CN102021180B - Application of rice genome KT487 in improvement of plant stress tolerance - Google Patents

Abstract

The invention discloses a gene KT487 derived from rice and related to stress tolerance. The experiment shows that the gene transformation rice can obviously improve the tolerance of the rice to adversity intimidation high salt. The protein and the coding gene thereof have significant theoretical and practical meaning for researching plant stress tolerance mechanisms and improving stress tolerance of the plants and the related characteristics, plays an important role in improvement of stress tolerance gene engineering of the plant ( in particular to cereal crops) and has wide application prospect.

Description

A paddy gene KT487 is in the application that improves on the plant stress tolerance ability

Technical field

The present invention relates to plant biotechnology field.Be specifically related to the gene clone and the application thereof of anti-retrocorrelation, that particularly derive from paddy rice and the degeneration-resistant relevant application of spiral ring coilin family gene KT487 in improving the plant salt tolerance ability.

Background technology

Paddy rice, corn and wheat are China's important crops, and the output of three big crops, quality are all most important for the grain-production and the grain security of China.Abiotic stresses such as arid, saline and alkaline, high temperature and freeze injury can directly influence normal growth and the output of food crop.Utilize the modern agriculture biotechnology, cultivate new crop varieties, can make farm crop under adverse environmental factor, keep stablizing high yield with resistance of reverse and suit property like transgenic technology.Along with going deep into of transgenic research, successively separating clone some and degeneration-resistant relevant gene, comprise the key controlling gene in the metabolic process, osmoregulation albumen, small-molecule substance also have to be participated in the transcription factor of the various adverse circumstance response pathway of regulation and control etc.

Transcription factor is the key gene of regulate gene expression, and growing of crop played important regulatory role.For many years; The clone of transcription factor and functional study are one of focuses of scientific research always; A large amount of transcription factor that scientists has been utilized different study route isolation identification; Some regulatory factors relevant have also therefrom been found, for the character improvements of farm crop provides the important gene resource with economical character.After the rice genome examining order was accomplished, many DBs were analyzed rice genome.It is predicted; In long-grained nonglutinous rice and japonica rice, comprise 2 respectively; 025 and 2,384 transcription factors belong to 63 transcription factor gene families; Like WRKY (111/113, long-grained nonglutinous rice/japonica rice), bZIP (88/109), AP2/EREBP (174/182), AUX/IAA (30/46), MYB (136/138), HB (84/103) etc.According to bibliographical information and database function note in the past; Here both comprised the peculiar transcription factor family of plant; Like WRKY, also comprise and closely-related some other transcription factor families such as growth and development of plants, resistance, like bZIP, AP2/EREBP, MYB etc.Utilize these DBs; In conjunction with gene expression informations such as gene chip hybridization, est sequences; From genomic level prediction and separating rice transcription factor full-length cDNA; And utilize the system of rice conversion efficiently that has set up to make its overexpression in paddy rice, and it is carried out the mass-producing functional verification, further infer the function of transcription factor through the phenotype variation of research transgenic paddy rice and the change of anti-adversity etc.; On the basis of work such as the Plant Transformation of a large amount of repeatability, phenotype analytical, Function Identification; Searching has practical value in the improvement farm crop the important regulatory factor of plant; And be applied to the character improvement of crop; Practical problems in effective solution agriculture prodn has important significance for theories and using value.

Summary of the invention

The purpose of this invention is to provide a paddy rice spiral ring coilin family gene KT487 relevant, to be used to improve the resistance of reverse ability of plant with resistance of reverse.

Spiral ring coilin family gene KT487 provided by the present invention derives from Oryza paddy rice (Oryza sativa L.), and coding has the protein of following aminoacid sequence:

1) the SEQ ID NO:1 in the sequence table;

SEQ ID NO:1 in the sequence table is made up of 278 amino-acid residues, is albumen KT487.

The encoding sox of KT487 both can be the cDNA sequence of said gene among the present invention, also can be the genomic dna sequence of said gene, or had 90% above homology and the proteic dna sequence dna of coding identical function with said gene.Encoding sox with aminoacid sequence shown in the SEQ ID NO:1 can have the nucleotide sequence of SEQ ID NO:2 in the sequence table.

Contain expression carrier of the present invention, transgenic cell line and host bacterium and all belong to protection scope of the present invention.

The arbitrary segmental primer of amplification KT487 is to also within protection scope of the present invention.

Another object of the present invention provides a kind of method that improves plant stress tolerance.

The method of raising plant stress tolerance provided by the present invention is that plant stress tolerance obtains to improve with code book invention KT487 gene transfered plant tissue, cell or the organ relevant with resistance of reverse.

In the method for above-mentioned raising plant stress tolerance, the KT487 gene that paddy rice is relevant with resistance of reverse among the present invention both can be the cDNA sequence of said gene, also can be the genomic gene sequence of said gene; Having 90% above homology and coding identical function proteic dna sequence dna with said gene, is the cDNA of said gene or genomic gene sequence to be separated and/or modified and/or design with known method obtain.What it should be appreciated by those skilled in the art is; The minor alteration of Nucleotide identity may cause the reduction or the reinforcement of this gene usefulness in the specific gene sequence; And (for example in some application; Antisense or inhibition technology altogether) in, partial sequence plays a role through regular meeting and full length sequence equally effectively.The method that gene order changes or shortens, and the method for testing the validity of these genes that change all is well known to those skilled in the art.

The relevant KT487 gene with resistance of reverse of paddy rice of the present invention or its homologous sequence can import plant tissue, cell or organ through plant expression vector; The carrier that sets out that is used to make up said plant expression vector can be any one and can be used for the carrier etc. that agrobacterium tumefaciens or Agrobacterium rhizogenes transform the binary vector of plant or can be used for the plant micropellet bombardment, like the pBin serial carrier (like pBin

19 etc.), pBI serial carrier (like pBI 101 etc.), Gateway ^TWSerial carrier (like pH2GW7 etc.), pCAMBIA serial carrier (like pCAMBIA 3301 etc.), per8, pX6 or other plant expression vector of deriving; The said carrier that sets out also can be the carrier that can in prokaryotic organism, duplicate, like pENTER-TOPO, pUC serial carrier or pBluescript serial carrier etc.

When using paddy rice is relevant with resistance of reverse among the present invention KT487 gene or its homologous sequence structure plant expression vector, before its transcription initiation Nucleotide, can add any enhancement type, composing type, organizing specific type or induction type (ABA, arid, saline and alkaline or chemically induced etc.) promotor.Said constructive expression's promotor can be cauliflower mosaic virus (CAMV) 35S promoter, corn Ubiquitin promotor or paddy rice actin1 promotor etc.; Said tissue specificity expression promoter can be root-specific expression promotor, blade specific is expressed promotor, dimension pipe specific expressing promoter, seed-specific expression promotor, flower specific expression promotor or pollen specific expression promotor; Like 2S1 promotor (GenBank number: NM_118848.2; GI:30687489) and NapinA (GenBank number: M64633.1, GI:349405) promotor etc.; Said inducible promoter can be and receives inductive promotors such as low temperature, arid, ABA, ethene, saline and alkaline or chemistry.Above-mentioned promotor can be used separately or be used in combination with other plant promoter.In addition; When using gene constructed plant expression vector of the present invention; Also can use enhanser, comprise translational enhancer and/or transcriptional enhancer, these enhanser zones can be ATG initiator codon or neighboring region initiator codon etc.; But must be identical with the reading frame of encoding sequence, to guarantee the correct translation of whole sequence.The source of said translation wave and initiator codon is widely, can be natural, also can be synthetic.Translation initiation region can be from transcription initiation zone or structure gene.

For the ease of transgenic plant cells or plant being identified and screening; Can process used plant expression vector, can produce the enzyme of colour-change or the gene of luminophor (gus gene, GFP gene, luciferase genes etc.) as adding the coding that in plant, to express, have antibiotic marker thing (neomycin phosphotransferase (NPTII) gene, hygromix phosphotransferase (Hygromycin phosphotransferase) gene, qingfengmeisu qiong affinity tag or kantlex affinity tag etc.) or the anti-chemical reagent marker gene (like anti-weedkiller gene) of resistance etc.Said host plant cell, tissue or the organ that contains neomycin phosphotransferase (NPTII) gene can be screened by kantlex or its substituted derivatives such as G418 etc., and the host plant cell, tissue or the organ that contain hygromix phosphotransferase (Hygromycin phosphotransferase) gene can be screened by Totomycin.From the security consideration of transgenic plant, can not add any selected marker, directly with adverse circumstance screening transformed plant.After aforesaid method screens, also can adopt Southern, PCR or dot blot equimolecular detection means that transfer-gen plant is detected, whether transform goal gene to confirm it.

Wherein, the present invention is the carrier that sets out with pCAMBIA1300, the plant expression vector called after pCact-KT487 that contains the paddy rice of the present invention KT487 gene relevant with resistance of reverse of structure.The plant expression vector that carries the paddy rice of the present invention KT487 gene relevant with resistance of reverse or its homologous sequence can be through using protoplastis-chemical mediated method (Ca ²⁺, PEG), combination transformed plant cells, tissue or the organ of any or several method in sharp, the particle gun of Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversions, pollen tube importing, microinjection, electricity, conventional biological method such as agriculture bacillus mediated, and plant transformed cell, tissue or organ cultivated into plant; Said tissue and organ can comprise fruit pod, callus, stem apex, blade and the seed etc. of host plant.

In addition, carry out succeeding transfer culture through the transfer-gen plant that conversion is had the paddy rice of the present invention KT487 gene relevant or its homologous sequence with resistance of reverse after, can therefrom further filter out the transfer-gen plant of gene pure.In addition, also can expand this transfer-gen plant numerous, but the resistance of reverse of render transgenic plant is further improved.The expansion of said transgenic plant is numerous to comprise vegetative propagation and/or seminal propagation.

Method of the present invention all is suitable for dicotyledons and monocotyledons; Therefore; Saidly both dicotyledonss such as tobacco, rape, cotton, soybean, willow, eucalyptus, yam or herbage can be derived from, also monocotyledonss such as paddy rice, corn, wheat, barley, jowar, millet or turfgrass can be derived from by plant transformed cell, tissue or organ.

The invention provides a paddy rice spiral ring coilin family gene KT487.Experiment showed, gene transformation paddy rice of the present invention can be improved the tolerance of paddy rice to low temperature and high salt environment stress.Albumen of the present invention and encoding sox thereof are for the anti-contrary Study on Mechanism of plant; And improve the resistance of reverse of plant and the improvement of correlated character has important theory and practical significance; To in the anti-contrary genetically engineered improvement of plant (particularly cereal crop), play a significant role, have a extensive future.

Below in conjunction with specific embodiment the present invention is explained further details.

Description of drawings

The T-DNA district collection of illustrative plates of Fig. 1 expression vector pCact.LB and RB are respectively left margin and the right margin of T-DNA; Hyg representes hygromycin resistance; P35S representes the promotor of 35S gene; CaMV35S ter representes the terminator of 35S gene; PAct1 representes the promotor of paddy rice Actin1 gene; OCS representes the terminator of ocs gene; HindIII, KpnI, SpeI, XbaI, SalI and PstI represent the restriction enzyme site of restriction enzyme respectively.

The salt tolerance analysis of Fig. 2 KT487 transgenic line.A: seedling growth conditions before salt is handled; B: salt is handled back seedling growth conditions; C: normal cultured seedling growth conditions after one week; D: the survival rate statistics that salt is handled.

The expression analysis of Fig. 3 KT487 transgenic line.Swimming lane " 1 " is the plasmid contrast; " 2 " spend 11 in being; " 3 " are for changeing empty carrier strain system; " 4-7 " is each transgenic line of KT487.

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment; The primer is synthetic by Shanghai Ying Jun biotech company; Order-checking is accomplished by the big gene of Beijing China, and the endonuclease in PCR test kit, the vector construction process is available from precious biotechnology ltd, and pEASY-T1 connects test kit available from the full Shi Jin in Beijing biotech company; The T4 dna ligase is available from Promega company, and the method that the equal reference reagent box of method provides is carried out.Carrier pHPG used in the experiment is by this experimental reconstruction gained, and basic framework comes from the pCAMBIA1300 of CAMBIA company.

1, the separation of KT487 gene

Infer the encoding sequence of KT487 gene, begin to design 5 ' end primer, design 3 ' end primer in the termination codon place from the coding initiation site ATG of gene:

Primer 1:5 ' tctagaATGCCCCAAGTGAGGAACCAG 3 '

Primer 2: 5 ' gtcgacCTAGCCCTTTTTTCGACCTTTC 3 '

The tctaga sequence is the restriction enzyme site of restriction enzyme XbaI in the primer 1, and the sequence of underscore sign is the encoding sequence of KT487 gene; The gtcgac sequence is the restriction enzyme site of restriction enzyme SalI in the primer 2, and the sequence of underscore sign is the encoding sequence of KT487 gene.

Extract total RNA of the Japanese fine paddy rice of seedling phase; Obtain cDNA as template through reverse transcription; Total length with above primer amplification KT487 gene; Its size is 837bp, and its nucleotide sequence is shown in SEQ ID NO:2 in the sequence table, and coded protein amino acid sequence is shown in the SEQ ID NO:1 in the sequence table.

Concrete reaction is: get total RNA of about 2 μ g, add 1 μ l, 10 * DNase buffer, the DNase of 1 μ l; Mend DEPC treated water to 10 μ l system, mixing is behind 37 ℃ of incubation 30min; The RQ DNase stop solution that adds 1 μ l, 65 ℃ of incubation 10min with termination reaction after, add 2 μ l Oligo (dT), 18 primer (0.1 μ g/ μ l); 4 μ l, 5 * First-strand buffer, 1 μ l Ribonuclease inhibitor (40U/ μ l), 2 μ l, 4 * dNTP (each 10mM); 1 μ l MMLV Reverse Transcriptase (200U/ μ l), careful mixing, 37 ℃ are incubated 1 hour.Handled 5 minutes for 90 ℃ then, cooled on ice, centrifugal collection promptly obtains corresponding reverse transcription product cDNA.With 10 times of the cDNA dilutions that obtains, get the template of 1 μ l, each 1 μ l of upstream and downstream primer (10 μ M), LA Taq enzyme (5U/ μ l) 0.5 μ l, 4 * dNTPs (each 10mM), 1 μ l, 2 * GCbuffer (Mg as the PCR reaction ²⁺) 25 μ l, H ₂O 20.5 μ l.The PCR reaction conditions is 95 ℃ of 5min of preheating, 94 ℃ of 1min of sex change, and the 56 ℃ of 30sec that anneal extend 72 ℃ of 1min50sec, 34 circulations.After reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis detect, obtained the dna fragmentation that size conforms to expected results respectively.Reclaim respectively and the above-mentioned fragment of purifying, connect among the carrier pEASY-T1 (full formula King Company), through heat shock method transformed into escherichia coli (E.coli) TOP10 bacterial strain; Selecting positive bacterium colony joins 5ml and contains in the LB liquid nutrient medium of 50mg/L kantlex; Cultivated 12-16 hour in 37 ℃, the shaking table of 200rpm, extract plasmid, obtain containing the segmental recombinant plasmid of purpose respectively; After sequence verification is correct; Downcut purpose fragment KT487 with XbaI and SalI double digestion, be connected into the pCact plant expression vector that carries out identical double digestion, make up and obtain carrier pCact-KT487.Picking colony PCR is accredited as the male bacterium colony and carries out sequence verification.The T-DNA district collection of illustrative plates of plant expression vector pCact is as shown in Figure 1.

2, the acquisition of KT487 transgenic paddy rice

Will be with agrobacterium-mediated transformation by the gene KT487 rice transformation relevant of embodiment 1 acquisition with resistance of reverse, concrete grammar is following:

Utilize the heat shock method to change above-mentioned recombinant vectors pCactF-KT487 over to Agrobacterium AGL0 bacterial strain (Chinese Academy of Sciences's heredity is given), utilize Agrobacterium that paddy rice is carried out cotransformation.

Partial blade with the paddy rice transfer-gen plant that obtains; Extract total DNA by ordinary method; Under the guiding of forward primer 5 '-ACTCACCGCGACGTCTGT-3 ' and reverse primer 5 '-TTCCTTTGCCCTCGGACG-3 '; The pcr amplification hygromycin phosphotransferase gene obtains the positive transfer-gen plant of 1009bp dna fragmentation through amplification, and detected result shows with aforesaid method and obtained to transform the transgenic paddy rice that pCactF-KT487 is arranged.

3, the salt tolerance analysis of KT487 transfer-gen plant

The T1 of results KT487 chooses 6 strain systems and carries out high-salt stress for transgenic paddy rice seed.Its sprouting of 3 angels is cultivated in the water seed soaking, carries out resistance screening with the 50mg/L Totomycin then, simultaneously to spend 11 to compare in the paddy rice that changes empty carrier; Screen after 5 days, adjoining tree is all dead, statistics transfer-gen plant resistance seedling and dead seedling number; Analyze the resistance of transfer-gen plant and separate ratio, that selects resistance seedling and non-resistant seedling separates than is about 3: 1 strain system, and the result shows the T1 transgenic line that has obtained to have the KT487 that unit point inserts; When treating seedling length to the 8cm left and right sides; Seedling is transferred in the triangular flask every bottle 10 strain, three repetitions from petridish.Be cultured to tri-leaf period (the 3rd leaf unfolded fully), its growth conditions such as Fig. 2 A.Use the Hoagland solution that contains 200mM NaCl instead and carry out salt sieve, about about 3 days, blade tip jaundice whiting appearred in contrast, sagging or half volume of blade even when rolling up entirely (Fig. 2 B), flush away salts solution, normal cultured.Changed a salts solution in per during this time 1.5 days.Rehydration was changed one time of nutrition liquid in second day again, to remove remaining salinity.Nutritive medium in the triangular flask was changed once in 2 days, to keep the fresh state of nutritive medium.Seedling number alive is added up in one week back photograph (Fig. 2 C), calculates salt tolerant seedling ratio, result such as Fig. 2 D (X-coordinate is different transgenic line numbering, and ordinate zou is that salt is handled survival rate).Experimental result shows, T ₁For transgenic rice plant to the tolerance of salt apparently higher than transgenic rice plant not, after salt is handled, KT487 transgenic paddy rice T ₁Can continued growth after the plant of positive strain of generation system recovers to cultivate, change empty carrier in spend 11 contrast (CK) plant yellow leaf, curl, withered, cane can not be upright, after recovering to cultivate very fast dead (Fig. 2 C).

After obtaining the KT487 transgenic paddy rice T2 seed in generation, we have carried out the salt tolerance experiment again, and result and above-mentioned experimental result are consistent.This description of test KT487 gene has the effect that strengthens the paddy rice salt tolerance.

5, the expression analysis of KT487 transfer-gen plant

The KT487 Gene RT-PCR detects primer:

Primer 3:5 ' GATAAAGTCGAGGGGGGGCC 3 '

Primer 4:5 ' AGCGGACTGTTCCTTTCTG 3 '

KT487 Gene RT-PCR amplified fragments is 347bp.

Actin Gene RT-PCR primer:

Primer 5:5 '-TGTTCCTGCCATGTATGT-3 '

Primer 6:5 '-ATGTCCCTCACAATTTCC-3 '

Actin Gene RT-PCR amplified fragments is 252bp.

Above primer is that seedling cDNA is a masterplate with each strain of KT487 transgenic respectively, negative control be normal growth in spend 11 seedling cDNA, detect the expression amount of KT487 gene in transgenic line, PCR detection architecture and program are:

10×buffer 2μl

10mM?dNTP 0.4μl

10 μ M primers F, 0.4 μ l

10 μ M primer R, 0.4 μ l

Taq?polymerase 0.4μl

cDNA 1μl

ddH ₂O 15.4μl

The PCR reaction conditions is: sex change in advance: 95 ℃, and 5 minutes; Sex change: 94 ℃, 30 seconds,, annealing: 55 ℃, 30 seconds, extend: 72 ℃, 30 seconds, 28 circulations; 72 ℃, 10 minutes.

After reaction finishes, the PCR product is carried out 1.5% agarose gel electrophoresis detect, the PCR detected result is seen Fig. 6, and wherein KT487 refers to the amplified production of this gene; Actin refers to the amplified production of paddy rice Actin gene; Swimming lane " 1 " is the plasmid contrast; " 2 " spend 11 in being; " 3 " are for changeing empty carrier strain system; " 4-7 " is each transgenic line of KT487.Visible by figure, the KT487 gene all has in transgenic paddy rice in various degree expresses.

Claims (7)

1. method that strengthens the paddy rice salt resistance; It is characterized in that the encoding sox of plant anti-adversity associated protein is inserted expression vector; Acquisition contains the recombinant expression vector of plant anti-adversity associated protein encoding sox; This recombinant expression vector is imported the purpose plant, and screening obtains salt resistance enhanced plant from the plant of expressing said plant anti-adversity associated protein expression amount increase; Wherein, the aminoacid sequence of said plant anti-adversity associated protein is shown in SEQ ID NO:1.

2. the described method of claim 1, it is characterized in that: the encoding sox of said plant resistance to environment stress GAP-associated protein GAP, its nucleotide sequence is shown in SEQ ID NO:2 in the sequence table.

3. the described method of claim 1 is characterized in that: said resistance relevant protein encoding sox is imported plant tissue, cell or organ, will be cultivated into plant by plant transformed cell, tissue or organ again, obtain the transgenic plant that salt tolerance improves.

4. the described method of claim 1; The characteristic of wherein said expression vector is: the carrier that sets out that is used to make up said plant expression vector is a kind ofly to can be used for the carrier that agrobacterium tumefaciens or Agrobacterium rhizogenes transform the binary vector of plant or can be used for the plant micropellet bombardment, or the carrier that can in prokaryotic organism, duplicate.

5. the described method of claim 4, the characteristic of wherein said expression vector is: when making up plant expression vector with said resistance relevant protein encoding sox, drive its expression with a kind of enhancement type, composing type, organizing specific type or inducible promoter.

6. the described method of claim 4, the wherein said carrier that sets out is the pCAMBIA serial carrier.

7. the described method of claim 6, the wherein said carrier that sets out is pCAMBIA1300.

Images