 20 g / L sucrose, pH 6.0. (Schenk & Hildebrandt, 1972)

9.2 Access to transformed explants

The upland cotton seeds were dehulled, the kernels were sterilized by 0.1% mercuric chloride for 10 min, rinsed 5-6 times with sterile tap water, inoculated into seed germination medium, and cultured at 28 ° C for 5-7 days. The sterile hypocotyls were cut into 3-5 mm long sections for transformation of the explants.

9.3 Preparation of Agrobacterium Dyeing Solution for Transformation

The preparation of Agrobacterium for transformation was carried out in the same manner as in Example 7.3. After centrifugation of the cultured Agrobacterium liquid, the cells were resuspended by adding the same volume of the co-culture liquid medium, and the resuspension was the Agrobacterium-dyeing solution for transformation.

9.4 Genetic Transformation of Cotton Hypocotyls and Induction of Embryogenic Callus

The explants were inoculated with Agrobacterium infusion for 20 min, the bacterial liquid was decanted, and the excess bacterial liquid on the surface of the explants was aspirated with sterile filter paper. The hypocotyl segments were inoculated into the co-culture medium at 26 ° C. After 2 days of culture, the hypocotyls were inoculated to the screening de-bacterting medium. After 20 days, the callus induction medium supplemented with kanamycin (Km) and cefomycin (cef) was subcultured for callus induction, and the cells were subcultured at intervals of 20 days. After 60 days, the embryogenic callus induction medium was substituted, and the embryogenic callus was obtained and then subjected to liquid suspension culture to obtain a large number of embryogenic callus with uniform growth.

9.5 Somatic Embryo Induction and Seedling Culture

Embryogenic callus in liquid suspension culture, 30 mesh stainless steel mesh screen filtration, evenness of embryogenic callus under sieve The body was inoculated into the somatic embryo maturation medium, and a large number of somatic embryos were produced in about 15 days, which were subcultured into the SH medium to promote the further formation of the somatic embryos. The regenerated shoots of 3-4 leaves were transplanted into the greenhouse for breeding.

9.6 VdP4-ATPase Transgenic Cotton Acquisition and Molecular Validation

The regenerated plants were subjected to GUS histochemical staining and PCR amplification identification according to the method of Example 4 using the regenerated cotton leaves as materials. GUS histochemical staining can obtain the blue (right) plant shown in Figure 9 as a transgenic plant, and the regenerated plant derived from one explant is calculated as one strain, and the VdP4- obtained by GUS histochemical staining is identified. ATPase transgenic cotton is 10 GUS-positive strains and 111 transgenic plants. To further determine whether the VdP4-ATPase gene was integrated in the GUS-positive plants, the transgenic plants were further amplified by PCR according to the method of Example 4.2. The results showed that all plants with positive GUS histochemical staining could be amplified. The target specific band of the VdP4-ATPase (about 200 bp) gene (Fig. 10). In the same manner substituting the molecular identification of T ₁ seedlings, generation of transgenic plants T ₁ seedlings were identified by molecular analysis for disease.

Using the DNA of transgenic cotton leaves as a template and using synthetic sequence 3 and sequence 4 as primers to amplify the VdP4-ATPase gene fragment, all GUS-positive plants can amplify the target specificity of VdP4-ATPase (about 200 bp) gene. band.

10. Resistance of transgenic cotton to Verticillium wilt

The seeds harvested from the T ₀ generation plants in the greenhouse were dehulled and seeded, and cultured at 28 °C after germination until the cotyledons were flattened and the true leaves began to appear. The V991 deciduous Verticillium wilt obtained in Example 7.1 was inoculated by root inoculation. After 2 days of infection, it was transplanted into nutrient sputum, and then cultured at 22 ° C (night) -26 ° C (daytime), 16 h light, 8 h dark condition, and the disease of the plant was counted according to the disease level standard of Example 5.2 at 5 d after inoculation. Grade, inoculated for 20 days, the non-transgenic plants (Null) isolated from the transgenic lines all developed disease, the disease index reached 82.24, and the disease index of the 10 transgenic VdP4-ATPase strains obtained were also lower than the non-transgenic control, among which VdP8, VdP10 The incidence rates of 7 strains such as VdP15, VdP16, VdP24, VdP33 and VdP56 were less than 50%, which were 28.57%, 50.00%, 50.00%, 33.33%, 50.00%, 46.25% and 25.00%, respectively. The disease index was 14.29, 12.50, 12.50, 8.33, 25.00, 21.15 and 6.25, in which the disease index of VdP16 and VdP56 strain rates were 8.33 and 6.25, respectively, below 10, reaching the level of disease resistance. Using average disease grades, the results showed that the average disease grade of non-transgenic controls was 3.29 after 20 days of inoculation, and it was susceptible to non-deciduous Verticillium wilt strain V991, VdP8, VdP10, VdP15, VdP16, VdP24, VdP33 and VdP56. The disease grades of these 7 strains were 0.57, 0.50, 0.50, 0.33, 1.0, 0.85, and 0.25, respectively (Fig. 11), and the strains of Verticillium wilt V991 also showed resistance or resistance.

Inoculation 20, the non-transgenic control plants showed typical symptoms of Verticillium wilt due to the infection of Verticillium dahliae. The upper leaves were chlorotic, some leaves were necrotic or even shedding. The true leaves of VdP4-ATPase transgenic cotton were normal and the plants grew normally. Only a slight disease appeared in the cotyledons of individual plants, and there were a few lesions (Fig. 12), which significantly improved the resistance to Verticillium wilt.

To further illustrate the relationship between transgene expression levels and disease resistance, use Real-time PCR The level of transcriptional expression of the foreign gene was measured. Using transgenic lines as materials, three samples were taken from each line to extract RNA, and reverse-transcribed to synthesize cDNA. Then, using cDNA as a template, synthetic sequence 3 and sequence 4 were used as primers to amplify VdP4-ATPase gene, which was uniform. The cDNA concentration was determined by using the GhHIS3 gene as an internal standard gene, and the amplification primer sequences were sequence 7 and sequence 8. The results showed (Fig. 13) that all VdP4-ATPase transgenic plants were also efficiently transcribed and expressed in comparison with the disease index of transgenic lines. The results showed that the level of transgene expression affected the resistance of transgenic lines. At the higher level, transgenic lines are more resistant to disease when the level of transgene expression is higher.

The deciduous Verticillium dahliae strain V991 was inoculated by the immersion root inoculation method, inoculated for 20 days, the disease grade was counted according to the 0-5 grade disease standard, the incidence rate, the disease index were calculated, and the average disease grade of each strain was calculated. The results showed that the incidence, disease index and average disease grade of the transgenic lines were significantly lower than those of the non-transgenic control, indicating that the resistance of VdP4-ATPase transgenic cotton to Verticillium wilt was significantly improved.

11. Genetic transformation of tomato

11.1 Tomato Genetic Transformation Medium

Basic medium: MSB0 (MS inorganic + B5 organic + 30 g / L sucrose, pH 5.8). Solid medium was added to 6 g/L of agar (Murashige and Skoog, 1962; Gamborg et al., 1968);

Co-cultivation medium MSB1: MSB0 + 2.0 mg / L 6-BA + 0.2 mg / L IAA + 100 uM AS (acetosyringone) + 6 g / L agar, pH 5.4;

Screening medium MSB2: MSB1 + 500mg / L cb (carbenicillin) + 100mg / L Km + 6g / L agar, pH 5.8;

Subculture medium MSB3: MSB0 + 200mg / Lcb + 100mg / L Km + 6g / L agar, pH 5.8;

Rooting medium MSB4: MSB0 + 0.5 mg / L IAA + 200 mg / L Cef + 50 mg / L Km + 6 g / L agar, pH 6.0.

11.2 Acquisition of tomato genetically transformed explants

Micro-Tom tomato seed 1% sodium hypochlorite solution was sterilized for 10-15min, then washed with sterile tap water for 5-6 times, inoculated onto MSB0 medium, and the photoperiod of 25°C, 16h light/8h dark was about 7d after germination, and the growth was strong. The flat, sterile seedling cotyledons are cut at both ends, and about 2/3 of the middle part is reserved for Agrobacterium-mediated transformation of the explants.

11.3 Preparation of Agrobacterium Dyeing Solution for Transformation

The preparation of Agrobacterium for transformation was carried out in the same manner as in Example 7.3. After centrifugation of the cultured Agrobacterium liquid, the cells were resuspended by adding the same volume of MSB0 liquid medium, and the resuspension was the Agrobacterium infusion solution for transformation.

11.4 Tomato Genetic Transformation

Referring to the method of Cortina et al. (2004), cotyledons of about 7 days old sterile seedlings were used as explants, and genetic transformation was carried out by Agrobacterium tumefaciens-mediated method.

After the Agrobacterium infusion solution was used to infiltrate the explants for 10 minutes, the bacterial liquid was decanted, and the excess bacterial liquid on the surface of the explants was aspirated by sterile absorbent paper, and then inoculated into a co-culture medium MSB1 with a layer of sterile filter paper, and dark co-cultured at 25 °C. 2d. After the co-culture was completed, the explants were inoculated into the screening medium MSB2 for differentiation culture, and cultured at 25 ° C, 16 h light / 8 h dark photoperiod for 2 weeks, and then the explants were subcultured into MSB3 medium to induce callus formation. Once every 2 weeks. After the Km-resistant shoots were produced, the shoots were excised and inoculated into MSB4 rooting medium to obtain Km-resistant regenerated plants. Regenerated seedlings with a root length of 3-5 cm are transplanted into a greenhouse to grow into seedlings.

Molecular identification of 11.5 transgenic tomato and acquisition of transgenic plants

The regenerated tomato plants were subjected to GUS histochemical staining and PCR amplification identification according to the method of Example 6. The GUS histochemical staining of tomato leaves showed that the blue (right) plants shown in Figure 14 were transgenic plants, and 30 VdP4-ATPase transgenic tomato plants were obtained by GUS histochemical staining, in order to further determine the GUS organization. The VdP4-ATPase gene was integrated into the plants positively stained by chemical staining. All the regenerated plants extracted the total DNA of the leaves, and then the DNA was used as a template to synthesize sequence 3 and sequence 4 as primers to amplify the fragment of VdP4-ATPase gene. The results showed that all GUS-positive plants were able to amplify the target-specific band of the VdP4-ATPase (about 200 bp) gene (Fig. 15). The results of PCR amplification indicated that the VdP4-ATPase gene was integrated into the VdP4-ATPase plants positive for GUS staining. Thirty VdP4-ATPase transgenic plants were obtained by GUS histochemical staining and PCR amplification. All of these transformant T ₀ plants were used for disease resistance identification analysis.

12. Resistance of transgenic tomato to Verticillium wilt

The transgenic tomato plants obtained by carrying out the genetic transformation and molecular identification of Example 11 were grown to 4-6 leaves in the greenhouse, and the roots were treated with a surgical blade at about 1-2 cm from the plant, and each plant was symmetrically wounded and then each 15 mL of the L2-1 inoculum prepared in Example 5.1 was poured and cultured in a culture chamber at 22 ° C (nighttime) -26 ° C (daytime). On the 20th day of inoculation, the disease grade of the transgenic plants was counted according to the standard of Example 7.2.

The results of disease resistance identification showed (Table 2). On the 30th day of inoculation, the wild type control (regenerated wild type plants) had an average disease grade of 3.13 and a disease index of 78.33. The average disease level of 30 VdP4-ATPase transformants was 1.63. The index was 40.83, and the disease index of the transgenic lines was reduced by 37.50 compared to the non-transgenic controls. At 30 days after inoculation, there were 18 transformants in 30 VdP4-ATPase transformants with no more than 1 disease grade. The transgenic plants with improved extractability showed only mild symptoms in the bottommost leaves, while the non-transgenic control plants had more than 3 disease grades. And the middle and upper leaves have begun to turn green and yellow (Figure 16).

The results of disease resistance identification showed that the VdP4-ATPase gene could significantly improve the resistance of transgenic tomato to Verticillium wilt.

Table 2 Inoculation of Verticillium dahliae for 30 days, the disease grade and disease index of transgenic tomato

WT: wild type control; VdP: VdP4-ATPase transgenic tomato.

Using all plants were inoculated with bacteria of root filling Verticillium dahliae spore suspension ⁽¹⁰⁷ spores / mL), seeded 30d, by five standard 0-4 scale level of each statistical disease transformant, and then calculate all Mean grade and disease index of transformants and controls. The non-transgenic controls were all onset, with an average disease grade of 3.13 and a disease index of 78.33. The disease grade and disease index of VdP4-ATPase transgenic tomato decreased significantly.

references

1.Chen Xusheng,Chen Yongzhen,Huang Junxi.Biochemical characteristics of exogenous protein of Verticillium dahliae strain VD8.Jiangsu Journal of Agricultural Sciences,1998,14(2):126-128.

2. Xiao Songhua, Wu Qiaojuan, Liu Jianguang, Di Jiachun, Xu Naiyin, Chen Xusheng. Creation of new high quality cotton germplasm against Verticillium wilt. Jiangxi Cotton, 2006, 6:10-14.

3. Agrios GN., Plant pathology, 5th edn.. USA, UK: Elsevier Academic Press, 2005.

4. Anita Grover and R. Gowthaman., Strategies for development of fungus-resistant transgenic plants. Science, 2003, 84: 330-340.

5.Bhat, R.G. and Subbarao, K.V., Host range specificity in Verticillium dahliae. Phytopathology, 1999, 89: 1218-1225.

6. Fradin EF, Bart PHJ, Thomma BPHJ., Physiology and molecular aspects of Verticillium wilt diseases caused by V.dahliae and V.albo-atrum. Molecular Plant Pathology, 2006, 7: 71–86.

7. Gamborg O.L., Miller R.A., Ojima K., Nutrient requirements of suspension cultures of soybean root cell. Experimental Cell Research, 1968, 50: 151-158.

8. Joseph Sambrook and David W. Russell., Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001.

9. Kawchuk, L.M., Tomato Ve disease resistance genes encode cell surface-like receptors. Proceedings of the National Academy of Sciences, 2001, 98(11): 6511-6515.

10. Klosterman SJ, Atallah ZK, Vallad GE, Subbarao KV., Diversity, pathogenicity, and management of Verticillium species. Annual Review of Phytopathology, 2009, 47: 39-62.

11. Murashige, T., Skoog, F., A revised medium for rapid growth and biological assays with tobacco tissue cultures. Physiologia plantarum, 1962, 15(3): 473-497.

12. Ortina C and Culianez-Macia FA., Tomato transformation and transgenic plant production. Plant cell, Tissue and Organ Culture, 2004, 76: 269-275.

13. Pegg GF, Brady BL., Verticillium wilts. New York: CABI Publishing, 2002, P432.

14. Powelson ML, Rowe RC., Biology and management of early dying of potatoes. Annual Review of Phytopathology, 1993, 31: 111-26.

15. Richard A. Jefferson, T.A.K. and Bevan, M.W., GUS fusions: B-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. European Molecular Biology Organization, 1987, 6(13): 3901-3907.

16.Rowe RC, Davis JR, Powelson ML, Rouse DI., Potato early dying: causal agents And management strategies. Plant Disease, 1987, 71: 482-89.

17. Rowe RC, Powelson ML., Potato early dying: management challenges in a changing production environment. Plant Disease, 2002, 86: 1184-93.

18. Shenk R.U., Hildebrandt A.C., Medium and techniques for induction and growth of monocotyledonous and dicotyledonous plant cell cultures. Canadian Journal of Botany, 1972, 50: 199-204.

19. Subbarao KV, Hubbard JC, Greathead AS, Spencer GA., Compendium of Lettuce Diseases, 1997, 26-27.

20. Talboys P W., A culture-medium aiding the identification of Verticillium alboatrumand V.dahlaie, Plant Pathology, 1961, 5: 57-58.

21. Y. Bolek, A. A. Bell, K. M. El-Zik, P. M. Thaxton and C. W. Magill., Reaction of Cotton Cultivars and an F2 Population to Stem Inoculation with Isolates Verticillium dahliae. Journal of Phytopathology, 2005, 153: 269-273.

Claims (10)

1. The use of the VdP4-ATPase gene encoding Verticillium dahliae P class ATPase for enhancing plant resistance to Verticillium wilt, wherein a VdP4-ATPase gene is integrated into a target plant to construct a transgenic plant, and the VdP4-ATPase gene is made in a plant Medium expression enhances plant resistance to Verticillium wilt.
2. The use according to claim 1, wherein the nucleotide sequence of the VdP4-ATPase gene is as shown in SEQ ID NO.
3. A method for improving resistance of a plant to Verticillium wilt, wherein the plant is resistant to Verticillium wilt by expressing a foreign gene encoding a Verticillium dahliae P class ATPase VdP4-ATPase gene.
4. The method of claim 3 comprising the steps of:

   The VdP4-ATPase gene encoding Verticillium dahliae P class ATPase is integrated into the target plant to construct a transgenic plant, and the VdP4-ATPase gene is expressed in the plant.
5. The method of claim 3 comprising the steps of:

   1) constructing a recombinant plant expression vector containing a VdP4-ATPase gene encoding a P. aeruginosa PTP class ATPase;

   2) introducing the recombinant plant expression vector into a target plant such that the VdP4-ATPase gene is constitutively expressed in the target plant;

   3) Obtaining transgenic plants with enhanced resistance to Verticillium wilt.
6. The method of claim 3, wherein the nucleotide sequence of the VdP4-ATPase gene encoding Verticillium dahliae class P ATPase is as shown in SEQ ID NO.
7. The method according to any one of claims 3 to 6, wherein the target plant is tomato, tobacco or cotton.
8. The method of claim 5, wherein the recombinant plant expression vector of step 1) has a structure as shown in FIG.
9. A method for preparing a transgenic plant having resistance to Verticillium wilt, comprising the steps of:

   i) obtaining a VdP4-ATPase gene encoding Verticillium dahliae P class ATPase, and operably inserting the gene into a plant expression vector to construct a plant expression vector;

   Ii) transforming the host with the plant expression vector obtained in step i) to obtain a transformant;

   Iii) transforming the plant with the transformant obtained in the step ii) to obtain a transgenic plant.
10. The production method according to claim 9, wherein the nucleotide sequence of the VdP4-ATPase gene encoding Verticillium dahliae class P ATPase is shown in SEQ ID NO.

Images