WO2017000089A1

WO2017000089A1 - Biotechnological breeding method for obtaining antiviral seedless grapes

Info

Publication number: WO2017000089A1
Application number: PCT/CN2015/000519
Authority: WO
Inventors: 田莉莉; 牛良
Original assignee: 中国农业科学院郑州果树研究所
Priority date: 2015-06-30
Filing date: 2015-08-12
Publication date: 2017-01-05
Also published as: CN104988179A

Abstract

Disclosed is a biotechnological breeding method for obtaining antiviral seedless grapes. The method comprises the following steps: obtaining zygotic embryos containing seedless genes by carrying out hybridization between varieties of seedless grapes and embryo rescue, and inducing grape somatic embryogenesis by means of the zygotic embryos; and carrying out agrobacterium tumefaciens-mediated genetic transformation by using RNAi antiviral vectors containing conservative gene segments of grape virus coat protein (CP), so that a grape material which is both antiviral and seedless can be obtained from transformed regeneration plants.

Description

Biotechnology breeding method for obtaining antiviral seedless grape

Technical field

The invention belongs to the technical field of agricultural biotechnology breeding, and particularly relates to a biotechnology breeding method for obtaining antiviral seedless grapes.

Background technique

Grape is one of the oldest fruit tree species in the world. It is popular among domestic and foreign consumers for its succulent, nutritious and multi-health functions. In recent years, the demand for table grape varieties in the domestic and foreign markets has also come. The higher, especially the non-nuclear grapes are more and more popular, and the existing seedless grape varieties can no longer meet the production needs. At the same time, grapes are also the most fruit species of the virus species [Martelli et al. Grapevine virology highlights: 2010-2012. Proceedings of the 17th Congress of ICVG, Davis, Califomia, USA, 2012: 13-31]. In recent years, grapes have been developed in various parts of China, and introductions have been frequent between regions. The virus itself can spread long distances with seedlings, leading to the spread of diseases in some places. According to the survey [Liu Xiao et al. Viral disease identification and health status evaluation of some grape varieties. Journal of Fruit Science, 2006, 23 (6): 846-849], most of the main varieties and rootstocks in China are generally poisonous, and some varieties are poisonous. The strain rate is almost 100%. Among them, grape leaf fan virus (GFLV), grape leaf curl virus (GLRaV, the main pathogen is GLRaV-3) grape virus A (GVA) and grape virus B (GVB) are the four most dangerous viruses in production. At present, grape virus disease has become an urgent problem in the production of fruit trees in China. There is no effective drug control method in the world under the current technical level, and breeding resistant varieties is undoubtedly the most economical and effective way.

The theory of modern grape breeding [Ramming et al. Hybridization of seedless grapes. Vitis, 1990 (Special issue): 439-444] believes that the use of "nuclear-free × non-nuclear" grape varieties hybridization, easy to obtain non-nuclear by embryo rescue method In the offspring, the proportion of non-nuclear types in hybrid offspring can reach more than 80%. At present, this biotechnology breeding method has been successfully applied to the field of seedless grape breeding technology [Teachless grape breeding for disease resistance by using embryo rescue.Vitis, 2008, 47(1): 15-19; Tian Lili et al. .Breeding of disease-resistant seedless grapes using Chinese wild Vitis spp. I. In vitro embryo rescue and plant development. Scientia Horticulturae, 2008, 117(2): 136-141]. At the same time, in plant antiviral breeding, the use of plant coat protein gene to transform plants is currently the main means of breeding resistant varieties. In recent years, the development of RNAi technology has provided a new strategy for plant transgenic antiviral. Previous studies have shown that RNAi vectors constructed by transforming all or part of the viral coat protein gene can obtain disease-resistant transgenic plants [Zhu Changxiang et al. Cultivation of PVY, TMV and CMV Transgenic Tobacco. China Agricultural Sciences, 2008, 41(4): 1040-1047]. Most researchers in the construction of RNAi vectors usually select relatively conserved fragments in the viral genome as interference fragments, which can also reduce the loss of disease resistance of transgenic plants caused by viral mutations [Xu et al. Conserved sequences of replicas gene- Mediated resistance to Potyvirus through RNA silencing. Journal of Plant Biology, 2009, 52(6): 550-559].

At present, the commonly used method of embryo rescue technology to cultivate seedless grape has some inadequacies: most of the non-nuclear grapes cultivated in production belong to the Eurasian species, although the quality is good but the disease resistance is generally poor. It is easy to obtain “nuclear-free × non-nuclear” non-nuclear offspring, but the obtained non-nuclear grapes are often less resistant to disease than the parents, and are more vulnerable to various viruses in nature. Therefore, relying solely on embryos to save this single organism The non-nuclear grapes obtained by technical means have great defects in antiviral diseases.

The disadvantages of using traditional grape transgenic technology to cultivate antiviral grapes are as follows: (1) It is necessary to use the complete gene translation strategy, and the genetically modified products cannot eliminate safety hazards; (2) the antiviral response of transformed plants is mostly delayed, which is disease-resistant; 3) If the exogenous gene fragment is too large, it is prone to the phenomenon that only the partial introduction or introduction of the gene of interest can only be partially expressed; (4) The high disease resistance of the transformed plant often requires multiple copies.

At present, although the new seedless grape varieties can be cultivated by the method of embryo rescue, since most of the seedless grapes belong to the Eurasian species, the shortcomings of poor disease resistance are common, and the single biotechnology means of embryo rescue is obtained. Nuclear grape offspring are often less resistant to disease than their parents and are more susceptible to various viruses.

Summary of the invention

The object of the present invention is to provide a biotechnology breeding method for obtaining antiviral seedless grape. In the field of seedless grape breeding technology, the embryo rescue technology and the transgenic two biotechnology methods are organically fused in the non-nuclear grape hybrid embryo. In the process of in vitro culture, the embryoid body induced by the zygotic embryo with the non-nuclear gene is used as a transgenic receptor material, and an RNAi antiviral vector containing the viral coat protein gene is introduced to obtain an antiviral disease. Nuclear grape regeneration plant new material.

The technical solution adopted by the invention is a biotechnology breeding method for obtaining antiviral seedless grapes, comprising the following steps:

Step 1. Obtaining a grape zygotic embryo with a non-nuclear gene by crossing between the seedless grape varieties and embryo rescue;

Step 2. Inducing the growth of grape somatic embryos by zygotic embryos;

Step 3. Construct an RNAi antiviral plant expression vector and transfer it to Agrobacterium tumefaciens;

Step 4. Agrobacterium transforms the somatic embryo derived from the zygotic embryo to obtain a regenerated plant.

The invention also features:

In step 1, the grape zygotic embryo with the non-nuclear gene obtained by hybridization and embryo rescue of the seedless grape variety is specifically:

Step 1.1: Artificial emasculation of the female parent species 3 days before flowering, the inflorescences after emasculation are immediately sprayed clean with water and bagged and tagged;

Step 1.2: On the 2-3rd day after the emasculation, the father's pollen is collected by the brush and scattered on the stigma of the female parent for artificial pollination;

Step 1.3: After 6 weeks of pollination, the young fruit was collected in the field, rinsed with tap water for 10 min; soaked in 70% alcohol for 1 minute on the ultra-clean workbench, then immersed in 0.1% HgCl _{2 for} 8 minutes, rinsed 4 times with sterile water. ;

Step 1.4: The sterilized fruit pieces are placed in a sterilized culture dish, and the ovules are taken out under aseptic conditions, and inoculated on the zygotic embryo development medium for ovule endogenous culture, and the zygotic embryo development medium is solid-liquid two-phase. TL medium;

Step 1.5: After the ovule is cultured on the zygotic embryo development medium for 6 weeks, the developing immature embryos are taken out under aseptic conditions, and inoculated on the solid embryogenic callus induction medium; that is, the grape zygotic embryo with the non-nuclear gene is obtained. .

The composition and content of TL medium are as follows: calcium nitrate 250.0 mg / L, potassium nitrate 600.0 mg / L, potassium chloride 75.0 mg / L, ammonium nitrate 300.0 mg / L, magnesium sulfate 1200.0 mg / L, potassium dihydrogen phosphate 300.0mg/L, manganese sulfate 3.0mg/L, potassium iodide 0.8mg/L, boric acid 0.5mg/L, zinc sulfate 0.5mg/L, sodium selenite 0.25mg/L, cobalt chloride 0.025mg/L, copper sulfate 0.025mg/L, sodium molybdate 0.025mg/L, ferric citrate 10.0mg/L, thiamine hydrochloride 0.25mg/L, pyridoxine hydrochloride 0.25mg/L, D-pantothenate 0.25mg/L, nicotinic acid 0.25mg/L, asparagine 300mg/L, glycine 5.0mg/L, arginine 2.0mg/L, inositol 50.0mg/L, hydrolyzed casein 500.0mg/L, L-cysteine 121.16mg/ L, sucrose 30000mg / L, agar 6000mg / L, the rest is distilled water, which added 6.0g / L sucrose, activated carbon 1.5g / L; step 1.5 in the induction medium: embryogenic callus induction medium composition of TL +0.5 mg/L 6-BA + 1.0 mg/L 2,4-D, with 30 g/L of sucrose and 6.0 g/L of agar.

In step 2, the somatic embryos induced by zygotic embryos are specifically:

Step 2.1, inoculation of the hybrid zygotic embryo obtained in step 1 on a solid embryogenic callus induction medium;

Step 2.2: After the zygotic embryo is cultured on the embryogenic callus induction medium for 4 weeks, the obtained yellow, granular, and compact embryogenic callus is inoculated on the solid somatic embryo differentiation medium;

Step 2.3: After the embryogenic callus is cultured on the somatic embryo differentiation medium for 4 weeks, a large number of somatic embryos can be induced, and at this time, most somatic embryo development stages are in the cotyledon stage.

The composition of the embryogenic callus induction medium in step 2.1 is TL+0.5mg/L6-BA+1.0mg/L 2,4-D, wherein sucrose 30g/L and agar 6.0g/L are added; step 2.3 The composition of the medium somatic embryo differentiation medium was TL+0.5 mg/L 6-BA+2.0 mg/L NAA, wherein 30 g/L of sucrose and 6.0 g/L of agar were added.

The RNAi antiviral plant expression vector is constructed in step 3 and transferred to Agrobacterium tumefaciens:

Step 3.1, Construction of the entry cloning vector: RNAi interference fragment GV is GFLV, GLRaV-3, GVA and GVB The 825 bp large fragment obtained by sequential concatenation of the four grape virus coat protein genes was sequenced in SEQ ID NO. 1; PCR amplification was carried out with GV upstream primer GV-F and downstream primer GV-R added with linker CACC. The PCR product was subjected to 1.0% agarose gel electrophoresis and the target band was cut and recovered to obtain the blunt-end PCR product containing the interference fragment GV; 6 μL of the ligation reaction system was constructed, and the reaction was carried out at 25 ° C for 30 min, and the product was transformed by heat shock method. E. coli Top10 competent cells were uniformly coated on LB solid medium plates containing 75 mg/L kanamycin, inverted culture at 37 ° C for 16 h, and monoclonal clones were shaken at 37 ° C in LB liquid medium containing the same concentration of Kan. After 14 hours of culture, the length of the amplified fragment was significantly larger than the length of the insert GV, that is, the entry cloning vector was constructed; named pENTR-GV;

Step 3.2: Construction of RNAi vector: LR reaction of the entry vector pENTR-GV and the target vector pHELLSGATE12 to construct a 20 μL LR reaction system; after reacting at 25 ° C for 12 h, the reaction was terminated by adding proteinase K; the reaction product was heat-transformed into E. coli Top10 Competent cells were uniformly coated on LB medium plates containing 100 mg/L spectinomycin (Spec), inverted culture at 37 ° C for 16 h, and monoclonal cloned into LB liquid medium containing the same concentration of Spec in shaking culture at 37 ° C for 14 h. After extracting the plasmid, the plasmid was digested with Xho I and Xba I, and the pHELLSGATE12 was used as a control. The recombinant plasmid after LR reaction was digested with Xho I and Xba I, and the fragment size was 917 bp and 915 bp, respectively. Significantly different from the fragment size of unreacted PHELLSGATE12 empty-cut (1429 bp for Xho I and 1419 bp for Xba I), the recombinant plasmid was constructed as RNAi vector and named PH12- GV;

Step 3.3: RNAi vector transformation Agrobacterium tumefaciens: The PH12-GV vector was transformed into Agrobacterium strain EHA105 competent cells, and uniformly coated on YEB plate medium containing 50 mg/L rifampicin and 100 mg/L spectinomycin, 28 Incubate for 48 h under °C conditions, pick the monoclonal to the same concentration of rifampicin and spectinomycin in YEB liquid medium for 28 h at 28 °C, and use GV-F and GV-R as primers for PCR amplification. After electrophoresis on a 1.0% agarose gel, the PCR product was a 829 bp fragment, and the RNAi plant expression vector engineering strain was transformed and named EH-GV.

The sequence of the GV-F upstream primer GV-F is shown in SEQ ID NO. 2, specifically: CACCATGGGTGATGAGCTTTGATGC; the sequence of the downstream primer of the GV is shown in SEQ ID NO. 3, specifically: TAGACTCTCAAGCTTGCTAA;

The PCR reaction system in step 3.1 and step 3.3 is: 10×Buffer 5 μL, dNTP mixtuer 5 μL, 10 μmol/L GV-F 2 μL, 10 μmol/L GV-R 2 μL, Pfu DNA Polymerase 1 μL, template 1 μL, sterilization double 34μL of distilled water, the total volume of 50μL; PCR reaction parameters: pre-denaturation at 94 °C for 5min; denaturation at 94 °C for 30s, annealing at 56 °C for 30s, extension at 72 °C for 40s, a total of 35 cycles; 72 °C extension for 10min;

The sequence of M13-F is shown in SEQ ID NO. 4, specifically: GTAAAACGACGGCCAGT.

The ligation reaction system used in step 3.1 is: recovery of the target gene fragment GV 1 μL, salt solution 1 μL, pENTR ^TM /SD/

Vector 1 μL, 3 μL of sterile ultrapure water.

The Xba I digestion system in step 3.2 is: Xba I 1 μL, 10×M Buffer 2 μL, 0.1% BSA 2 μL, LR reaction product 6 μL, sterile ultrapure water 9 μL; Xho I digestion system: Xho I 1 μL, 10× H Buffer 2 μL, LR reaction product 6 μL, and sterile ultrapure water 11 μL.

The LR reaction system in the step 3.2 was: pENTR-GV 2 μL, pHELLSGATE 12, 2 μL, LR clonase enzyme mix 4 μL; Sterile water 12 μL.

In step 4, the Agrobacterium-derived zygotic embryo-derived somatic embryos obtain regenerated plants as follows:

Step 4.1, at 28 ° C, 200 rpm, the RNAi plant expression vector engineering strain EH-GV transformed with Agrobacterium was shake cultured in YEB liquid medium containing 50 mg/L rifampicin for 48 hours until the OD value was about 0.5. After centrifugation at 5000 rpm for 10 minutes, the precipitated cells were collected, resuspended in an equal volume of WPM liquid medium, and the somatic embryo obtained in step 2.3 was inoculated with Agrobacterium liquid for 10-15 minutes;

Step 4.2: The infected somatic embryo is placed in a sterile culture dish, and the excess bacterial solution is blotted with the sterile filter paper, inoculated on the WPM solid medium, and cultured for 3 days in the dark;

Step 4.3, after inoculation of the infected somatic embryos in WPM + 0.2 mg / L 6 - BA + 50 mg / L kanamycin (Kan) + 200 mg / L cephalosporin (Cef) + 200 mg / L carbenicillin (Carb) medium, cultured for 3 months under the conditions of 16h/8h photoperiod, once every 2 weeks;

Step 4.4, cultivating the resistant bud obtained by germination on 1/2MS+0.2mg/L 吲哚butyric acid (IBA)+25mg/L Kan+200mg/L Cef+200mg/L Carb medium at 16h/8h light Incubate for 2 months under cyclic conditions, subculture every 4 weeks, and the tube seedlings after rooting are expanded on 1/2MS+0.2mg/L IBA+25mg/L Kan+200mg/L Cef+200mg/L Carb medium. Regenerated plants with strong growth and good rooting are cultivated and transplanted in the greenhouse to prepare antiviral seedless grapes.

The beneficial effects of the present invention are as follows: the "endosome embryo" of the acceptor material used for Agrobacterium infection in the transformation of grapes of the present invention is induced by the zygotic embryo of the "nuclear-free × non-nuclear" grape hybrid, which is contained in the acceptor material. The ratio of non-nuclear genes is high (≥80%), so it is easier to obtain antiviral non-nuclear materials in transformed plants after transformation.

Compared with the traditional transgenic method, the main advantages of the RNAi antiviral vector used in the transformation of the grape of the present invention are: (1) the complete gene of the virus is not required, and only the partial fragment of the gene can also play a disease resistance; (2) The inserted gene fragment is small, which is conducive to vector construction and genetic transformation; (3) RNA invading the virus in the transgenic plant is rapidly degraded, and the virus gene is not required to express the protein, and the transgenic product is more safe and reliable; (4) single copy transformation It also produces highly resistant and even immune plants.

The invention combines the seedless grape embryo rescue technology with the transgenic technology, adopts the embryoid body of the seedless grape hybrid immature embryo obtained by embryo rescue as the acceptor material, and utilizes the conserved fragment containing the grape virus coat protein (CP) gene. The RNAi antiviral vector is subjected to Agrobacterium-mediated genetic transformation, and a new grape material which is both antiviral and non-nuclear can be obtained from the transformed plant after transformation, and a new variety is selected.

DRAWINGS

Figure 1 is the PCR identification of the entry cloning vector pENTR-GV, wherein M: DL2000 marker; 1: pENTR-GV with M13-F & GV-R as primer PCR amplification results; 2: pENTR-GV with GV-F & GV-R as primer PCR amplification results;

Figure 2 is a Xho I digestion of the RNAi vector PH12-GV; wherein, M: DL2000 marker; 1: PH12-GV digestion results; 2: pHELLSGATE12 no-load digestion results;

Figure 3 is a Xba I digestion of the RNAi vector PH12-GV of the present invention, wherein M: DL2000 marker; 1: PH12-GV digestion results; 2: pHELLSGATE12 empty-cut digestion results;

Figure 4 is a PCR identification of EH-GV of the present invention; wherein, M: DL2000 marker; 1: EHA105 no-load PCR result; 2-3: PCR result of EH-GV engineering strain;

Figure 5 is a regenerated plant of the somatic embryo derived from the Agrobacterium EH-GV transformed zygotic embryo of the present invention, wherein D-1: somatic embryo after infection by Agrobacterium, D-2: post-embryonic germination of Agrobacterium transformant cells Resistant bud, D-3: Regenerated plant of post-embryo rooting of Agrobacterium tumefaciens cells, D-4: Transgenic plants transplanted into the greenhouse.

detailed description

The present invention will be described in detail below in conjunction with specific embodiments.

Example 1 Obtaining a grape zygotic embryo with a non-nuclear gene by hybridization and embryo rescue between seedless grape varieties:

Step A-1, artificial emasculation of the female cultivar 3 days before flowering (the female parent in this example is “red-faced non-nuclear”), and the inflorescences after emasculation are immediately sprayed with water and bagged and tagged. ;

Step A-2. On the 2-3rd day after emasculation, the father's pollen is taken with a writing brush (in this embodiment, the male parent is "flame without nuclear") scattered on the female stigma for artificial pollination;

Step A-3, 6 weeks after pollination, collect young fruit in the field, rinse with tap water for 10 minutes; soak it in 70% alcohol for 1 minute on the ultra-clean workbench, then soak it in 0.1% HgCl _{2 for} 8 minutes, rinse with sterile water. 4 times;

Step A-4, the disinfected fruit pieces are placed in a sterile culture dish, and the ovules are taken out under aseptic conditions, and inoculated on the zygotic embryo development medium for ovule endogenous culture, and the zygote embryo development medium is solid-liquid double Phase TL medium, its composition and content are as follows: calcium nitrate 250.0mg / L, potassium nitrate 600.0mg / L, potassium chloride 75.0mg / L, ammonium nitrate 300.0mg / L, magnesium sulfate 1200.0mg / L, phosphoric acid Potassium dihydrogen 300.0mg / L, manganese sulfate 3.0mg / L, potassium iodide 0.8mg / L, Boric acid 0.5mg/L, zinc sulfate 0.5mg/L, sodium selenite 0.25mg/L, cobalt chloride 0.025mg/L, copper sulfate 0.025mg/L, sodium molybdate 0.025mg/L, ferric citrate 10.0mg /L, thiamine hydrochloride 0.25mg / L, pyridoxine hydrochloride 0.25mg / L, D - calcium pantothenate 0.25mg / L, niacin 0.25mg / L, asparagine 300mg / L, glycine 5.0mg / L, Arginine 2.0mg/L, inositol 50.0mg/L, hydrolyzed casein 500.0mg/L, L-cysteine 121.16mg/L, sucrose 30000mg/L, agar 6000mg/L, the rest is distilled water, which is attached Sucrose 6.0g / L, activated carbon 1.5g / L;

Step A-5, after the ovule is cultured on the zygotic embryo development medium for 6 weeks, the developing immature embryos are taken out under aseptic conditions, and inoculated on the solid embryogenic callus induction medium, the embryogenic callus induction medium. The composition is TL+0.5mg/L6-BA+1.0mg/L 2,4-D, with 30g/L of sucrose and 6.0g/L of agar; the gene with no nuclear gene (the ratio is above 80%) can be obtained. Grape zygotic embryo.

Example 2 Induction of somatic embryos by zygotic embryo induction

Step B-1, the hybrid zygotic embryo obtained in the step A is inoculated on the solid embryogenic callus induction medium, and the composition of the embryogenic callus induction medium is TL+0.5 mg/L 6-BA+1.0 mg. /L 2,4-D, wherein sucrose 30g / L, agar 6.0g / L;

Step B-2: After the zygotic embryo is cultured on the embryogenic callus induction medium for 4 weeks, the obtained yellow, granular, and compact embryogenic callus is inoculated on the solid somatic embryo differentiation medium. The composition of the somatic embryo differentiation medium is TL+0.5 mg/L 6-BA+2.0 mg/L NAA, wherein 30 g/L of sucrose and 6.0 g/L of agar are added;

Step B-3, after the embryogenic callus is cultured on the somatic embryo differentiation medium for 4 weeks, a large number of somatic embryos can be induced. In this embodiment, most of the somatic embryo development stages are in the cotyledon stage. .

Example 3 Construction of RNAi antiviral plant expression vector and transfer into Agrobacterium tumefaciens

Step C-1 (the construction process of the entry cloning vector), in the present embodiment, the RNAi interference fragment GV is 825 bp obtained by sequentially concatenating the conserved segments of the four grape virus coat protein genes of GFLV, GLRaV-3, GVA and GVB. Large fragment (see SEQ ID NO. 1 for the sequence). PCR amplification was carried out using the GV upstream primer GV-F (the primer sequence is CACCATGGGTGATGAGCTTTGATGC, the sequence is shown in SEQ ID NO. 2) and the downstream primer GV-R (the primer sequence is TAGACTCTCAAGCTTGCTAA, the sequence is shown in SEQ ID NO. 3). The PCR reaction system in this example is: 10×Buffer 5 μL, dNTP mixtuer (2.5 mM of each dNTP) 5 μL, GV-F (10 μmol/L) 2 μL, GV-R (10 μmol/L) 2 μL, Pfu DNA Polymerase 1 μL, 1 μL of template, sterile double distilled water 34 μL, total volume 50 μL. The PCR reaction parameters were: pre-denaturation at 94 ° C for 5 min; (degeneration at 94 ° C for 30 s, annealing at 56 ° C for 30 s, extension at 72 ° C for 40 s) for 35 cycles; 72 ° C for 10 min. The PCR product was subjected to 1.0% agarose gel electrophoresis and the target strip was recovered to obtain a blunt-end PCR product containing the interference fragment (GV). Follow pENTR ^TM /SD/

The kit instructions were used to construct a 6 μL reaction system. The reaction system used in this example was: Recovering the target gene fragment GV 1 μL, salt solution 1 μL, pENTR ^TM /SD/

Vector 1μL, sterile ultrapure water 3μL), reacted at 25°C for 30min, and the product was heat-induced to transform E. coli Top10 competent cells and evenly coated on LB solid medium plate containing 75mg/L kanamycin. Incubate at 37 ° C for 16 h, select monoclonal to LB liquid medium containing the same concentration of Kan in 37 ° C shaking culture for 14 h, respectively, GV-F & GV-R and M13-F (GTAAAACGACGGCCAGT, sequence see SEQ ID NO. 4) & GV Two pairs of primers of -R were subjected to PCR amplification of the bacterial solution, and the PCR product was subjected to 1.0% agarose gel electrophoresis. The PCR reaction system in this example is: 10×Buffer 2 μL, dNTP mixtuer (2.5 mM of each dNTP) 1.6 μL, primer (10 μmol/L) 1 μL each 1 μL, rTaq DNA Polymerase 0.2 μL, template 1 μL, sterile double distilled water 13.2 μL, total volume 20 μL. The PCR reaction parameters are the same as in step C-1. When GV-F and GV-R were used as primers, the amplified product showed a target band of 829 bp (825+4 bases CACC=829 bp) (GV was 825 bp in length), and primers M13-F and When GV-R is a primer, the length of the amplified fragment is significantly larger than the length of the inserted GV, indicating that the tandem gene fragment GV has been ligated into the pENTR/SD/D-TOPO vector, which is identified as a well-established cloning vector. In the examples, it was named pENTR-GV (Fig. 1).

Step C-2 RNAi vector construction process: The entry vector pENTR-GV and the target vector pHELLSGATE12 were subjected to LR reaction, and 20 μL reaction system was constructed according to the Gateway LR Clonase II Enzyme Mix kit instructions. The reaction system of this example was: pENTR-GV 2 μL, pHELLSGATE 12, 2 μL, LR clonase enzyme mix 4 μL, Sterile water 12 μL. After 12 h of reaction at 25 ° C, the reaction was stopped by the addition of proteinase K. The reaction product was heat-transformed into E. coli Top10 competent cells, uniformly coated on LB medium plate containing 100 mg/L spectinomycin, inverted culture at 37 ° C for 16 h, and picked up to LB liquid medium containing the same concentration of Spec. After incubating for 14 h at 37 ° C, the plasmid was extracted and then digested with Xho I (Fig. 2) and Xba I (Fig. 3) (with pHELLSGATE12 empty control as control). In this example, the Xba I digestion system was: Xba I 1μL, 10x M Buffer 2μL, 0.1% BSA2μL, LR reaction product 6μL, sterile ultrapure water 9μL; Xho I digestion system: Xho I 1μL, 10x H Buffer 2μL, LR reaction product 6μL, sterilized ultrapure water 11μL . If the recombinant plasmid after LR reaction was digested by Xho I and Xba I, the fragment size was about 900 bp, and the size of the fragment was significantly different from that of unreacted PHELLSGATE12 (Xho I was 1429 bp). The Xba I excised fragment was 1419 bp), and it was confirmed that the recombinant plasmid was a constructed RNAi vector, which was named PH12-GV in this example.

Step C-3 (RNAi vector transformation of Agrobacterium tumefaciens), transforming PH12-GV vector into Agrobacterium strain EHA105 competent cells, uniformly coated on YEB plate containing 50 mg/L rifampicin and 100 mg/L spectinomycin On the base, incubate at 48 °C for 48 h, pick the monoclonal to the same concentration of rifampicin and spectinomycin in YEB liquid medium for 28 h at 28 °C, and use GV-F&GV-R as primer to carry out bacterial PCR amplification. Increase, 1.0% agarose gel electrophoresis, PCR reaction system and reaction parameters are the same as step C-1. If a fragment of 829 bp (825+4 bases CACC=829 bp) appears (Fig. 4), it is identified as RNAi plant expression vector engineering. The strain has been transformed, and is named EH-GV in this embodiment.

Example 4 Agrobacterium transforms zygotic embryo-derived somatic embryos to obtain regenerated plants

Step D-1, 28 ° C, 200 rpm, the RNAi plant expression vector engineering strain EH-GV transformed with Agrobacterium was shake cultured in YEB liquid medium containing 50 mg/L rifampicin for 48 hours until the OD value was about After centrifugation at 0.5, 5000 rpm for 10 minutes, the precipitated cells were collected, resuspended in an equal volume of WPM liquid medium, and the somatic embryos obtained in the step B-3 were inoculated with Agrobacterium liquid for 10-15 minutes.

Step D-2, the infected somatic embryos are placed in a sterile culture dish, and the excess bacterial solution is blotted with the sterilized filter paper, inoculated on a WPM solid medium, and cultured for 3 days in the dark.

Step D-3, after inoculation of the infected somatic embryos in WPM + 0.2 mg / L 6 - BA + 50 mg / L kanamycin (Kan) + 200 mg / L cephalosporin (Cef) + 200 mg / L carboxy The cells were cultured on benzylpenicillin (Carb) medium for 3 months under the conditions of 16 h/8 h photoperiod, and subcultured every 2 weeks.

Step D-4, culturing the resistant bud obtained by germination in 1/2MS+0.2mg/L indolebutyric acid (IBA)+25mg/L kanamycin (Kan)+200mg/L Cef+200mg/L Carb culture On the base, cultured for 2 months under the photoperiod of 16h/8h, once every 4 weeks, the test tube seedlings after rooting were 1/2MS+0.2mg/L IBA+25mg/L Kan+200mg/L Cef+200mg/LCarb After expanding the culture on the medium, the regenerated plants with strong growth and good rooting are selected for refining and transplanting in the greenhouse. Specifically, the plants with good root development under in vitro conditions are washed with water after being reheated in the greenhouse. The attached agar is transplanted into a nutrient bowl containing nutrient soil, and the lived seedlings are routinely managed to develop into a robust grape plant.

Example 5 Identification of Antiviral Characteristics of Transgenic Grapes

Step E-1, the grape diseased leaves of the diseased plants in the field were thoroughly ground with 10 volumes of 0.05 mmol/L phosphate buffer (pH = 7.2), centrifuged at 4000 rpm for 10 minutes, and the supernatant was taken as a virus extract.

Step E-2. After surface disinfection of the leaves with 70% alcohol, dry them thoroughly. After rubbing the upper surface of the leaves with quartz sand to make a slight wound, use the fingers to pick up the virus extract and inoculate the seeds into the young leaves of the grapes. The plants were inoculated with 5 leaves, and the untransformed plants were inoculated as a control. After 20 days, the plants were tested with DAS-ELISA.

Step E-3, take 100 mg of the top leaves of the test plants, grind in 1 ml of PBS buffer, centrifuge, and take the supernatant, and dilute the antibody to 1 g with 0.1 mol/L (pH 9.6) carbonate coating buffer. /m L coated with EL ISA plate, 100uL per well, incubate for 4h at 37°C; wash plate with PBST buffer for 3 times, add 100uL of virus juice per well, overnight at 4°C; wash plate with PBST for 3 times to dry and add 1/ The 4000 diluted conjugated antibody was incubated at 100 uL per well for 3 h at 37 ° C; the plate was washed 4 times with PBST, patted dry, 100 uL of substrate was added to each well, and the absorbance (OD ₄₀₅ ) was read at 405 nm after 1 h. The virus-free tube seedling "ruby seedless" is used as a negative control. If the ratio of the absorbance of a plant read to the negative control absorbance is greater than 2.5, it is a positive reaction (plant poison), which is considered as a susceptibility reaction, otherwise For the negative reaction (plants without toxicity), it was identified as the disease resistance reaction, and the identification results are shown in Table 1.

Table 1 Identification of disease resistance after transgenic plant virus inoculation

The results in Table 1 show that the control plants showed a susceptibility response to the four viruses after virus inoculation, and the transgenic plants obtained after transformation showed the disease resistance reaction in most cases. Among the four transgenic lines obtained, the strains TrGV-1, TrGV-3, and TrGV-4 showed the most serious four viruses (GFLV, GLRaV-3, GVA, GVB) in grape production. The reaction; the strain TrGV-2 showed only a disease for the virus GVB, but showed resistance to the other three viruses. It indicated that the virus accumulation of these transgenic plants was significantly reduced after inoculation of the virus, and thus the disease resistance was significantly improved.

Claims

A biotechnology breeding method for obtaining antiviral seedless grapes, characterized in that the method comprises the following steps:

Step 1. Obtaining a grape zygotic embryo with a non-nuclear gene by crossing between the seedless grape varieties and embryo rescue;

Step 2. Inducing the growth of grape somatic embryos by zygotic embryos;

Step 3. Construct an RNAi antiviral plant expression vector and transfer it to Agrobacterium tumefaciens;

Step 4. Agrobacterium transforms the somatic embryo derived from the zygotic embryo to obtain a regenerated plant.
The method for breeding an antiviral seedless grape according to claim 1, wherein the grape zygotic embryo with the non-nuclear gene obtained by the hybridization between the seedless grape varieties and the embryo rescue in the step 1 is specifically:

Step 1.1: Artificial emasculation of the female parent species 3 days before flowering, the inflorescences after emasculation are immediately sprayed clean with water and bagged and tagged;

Step 1.2: On the 2-3rd day after the emasculation, the father's pollen is collected by the brush and scattered on the stigma of the female parent for artificial pollination;

Step 1.3: After 6 weeks of pollination, the young fruit was collected in the field, rinsed with tap water for 10 min; soaked in 70% alcohol for 1 minute on the ultra-clean workbench, then immersed in 0.1% HgCl 2 for 8 minutes, rinsed 4 times with sterile water. ;

Step 1.4: The sterilized fruit pieces are placed in a sterilized culture dish, and the ovules are taken out under aseptic conditions, and inoculated on the zygotic embryo development medium for ovule endogenous culture, and the zygotic embryo development medium is solid-liquid two-phase. TL medium;

Step 1.5: After the ovule is cultured on the zygotic embryo development medium for 6 weeks, the developing immature embryos are taken out under aseptic conditions, and inoculated on the solid embryogenic callus induction medium; that is, the grape zygotic embryo with the non-nuclear gene is obtained. .
The method for breeding an antiviral seedless grape according to claim 2, wherein the composition and content of the TL medium are as follows: calcium nitrate 250.0 mg/L, potassium nitrate 600.0 mg/L, chlorine Potassium 75.0mg / L, ammonium nitrate 300.0mg / L, magnesium sulfate 1200.0mg / L, potassium dihydrogen phosphate 300.0mg / L, manganese sulfate 3.0mg / L, potassium iodide 0.8mg / L, boric acid 0.5mg / L, sulfuric acid Zinc 0.5mg/L, sodium selenite 0.25mg/L, cobalt chloride 0.025mg/L, copper sulfate 0.025mg/L, sodium molybdate 0.025mg/L, ferric citrate 10.0mg/L, thiamine hydrochloride 0.25mg/L, pyridoxine hydrochloride 0.25mg/L, D-pantothenate 0.25mg/L, niacin 0.25mg/L, asparagine 300mg/L, glycine 5.0mg/L, arginine 2.0mg/L , inositol 50.0mg / L, hydrolyzed casein 500.0mg / L, L-cysteine 121.16mg / L, sucrose 30000mg / L, agar 6000mg / L, the rest is distilled water, which added 6.0g / L sucrose, activated carbon 1.5g/L; the induction medium in step 1.5 is: the composition of the embryogenic callus induction medium is TL+0.5mg/L6-BA+1.0mg/L 2,4-D, and 30g/L of sucrose is added. Agar 6.0g/L.
The method for breeding an antiviral seedless grape according to claim 2, wherein the somatic embryo induced by the zygotic embryo in the step 2 is specifically:

Step 2.1, inoculation of the hybrid zygotic embryo obtained in step 1 on a solid embryogenic callus induction medium;

Step 2.2: After the zygotic embryo is cultured on the embryogenic callus induction medium for 4 weeks, the obtained yellow, granular, and compact embryogenic callus is inoculated on the solid somatic embryo differentiation medium;

Step 2.3: After the embryogenic callus is cultured on the somatic embryo differentiation medium for 4 weeks, a large number of somatic embryos can be induced, and at this time, most somatic embryo development stages are in the cotyledon stage.
The method for breeding an antiviral seedless grape according to claim 4, wherein the component of the embryogenic callus induction medium in the step 2.1 is TL+0.5 mg/L6-BA+1.0 mg. /L 2,4-D, wherein sucrose 30g / L, agar 6.0g / L; the composition of the somatic embryo differentiation medium in step 2.3 is TL + 0.5mg / L 6-BA + 2.0mg / L NAA Among them, 30 g/L of sucrose and 6.0 g/L of agar were added.
The method for breeding an antiviral seedless grape according to claim 4, wherein the RNAi antiviral plant expression vector is constructed in the step 3 and transferred to the Agrobacterium tumefaciens:

Step 3.1: Construction of the entry cloning vector: The RNAi interference fragment GV is a large fragment of 825 bp obtained by sequential concatenation of the conserved segments of the four grape virus coat protein genes of GFLV, GLRaV-3, GVA and GVB, and the sequence is shown in SEQ ID NO. PCR amplification was carried out with the GV upstream primer GV-F and the downstream primer GV-R with the addition of the linker CACC. The PCR product was subjected to 1.0% agarose gel electrophoresis and the target strip was recovered to obtain a blunt end containing the interference fragment GV. The PCR product was constructed by constructing 6 μL of ligation reaction system, reacting at 25 ° C for 30 min, and transforming the product by heat shock method to transform E. coli Top10 competent cells, and uniformly coating on LB solid medium plate containing 75 mg/L kanamycin, 37 Incubate in °C for 16h, select monoclonal to LB liquid medium containing the same concentration of Kan in 37 °C shaking culture for 14h, the length of the amplified fragment is significantly larger than the length of the insert GV, that is, construct the entry cloning vector; named pENTR-GV ;

Step 3.2: Construction of RNAi vector: LR reaction of the entry vector pENTR-GV and the target vector pHELLSGATE12 to construct a 20 μL LR reaction system; after reacting at 25 ° C for 12 h, the reaction was terminated by adding proteinase K; the reaction product was heat-transformed into E. coli Top10 Competent cells were uniformly coated on LB medium plates containing 100 mg/L spectinomycin (Spec), inverted culture at 37 ° C for 16 h, and monoclonal cloned into LB liquid medium containing the same concentration of Spec in shaking culture at 37 ° C for 14 h. After extracting the plasmid, the plasmid was digested with Xho I and Xba I, and the pHELLSGATE12 was used as a control. The recombinant plasmid after LR reaction was digested with Xho I and Xba I, and the fragment size was 917 bp and 915 bp, respectively. Significantly different from the fragment size of unreacted PHELLSGATE12, the fragment was 1429 bp in Xho I and 1419 bp in Xba I. The recombinant plasmid was constructed as RNAi vector. Named PH12-GV;

Step 3.3: RNAi vector transformation Agrobacterium tumefaciens: The PH12-GV vector was transformed into Agrobacterium strain EHA105 competent cells, and uniformly coated on YEB plate medium containing 50 mg/L rifampicin and 100 mg/L spectinomycin, 28 Inverted cultured for 48 h at °C, and picked the monoclonal to the YEB solution containing the same concentration of rifampicin and spectinomycin. The medium was shaken at 28 °C for 48 h, and GV-F and GV-R were used as primers for PCR amplification, 1.0% agarose gel electrophoresis, PCR product was 829 bp fragment, RNAi plant expression vector engineering strain Converted, named EH-GV.
The method for obtaining an antiviral seedless grape according to claim 6, wherein the sequence of the upstream primer GV-F of the GV is as shown in SEQ ID NO. 2, specifically: CACCATGGGTGATGAGCTTTGATGC; The sequence of the downstream primer of GV is shown in SEQ ID NO. 3, specifically: TAGACTCTCAAGCTTGCTAA;

The PCR reaction system in the steps 3.1 and 3.3 is: 10×Buffer 5 μL, dNTP mixtuer 5 μL, 10 μmol/L GV-F 2 μL, 10 μmol/L GV-R 2 μL, Pfu DNA Polymerase 1 μL, template 1 μL, sterilization Double distilled water 34μL, total volume 50μL; PCR reaction parameters: pre-denaturation at 94 °C for 5min; denaturation at 94 °C for 30s, annealing at 56 °C for 30s, extension at 72 °C for 40s, a total of 35 cycles; 72 °C extension for 10min;

The sequence of the M13-F is shown in SEQ ID NO. 4, specifically: GTAAAACGACGGCCAGT.

The ligation reaction system used in step 3.1 is: recovery of the target gene fragment GV 1 μL, salt solution 1 μL,
Vector 1 μL, 3 μL of sterile ultrapure water.
The method for breeding an antiviral seedless grape according to claim 6, wherein the Xba I digestion system in the step 3.2 is: Xba I 1 μL, 10×M Buffer 2 μL, 0.1% BSA 2 μL, LR 6 μL of the reaction product, 9 μL of sterilized ultrapure water; Xho I digestion system: Xho I 1 μL, 10×H Buffer 2 μL, LR reaction product 6 μL, and sterilized ultrapure water 11 μL.
The method for breeding an antiviral seedless grape according to claim 6, wherein the LR reaction system in the step 3.2 is: pENTR-GV 2 μL, pHELLSGATE 12, 2 μL, LR clonase enzyme mix 4 μL; Sterile Water 12μL.
The method for breeding an antiviral seedless grape according to claim 6, wherein in the step 4, the Agrobacterium-derived zygotic embryo-derived somatic embryo obtains the regenerated plant:

Step 4.1, at 28 ° C, 200 rpm, the RNAi plant expression vector engineering strain EH-GV transformed with Agrobacterium was shake cultured in YEB liquid medium containing 50 mg/L rifampicin for 48 hours until the OD value was about 0.5. After centrifugation at 5000 rpm for 10 minutes, the precipitated cells were collected, resuspended in an equal volume of WPM liquid medium, and the somatic embryo obtained in step 2.3 was inoculated with Agrobacterium liquid for 10-15 minutes;

Step 4.2: The infected somatic embryo is placed in a sterile culture dish, and the excess bacterial solution is blotted with the sterile filter paper, inoculated on the WPM solid medium, and cultured for 3 days in the dark;

Step 4.3, after inoculation of the infected somatic embryos in WPM + 0.2 mg / L 6-BA + 50 mg / L kanamycin (Kan) + 200 mg / L cephalosporin (Cef) + 200 mg / L carbenicillin (Carb) medium, cultured for 16 months under the conditions of 16h / 8h photoperiod, once every 2 weeks;

Step 4.4, cultivating the resistant bud obtained by germination on 1/2MS+0.2mg/L 吲哚butyric acid (IBA)+25mg/L Kan+200mg/L Cef+200mg/L Carb medium at 16h/8h light Incubate for 2 months under cyclic conditions, subculture every 4 weeks, and the tube seedlings after rooting are expanded on 1/2MS+0.2mg/L IBA+25mg/L Kan+200mg/L Cef+200mg/L Carb medium. Regenerated plants with strong growth and good rooting are cultivated and transplanted in the greenhouse to prepare antiviral seedless grapes.