CN105647961A - Application of rice gene BSK331 in improvement of plant stress tolerance - Google Patents

Abstract

The present invention discloses application of rice gene BSK331 in improvement of plant stress tolerance. Experiments show that the gene can significantly improve adversity stress high salt and drought tolerance when in use in conversion of rice. A protein and a coding gene have important theoretical and practical significance for study of plant stress tolerance mechanisms and improvement of plant stress tolerance and related traits, may play an important role in improvement of stress tolerance gene engineering of plants (especially cereals), and has broad application prospects.

Description

One paddy gene BSK331 is in the application improved on plant stress tolerance energy

Technical field

The gene that the present invention relates to plant stress tolerance relevant is applied with it, particularly to deriving from the application in improving plant salt tolerance and arid of the Oryza sativa L. transcription factor relevant to resistance to adverse circumstance.

Background technology

Transcription factor (transcriptionfactor, TF), also known as trans acting factor, refer to in eukaryotic gene promoter region cis acting element generation specificity interact DBP molecule or can with the related protein molecules of these protein-interactings, major function be specifically activate or suppressor gene transcribe effect (Guilfoyleetal., 1997). They play important regulating and controlling effect (Adametal.1994 in the growth of higher plant, growth, morphogenesis and the environment reaction such as biology and abiotic stress; Logemannetal., 1995; Baersonetal., 1993). At present, in plant find transcription factor research more have the types such as bZIP, MYB, AP2/EREBP, WRKY and MADS.

Transcription factor is the key gene that controlling gene is expressed, and plays important regulating and controlling effect in the growth promoter of crop and the change of the reply external environments such as arid, high salt, low temperature thereof. For many years, one of the clone and the functional study focus being always up scientific research of transcription factor, scientists utilizes the substantial amounts of transcription factor of different study route isolation identification, also being therefrom found that some regulatory factors relevant to economical character, the character improvement for crops provides important gene resource. Oryza sativa L. is unifacial leaf model plant, is again the important cereal crops of China. After Sequencing of Rice Genome has worked, rice genome has been analyzed by many data bases. It is predicted, long-grained nonglutinous rice and japonica rice comprise 2 respectively, 025 and 2,384 transcription factor, belong to 63 transcription factor gene families, such as WRKY (111/113, long-grained nonglutinous rice/japonica rice), bZIP (88/109), AP2/EREBP (174/182), AUX/IAA (30/46), MYB (136/138), HB (84/103) etc. Functional annotation according to conventional bibliographical information Yu data base, here transcription factor family specific to plant had both been comprised, such as WRKY, also comprise some other transcription factor family closely-related with growth and development of plants, resistance etc., such as bZIP, AP2/EREBP, MYB etc.

HAP transcription factor is present in all most eukaryotes, is able to the CCAAT box with gene promoter upstream and is combined the trans acting factor transcribed with regulator gene. The heterotrimer being made up of tri-subunits of HAP2, HAP3, HAP5, these three subunit is all formed necessary to HAP-DNA complex. From model plant arabidopsis and Oryza sativa L., the coding all genes of HAP2, HAP3, HAP5 albumen have now been cloned. In arabidopsis, each HAP subunit is by multiple gene codes: the gene of 10 coding HAP2, the gene of 13 coding HAP3, the gene (Siefersetal., 2009) of 13 coding HAP5, these subunits can have 1690 kinds of compound modes in theory. Oryza sativa L. has the gene of 10 coding HAP2, the genes of 11 genes encoding HAP3 and 7 coding HAP5. The HAP gene found the earliest is LEC1 or NF-YB9 gene. LEC1 expresses at embryo's camber of development of plants, is control the necessary factor that embryo changes to maturity state. Finding in the research to arabidopsis HAP3 transcription factor, HAP3 disappearance causes that the arabidopsis florescence postpones, after contrary overexpression HAP3 gene, and flowering of plant time advance. Adverse circumstance research to HAP transcription factor finds, process LAN HAP2 gene in arabidopsis, it is possible to reduce its sensitivity to arid, it is possible to the content of reduction blade anthocyanidin, and phenotype contrary (Lietal., 2008) in corresponding mutant. Visible HAP transcription factor plays a very important role on the fetal development of plant, photoperiodic florescence control and drought stress. But the resistance to adverse circumstance functional study that HAP gene is in Oryza sativa L. is also less.

Oryza sativa L. has the gene of 11 coding HAP3, and the function of these genes is but without detailed research. The present invention adopts HAP3A and HAP3C assortment of genes BSK331; build combination carrier and utilize the efficient rice conversion system having built up to make it express in Oryza sativa L.; it is carried out scale functional verification; the function of transcription factor is inferred further by characteristics such as the changes of the character mutation of research transgenic paddy rice and anti-adversity; find the important regulatory factor of plant in improvement crops with practical value; and it is applied to the character improvement of crop; thus the practical problem effectively solved in agricultural production, there is important theory significance and using value.

Summary of the invention

It is an object of the invention to provide the paddy gene relevant to a resistance of reverse combination BSK331, for the resistance of reverse energy improving plant.

Assortment of genes BSK331 provided by the present invention, derives from Oryza Oryza sativa L. (OryzasativaL.), and coding has the protein of following aminoacid sequence:

1) SEQIDNO:1 and 2 in sequence table;

SEQIDNO:1 in sequence table is made up of 178 amino acid residues, for albumen OsHAP3A.

SEQIDNO:2 in sequence table is made up of 143 amino acid residues, for albumen OsHAP3C.

In the present invention, BSK331 transcription factor encoding gene both can be the cDNA sequence of described gene, it is possible to for the genomic dna sequence of described gene, or had more than 90% homology and the DNA sequence of coding identical function albumen with described gene. The encoding gene with aminoacid sequence shown in SEQIDNO:1 can have the nucleotide sequence of SEQ ID NO:3. The encoding gene with aminoacid sequence shown in SEQIDNO:2 can have the nucleotide sequence of SEQ ID NO:4.

Protection scope of the present invention is belonged to containing the expression vector of gene of the present invention, transgenic cell line and Host Strains.

The primer pair of the amplification arbitrary fragment of BSK331 is also within protection scope of the present invention.

It is a further object to provide a kind of method improving plant stress tolerance.

The method of raising plant stress tolerance provided by the present invention, including the tolerance of high salt, arid. It is that assortment of genes BSK331 relevant to resistance of reverse for code book invention is imported plant tissue, cell or organ, makes plant stress tolerance obtain and improve.

In the method for above-mentioned raising plant stress tolerance, the assortment of genes BSK331 that in the present invention, Oryza sativa L. is relevant to resistance of reverse both can be the cDNA sequence of described gene, it is possible to for the genomic gene sequence of described gene; There is with described gene more than 90% homology and the DNA sequence of coding identical function albumen, be the cDNA of described gene or genomic gene sequence are easily separated and/or are modified by known method and/or design obtain. What it should be appreciated by those skilled in the art is; the minor alteration of specific gene sequence nucleotide homogeneity may result in reduction or the reinforcement of this gene usefulness; and in some application (such as; antisense or co-suppression technology) in, partial sequence often equally effective when plays a role with full length sequence. Gene order change or the method shortened, and the method testing the effectiveness of these genes changed is all well known to those skilled in the art.

Assortment of genes BSK331 or its homologous sequence that Oryza sativa L. of the present invention is relevant to resistance of reverse can import plant tissue, cell or organ by plant expression vector; The carrier that sets out for building described plant expression vector can be used for agrobacterium tumefaciens for any one or Agrobacterium rhizogenes converts the binary vector of plant or can be used for the carrier etc. of plant micropellet bombardment, such as pBin serial carrier (such as pBin19 etc.), pBI serial carrier (such as pBI101 etc.), Gateway^TWSerial carrier (such as pH2GW7 etc.), pCAMBIA serial carrier (such as pCAMBIA3301 etc.), per8, pX6 or other derivative plant expression vector, the described carrier that sets out can be also the carrier that can replicate in prokaryote, such as pENTER-TOPO, pUC serial carrier or pBluescript serial carrier etc.

When using the assortment of genes BSK331 or its homologous sequence structure plant expression vector that Oryza sativa L. is relevant to resistance of reverse in the present invention, any enhancement mode, composing type, organizing specific type or induction type (ABA, arid, saline and alkaline or chemical induction etc.) promoter can be added before its transcription initiation nucleotide. Described constructive expression's promoter can be cauliflower mosaic virus (CAMV) 35S promoter, Semen Maydis Ubiquitin promoter or Oryza sativa L. actin1 promoter etc.; Described tissue specificity expression promoter can express promoter for root-specific, blade specific expresses promoter, dimension pipe specific expressing promoter, seed-specific expression promoter, flower specific express promoter or pollen specific expresses promoter, such as 2S1 promoter (No. GenBank: NM_118848.2, and NapinA (No. GenBank: M64633.1, GI:349405) promoter etc. GI:30687489); Described inducible promoter can be by low temperature, arid, ABA, ethylene, the induction such as saline and alkaline or chemical promoter. Above-mentioned promoter can be used alone or be combined use with other plant promoter. In addition, when using the gene constructed plant expression vector of the present invention, it be also possible to use enhancer, including translational enhancer and/or transcriptional enhancer, these enhancer regions can be ATG initiation codon or neighboring region start codon etc., but must be identical with the reading frame of coded sequence, to ensure the correct translation of whole sequence.The source of described translation control signal and start codon is widely, it is possible to be natural, it is also possible to be synthesis. Translation initiation region can come from transcription initiation region or structural gene.

For the ease of transgenic plant cells or plant being identified and screening, plant expression vector used can be processed, the enzyme of color change or the gene (gus gene of luminophor can be produced as added the coding can expressed in plant, GFP gene, luciferase genes etc.), there is antibiotic marker thing (neomycin phosphotransferase (NPTII) gene of resistance, hygromix phosphotransferase (Hygromycinphosphotransferase) gene, gentamycin label or kanamycin label etc.) or anti-chemical reagent marker gene (such as anti-herbicide gene) etc. described can be screened by kanamycin or its substituted derivatives such as G418 etc. containing the host plant cell of neomycin phosphotransferase (NPTII) gene, tissue or organ, can be screened by hygromycin containing the host plant cell of hygromix phosphotransferase (Hygromycinphosphotransferase) gene, tissue or organ. from the security consideration of transgenic plant, any selected marker can be not added with, directly screen transformed plant with adverse circumstance. also can adopt Southern, PCR or dot blot equimolecular detection means that transfer-gen plant is detected after said method screens, to determine if that conversion has genes of interest.

Wherein, the present invention with the double; two carrier T of the pCAMBIA2300 Kan plant resistance to environment stress having been built up for the carrier that sets out, the plant expression vector called after pDTL-NPTII-BSK331 containing the Oryza sativa L. of the present invention assortment of genes BSK331 relevant to resistance of reverse of structure. So can cultivate the transgenic paddy rice of the marker-free of efficient stable. The plant expression vector carrying the Oryza sativa L. of the present invention assortment of genes BSK331 relevant to resistance of reverse or its homologous sequence can pass through to use protoplast-chemistry mediated method (Ca²⁺, PEG), Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, pollen tube importing, microinjection, electric shock, particle gun, any one or more method in the conventional biology methods such as agriculture bacillus mediated combination convert plant cell, tissue or organ, and the plant cell of conversion, tissue or organ are cultivated into plant; Described tissue and organ can include the fruit pod of host plant, callus, stem apex, blade and seed etc.

Additionally, by by converting after the transfer-gen plant having assortment of genes BSK331 that Oryza sativa L. of the present invention is relevant to resistance of reverse or its homologous sequence carries out successive transfer culture, the transfer-gen plant of gene pure therefrom can be filtered out further. Additionally, also this transfer-gen plant can be carried out expanding propagation, can the resistance of reverse of render transgenic plant improve further. The expanding propagation of described transgenic plant includes asexual propagation and/or seminal propagation.

The method of the present invention is all applicable to dicotyledon and monocotyledon, therefore, described plant cell, tissue or the organ being converted both can derive from the dicotyledons such as Nicotiana tabacum L., Brassica campestris L, Cotton Gossypii, Semen sojae atricolor, willow, Eucalyptus, Rhizoma Solani tuber osi or herbage, it is possible to derives from the monocotyledons such as Oryza sativa L., Semen Maydis, Semen Tritici aestivi, Fructus Hordei Vulgaris, Sorghum vulgare Pers., millet or turfgrass.

The invention provides an Oryza sativa L. transcription factor gene combination BSK331 relevant to resistance of reverse. It is demonstrated experimentally that the gene transformation Oryza sativa L. of the present invention can be improved the toleration that high salt and Drought Stress are coerced by Oryza sativa L.. The albumen of the present invention and encoding gene thereof are for the resistance to inverse machine-processed research of plant, and the improvement of the resistance of reverse and correlated traits improving plant has important theory and practical significance, by playing a significant role in the resistance to inverse genetic engineering improvement of plant (particularly cereal crop), have a extensive future.

Below in conjunction with specific embodiment, the present invention is described in further details.

Accompanying drawing explanation

Fig. 1 double T-DNA expression vector pDTL-NPTII-BSK331 collection of illustrative plates

Fig. 2 BSK331 transgenic line T1 Seedling Salt Tolerance Analysis and survival rate statistics

Fig. 3 BSK331 transgenic line T1 Seedling Drought Stress Tolerance Analysis of A and survival rate statistics

Fig. 4 BSK331 transgenic line T2 Seedling soil Drought Stress Tolerance Analysis of A and survival rate statistics

Detailed description of the invention

In following embodiment, method therefor is conventional method if no special instructions, concrete steps can be referring to: " MolecularCloning:ALaboratoryManual " (Sambrook, J., Russell, DavidW., MolecularCloning:ALaboratoryManual, 3rdedition, 2001, NY, ColdSpringHarbor). The primer and DNA sequence synthesize by Shanghai Ying Jun Bioisystech Co., Ltd.

1, the structure of the separation of two genes of BSK331 and expression vector

According to the primers of gene in GenBank, with our unit preserve containing corresponding genes of interest ' plasmid for template, expand by the method for PCR and obtain OsHAP3A and OsHAP3C gene. Its nucleotide sequence is such as shown in SEQ ID NO:3 and 4, shown in SEQIDNO:1 and 2 in coded protein amino acid sequence such as sequence table.

1) primer of OsHAP3A gene:

Forward primer: 5 ' gaattcATGATGATGATGGATCTAGGGTT3 ' (SEQIDNO:5)

Reverse primer: 5 ' ggcgcgccTTAGGTGTCCCCATTATGATACTGA3 ' (SEQIDNO:6)

2) primer of OsHAP3C gene:

Forward primer: 5 ' cccgggATGTCGGAGGGGTTCGACGG3 ' (SEQIDNO:7)

Reverse primer: 5 ' ggcgcgccTTACATGCCTTCAAACGATGATCCA3 ' (SEQIDNO:8)

The OsHAP3A gene of acquisition is adopted our unit is promoter from the adverse circumstance inducible promoter KT620 of dominant patent, with T35S for terminator, carrys out construction expression frame. OsHAP3C gene adopts our unit to be promoter from the adverse circumstance inducible promoter KT582 of dominant patent, with OCS for terminator, forms expression cassette. The two expression cassette is building up to jointly the multiple clone site district of double T-DNA carrier. Double T-DNA carrier collection of illustrative plates is as shown in Figure 2.

Concrete reaction is, take the 1 �� l plasmid containing corresponding genes of interest as the PCR template reacted, each 1 �� l, LATaq enzyme (5U/ �� l) the 0.5 �� l of upstream and downstream primer (10 ��Ms), 4 �� dNTPs (each 10mM) 1 �� l, 2 �� GCbuffer (Mg²⁺) 25 �� l, H₂O20.5 �� l. PCR reaction condition is preheating 95 DEG C of 5min, 94 DEG C of 1min of degeneration, and anneal 55 DEG C of 30sec, extends 72 DEG C of 30sec, 34 circulations. pcr amplification product is carried out 1% agarose gel electrophoresis detection, it is thus achieved that the DNA fragmentation that size is consistent respectively with expected results after terminating by reaction. it is separately recovered and the above-mentioned fragment of purification, connect in carrier pEASY-T1 (Quan Shi King Company), escherichia coli (E.coli) TOP10 bacterial strain is converted by heat shock method, select positive bacterium colony and join in the 5ml LB fluid medium containing 50mg/L kanamycin, 37 DEG C, the shaking table of 200rpm is cultivated 12-16 hour, extract plasmid, respectively obtain the recombiant plasmid containing purpose fragment, after sequence verification is correct, by purpose fragment under double digestion enzyme action, it is connected into the pDTL-NPTII plant expression vector carrying out identical double digestion, structure obtains carrier pDTL-NPTII-BSK331. picking colony PCR is accredited as the bacterium colony of the positive and carries out sequence verification.

2, the acquisition of BSK331 transgenic paddy rice

The assortment of genes BSK331 rice transformation relevant to resistance of reverse that will obtain by detailed description of the invention 1 with agrobacterium-mediated transformation, concrete grammar is as follows:

1) Agrobacterium is converted

Utilize heat shock method that above-mentioned recombinant vector pDTL-NPTII-BSK331 proceeds to Agrobacterium AGL0 bacterial strain (Chinese Academy of Sciences's heredity is given), utilize Agrobacterium that Oryza sativa L. is carried out cotransformation.

2) Rice Callus is infected

Picking step 1) single colony inoculation of positive recombinational agrobacterium of obtaining is in the 20mLYEB fluid medium containing kanamycin 50mg/L and rifampicin 50mg/L, at 28 DEG C, under 150rpm shaken cultivation 2-3 days, then at 4 DEG C, centrifugal 3 minutes of 5000rpm, remove supernatant, bacterial sediment is resuspended in the AA culture medium (Co (N0 containing 0.1mmol/L acetosyringone₃)₂��6H₂O0.15mg/L, CaCl₂110mg/L,MgSO₄122mg/L, KI3.75mg/L, NaH₂PO₄��H₂O150mg/L, Na₂-EDTA0.01mM, FeSO₄��7H₂O139mg/L, KCl2.95g/L, MnSO₄��4H₂O84.5mg/L, ZnSO₄��7H₂O6.25mg/L, H₃BO₃5mg/L, Gly37.5mg/L, CuSO₄0.005mg/L, Na₂MoO₄��2H₂O1.25mg/L, thiamine hydrochloride VB₁5mg/L, nicotinic acid 5mg/L, pyridoxine hydrochloride VB₆5mg/L, creatine 0.1g/L, casein hydrolysate 0.3g/L, L-Gln87.6mg/L, L-Asp26.6mg/L, sucrose 20g/L) in, at 28 DEG C, lucifuge shaken cultivation 1-2 hour is to OD₆₀₀=0.6-0.9. Select the Oryza sativa L. force fortune round-grained rice growth conditions callus good, granular that method for plant tissue culture routinely obtains and immerse after above-mentioned conversion has and shake 20 minutes in the recombinational agrobacterium culture fluid of pDTL-NPTII-BSK331, stand 30 minutes, take out, blot unnecessary bacterium solution with aseptic filter paper, callus is inoculated in N₆Co-culture base (N₆Culture medium+10g/L glucose+1mg/L acetosyringone+2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L) upper cultivation, wherein N₆The formula of minimal medium is: (NH₄)₂SO₄0.46g/L, KNO₃2.83g/L, CaCl₂0.2g/L, MgSO₄0.092g/L, KH₂PO₄0.4g/L, Na₂-EDTA0.15g/L, FeSO₄��7H₂O0.11g/L, MnSO₄��4H₂O0.44g/L, ZnSO₄��7H₂O0.17g/L, H₃BO₃0.14g/L, CoCl₂��6H₂O0.0005g/L, CuSO₄��5H₂O0.0005g/L, Na₂MoO₄��2H₂O0.005g/L, thiamine hydrochloride VB₁0.01g/L, nicotinic acid 0.001g/L, pyridoxine hydrochloride VB₆0.001g/L, creatine 0.1g/L, casein hydrolysate 0.3g/L, L-Pro0.5g/L, sucrose 30g/L, agar 10g/L, pH5.8. After 2-3 days, callus is put in wide mouthed bottle, with aseptic water washing 3-5 time, shake is for several times every time, then soaks 30-60 minute in the sterilized water containing 500mg/L cephamycin, finally uses aseptic water washing 1 time again, it is placed on aseptic filter paper to dry, finally proceeds to screening culture medium (N₆Minimal medium+2,4-D2mg/L+ cephamycin 250mg/L) screening.

3) acquisition of positive transgenic Oryza sativa L.

By the Rice Callus after infecting in N₆Co-culture after base co-cultures 3-5 days, go to the N containing 50mg/LG418 and 400mg/L cephamycin₆Solid medium (N₆A great number of elements+B₅Trace element+B₅Organic principle+300mg/L caseinhydrolysate+500mg/L proline+30g/L sucrose+7-8g/L agar, pH5.8) above screen 3 weeks, then proceed to the N containing 50mg/LG418 and 200mg/L cephamycin₆Solid medium screens 4 weeks, subsequently resistant calli is proceeded to pre-division culture medium (N₆Culture medium+1mg/L naa+2mg/L6-benzylaminopurine+5mg/L abscisic acid), illumination cultivation 3 weeks, then proceed to division culture medium (N₆Culture medium+1mg/L naa+2mg/L6-benzylaminopurine) on break up, move in greenhouse after the regeneration plant grown is carried out root culture on strong seedling culture base (1/2MS inorganic salt+0.5mg/L naa+0.25mg/L paclobutrazol), at 28 DEG C, plant leaf is taken after cultivating 1 month under the illumination of 15 hours/day, extract STb gene according to a conventional method, under the guiding of forward primer 5 '-ctaaaacaattcatccagtaaaat-3 ' (SEQIDNO:9) and reverse primer 5 '-atggctaaaatgagaatatcaccg-3 ' (SEQIDNO:10), pcr amplification kanamycin gene, through amplification acquisition 795bpDNA fragment is positive transgenic plant, testing result shows that obtaining conversion in aforementioned manners has the transgenic paddy rice of pDTL-NPTII-BSK331.

3, BSK331 transgenic T₁Salt Tolerance Analysis for plant

The T1 of results BSK331 is for transgenic paddy rice seed, and the strain choosing more than 6 carries out high-salt stress. It is sprouted to cultivate 3 angels by water logging kind. Force fortune round-grained rice to turn empty carrier compares simultaneously, when Seedling grows to about 8cm, carries DNA and carries out positive Seedling qualification. Positive seedling is transferred in triangular flask from culture dish, every bottle of 10 strains, three repetitions. It is cultured to tri-leaf period (the 3rd leaf is unfolded completely), its growth conditions such as Fig. 2 A. Beginning with the high salt screening of 200mM concentration, after comparison young leaves, Lao Ye roll up entirely 1 to 2 day (Fig. 2 B), again normally cultivate, the nutritional solution in period triangular flask is changed once for 2 days, to keep the fresh state of nutritional solution. The renewal cultivation result of a week is as shown in Figure 2 C, turn empty vector control strain major part all turn to be yellow, wilt, dead, and transfer-gen plant shows stronger high-salt tolerance power and recovery capability, recovering the survival rate after a week to add up as shown in Figure 2 D, the survival rate of transgenic line is all high than comparison.

This description of test BSK331 has the ability strengthening Oryza sativa L. tolerance high salt.

4, BSK331 transgenic T₁For plant Drought Stress Tolerance Analysis of A

The T1 of results BSK331 is for transgenic paddy rice seed, and the strain choosing more than 6 carries out drought stress. It is sprouted to cultivate 3 angels by water logging kind. Force fortune round-grained rice to turn empty carrier compares simultaneously, when Seedling grows to about 8cm, carries DNA and carries out positive Seedling qualification. Positive seedling is transferred in triangular flask from culture dish, every bottle of 10 strains, three repetitions. Being cultured to tri-leaf period (the 3rd leaf is unfolded completely), the Seedling selecting growth conditions (thickness, plant height) consistent carries out arid screening, its growth conditions such as Fig. 3 A. Arid bottle sieve adopts 20%PEG6000 solution to process. When adjoining tree young leaves, Lao Ye major part stop screening after all turning to be yellow change volume. Then plant cleans up rear rehydration cultivate one week. Nutritional solution in triangular flask is changed once for 2 days, to keep the fresh state of nutritional solution. Seedling growth conditions after Osmotic treatment as shown in Figure 3 B, rehydration after one week Seedling recover state as shown in Figure 3 C. Finally adding up the Seedling survival rate of each strain, as shown in the bar diagram of Fig. 3 D, the survival rate of BSK331 transgenic line is above the survival rate of comparison.

This description of test BSK331 has the effect strengthening rice drought tolerance.

5, BSK331 transgenic T2 sieves for the soil drought of plant

The T2 of results BSK331, for transgenic paddy rice seed, chooses 4 strains and carries out arid screening. It is sprouted to cultivate 3 angels by water logging kind. Force fortune round-grained rice to turn empty carrier compares simultaneously. After seed germination shows money or valuables one carries unintentionally, it is moved in hole tray, ensures that the Nutrition Soil amount in each cave is consistent, one, every cave seed as far as possible. 40 seeds of each numbering kind. Plant to be planted starts drought sieve when growing into 2 weeks. The method of drought sieve for each hole tray being watered to after saturated, removing excessive moisture and start drought sieve, until adjoining tree blade turn yellow, curling, dried-up, stem stalk become withered till, period does not give any moisture. Drought sieve terminates rear rehydration and cultivates one week Taking Pictures recording. Before soil drought sieve, the growth conditions of plant is as shown in Figure 4 A, when drought sieve terminates as shown in Figure 4 B, adjoining tree leaf rolling, withered, stem stalk can not be upright, quickly death after renewal cultivation, and transfer-gen plant BSK331 renewal cultivation rear blade turns green, stem stalk is upright, rehydration quickly recovers green growth conditions after cultivating, rehydration cultivate one week after plant growth conditions as shown in Figure 4 C.Finally adding up the Seedling survival rate of each strain, as shown in the bar diagram of Fig. 4 D, the survival rate of BSK331 transgenic line is higher than the survival rate of comparison.

This description of test BSK331 has the effect strengthening rice drought tolerance.

SEQUENCELISTING

<110>Shenzhen Crop Molecular Design Breeding Institute

Xingwang Investment Pty Ltd.

<120>paddy gene BSK331 are in the application improved on plant stress tolerance energy

<130>

<160>10

<170>PatentInversion3.3

<210>1

<211>178

<212>PRT

<213>Oryza sativa L. (Oryzasativa)

<400>1

MetMetMetMetAspLeuGlyPheLeuGluGlyGlyAlaGlyMetAla

151015

AspAlaGlyHisAspGluSerGlySerProProArgSerGlyGlyVal

202530

ArgGluGlnAspArgPheLeuProIleAlaAsnIleSerArgIleMet

354045

LysLysAlaValProAlaAsnGlyLysIleAlaLysAspAlaLysGlu

505560

ThrLeuGlnGluCysValSerGluPheIleSerPheValThrSerGlu

65707580

AlaSerAspLysCysGlnLysGluLysArgLysThrIleAsnGlyGlu

859095

AspLeuLeuPheAlaMetGlyThrLeuGlyPheGluGluTyrValAsp

100105110

ProLeuLysIleTyrLeuHisLysTyrArgGluMetGluGlyAspSer

115120125

LysLeuSerSerLysAlaGlyAspGlySerValLysLysAspThrIle

130135140

GlyProHisSerGlyAlaSerSerSerSerAlaGlnGlyMetValGly

145150155160

AlaTyrThrGlnGlyMetGlyTyrMetGlnProGlnTyrHisAsnGly

165170175

AspThr

<210>2

<211>143

<212>PRT

<213>Oryza sativa L. (Oryzasativa)

<400>2

MetSerGluGlyPheAspGlyThrGluAsnGlyGlyGlyGlyGlyGly

151015

GlyGlyValGlyLysGluGlnAspArgPheLeuProIleAlaAsnIle

202530

GlyArgIleMetArgArgAlaValProGluAsnGlyLysIleAlaLys

354045

AspSerLysGluSerValGlnGluCysValSerGluPheIleSerPhe

505560

IleThrSerGluAlaSerAspLysCysLeuLysGluLysArgLysThr

65707580

IleAsnGlyAspAspLeuIleTrpSerMetGlyThrLeuGlyPheGlu

859095

AspTyrValGluProLeuLysLeuTyrLeuArgLeuTyrArgGluThr

100105110

GluGlyAspThrLysGlySerArgAlaSerGluLeuProValLysLys

115120125

AspValValLeuAsnGlyAspProGlySerSerPheGluGlyMet

130135140

<210>3

<211>537

<212>DNA

<213>Oryza sativa L. (Oryzasativa)

<400>3

atgatgatgatggatctagggtttttggagggcggcgcggggatggcggacgcggggcac60

gacgagagcgggagcccgccgaggagcggcggggtgagggagcaggacaggttcctgccc120

atcgccaacatcagccgcatcatgaagaaggccgtcccggcgaacggcaagatcgccaag180

gacgccaaggagaccctgcaggagtgcgtctcggagttcatctccttcgtcaccagcgag240

gcgagcgacaaatgtcagaaggagaagcgcaagaccatcaacggggaagatctcctcttt300

gcgatgggtacgcttggctttgaggagtacgttgatccgttgaagatctatttacacaag360

tacagagagatggagggtgatagtaagctgtcctcaaaggctggtgatggttcagtaaag420

aaggatacaattggtccgcacagtggcgctagtagctcaagtgcgcaagggatggttggg480

gcttacacccaagggatgggttatatgcaacctcagtatcataatggggacacctaa537

<210>4

<211>432

<212>DNA

<213>Oryza sativa L. (Oryzasativa)

<400>4

atgtcggaggggttcgacgggacggagaacggcggcggcggcggcggaggcggagtaggg60

aaggagcaggaccggttcctgccgatcgccaacatcggccgcatcatgcgccgggccgtg120

ccggagaacggcaagatcgccaaggactccaaggagtccgtccaggagtgcgtctccgag180

ttcatcagcttcatcaccagcgaagcaagcgacaagtgcctcaaggagaagcgcaagacc240

atcaatggggacgacctgatctggtcaatgggcacgctcggattcgaggactatgtcgag300

cctctcaagctctacctcaggctctaccgggagacggagggtgacacaaagggttcaaga360

gcttctgaactgccagtaaagaaagatgttgtacttaatggagatcctggatcatcgttt420

gaaggcatgtaa432

<210>5

<211>29

<212>DNA

<213>synthetic

<400>5

gaattcatgatgatgatggatctagggtt29

<210>6

<211>33

<212>DNA

<213>synthetic

<400>6

ggcgcgccttaggtgtccccattatgatactga33

<210>7

<211>26

<212>DNA

<213>synthetic

<400>7

cccgggatgtcggaggggttcgacgg26

<210>8

<211>33

<212>DNA

<213>synthetic

<400>8

ggcgcgccttacatgccttcaaacgatgatcca33

<210>9

<211>24

<212>DNA

<213>synthetic

<400>9

ctaaaacaattcatccagtaaaat24

<210>10

<211>24

<212>DNA

<213>synthetic

<400>10

atggctaaaatgagaatatcaccg24

Claims (9)

1. the method strengthening stress resistance of plant, it is characterized in that the encoding gene of plant anti-adversity associated protein is inserted expression vector, obtain the recombinant expression carrier containing plant anti-adversity associated protein encoding gene, this recombinant expression carrier is imported purpose plant, and from the plant that the plant expressing described plant anti-adversity associated protein or described plant anti-adversity associated protein expression increase, screening obtains the plant that resistance strengthens; Wherein, the aminoacid sequence of described plant anti-adversity associated protein is such as shown in SEQIDNO:1 or SEQIDNO:2.

2. the method strengthening stress resistance of plant described in claim 1, it is characterised in that: the encoding gene of described plant resistance to environment stress associated protein, is one of following nucleotide sequence:

1) nucleotide sequence shown in SEQ ID NO:3 or SEQIDNO:4;

2) there is more than 90% similarity and coding identical function protein DNA sequence with SEQIDNO:3 or SEQIDNO:4 sequence.

3. the method described in claim 1, it is characterised in that: described resistance relevant protein encoding gene is imported plant tissue, cell or organ, then the plant cell being converted, tissue or organ are cultivated into plant, obtain the transgenic plant that resistance of reverse improves.

4. the method described in claim 1, wherein said expression vector is characterized by: the carrier that sets out being used for building described plant expression vector is a kind of binary vector that can be used for agrobacterium tumefaciens or Agrobacterium rhizogenes conversion plant or the carrier that can be used for plant micropellet bombardment, or the carrier that can replicate in prokaryote.

5. the method described in claim 4, wherein said expression vector is characterized by: when building plant expression vector with described resistance relevant protein encoding gene, drives it to express with a kind of enhancement mode, composing type, organizing specific type or inducible promoter.

6. the method described in claim 4, the wherein said carrier that sets out is pCAMBIA serial carrier, it is preferred to pCAMBIA2300.

7. the method described in claim 1, the resistance of wherein said enhancing plant refers to the ability strengthening Plant Tolerance high salt and arid.

8. the method described in claim 1, wherein said resistance relevant protein can be used for strengthening the resistance of reverse of transgenic paddy rice.

9. the method described in claim 8, the resistance of reverse of wherein said enhancing transgenic paddy rice refers to the toleration enhancing Oryza sativa L. to high salt and arid.