CN104073491A - High-temperature-induced expressed plant promoter Posheat2 and application thereof - Google Patents
High-temperature-induced expressed plant promoter Posheat2 and application thereof Download PDFInfo
- Publication number
- CN104073491A CN104073491A CN201410325505.5A CN201410325505A CN104073491A CN 104073491 A CN104073491 A CN 104073491A CN 201410325505 A CN201410325505 A CN 201410325505A CN 104073491 A CN104073491 A CN 104073491A
- Authority
- CN
- China
- Prior art keywords
- posheat2
- promotor
- high temperature
- plant
- temperature induction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention provides a high-temperature-induced expressed paddy rice promoter Posheat2 and an application thereof. The invention further provides an expression kit, a plant expression vector, a host strain and transformant containing the promoter. Specifically, the invention provides an application of the promoter in plant genetic engineering. The promoter provided by the invention can specifically drive the expression of an exogenous gene in a plant under the condition of high-temperature induction, so that the promoter can be used for enhancing and improving the growth characteristics of plants, in particular the high-temperature resistance of the plants, and thus, the high-temperature resisting traits of the plants are effectively improved.
Description
Technical field
The present invention relates to biotechnology and plant gene engineering technology field.Particularly, the present invention relates to kind of plant high temperature induction genetic expression promotor Posheat2 and an application thereof, in transgenic rice plant, this promotor can specificly at high temperature drive target gene to express.
Background technology
Follow the quickening of process of industrialization, the CO that human social development produces
2isothermal chamber gas, causes global warming and has become indisputable fact, many areas in the world, and high temperature has become the principal element that affects plant growth.Pertinent data shows, as summer high temperature etc., in the whole world, many regions will occur more frequently extreme weather phenomenon, and the time length is longer.On the south China the Changjiang river two season early rice the phase of blossoming and bearing fruit and semilate rice often meet with abnormal high temperature weather flowering period, if in late July, 2003 is to early August, there is hot weather rarely seen in the history in paddy area in the southern part of China, part rice district, 38 DEG C of above hot weathers have continued more than 20 day, the highest temperature reaches 41.3 DEG C, makes paddy rice suffer the warm evil of serious height, the significantly underproduction.High warm evil has become the bottleneck that restriction China paddy rice high-quality and safety is produced.Therefore, carry out the research of paddy rice thermotolerance to promoting paddy rice to continue to keep the safety in production significant.
Paddy rice is China's staple food crop, occupy very important status, and high temperature all can exert an influence in guarantee national food security process to the whole growth and development process of paddy rice.Prasad etc. think that high temperature stress causes flower pesticide do not ftracture or ftracture and be obstructed, and Pollen Activity reduces.The researchs such as Lee Cheng get etc., Cao Yunying think, when mean daily temperature is higher than 32 DEG C, day top temperature is during higher than 35 DEG C, and Pollen Activity, anther dehiscence, pollen germination and pollen tube growth etc. are all influenced, cause fertilization rate to decline.Although forefathers cause reason and the physiological mechanism that setting percentage reduces to have some researchs to high temperature, research at present only limits in a certain respect mostly, and utilizes the research report of gene engineering technique improvement or seed selection thermotolerance rice varieties few.
Summary of the invention
For the problems referred to above, the present inventor has carried out large quantity research to plant heat resistance property improvement aspect, and has found the promotor that drives foreign gene to express under high temperature induction condition.
Therefore, the object of this invention is to provide a kind of promotor that drives foreign gene to express under high temperature induction condition, obtain contain this promoter sequence transformant and the application of this promotor.Wherein, related " plant " refers to monocotyledons herein, and for example paddy rice, wheat, corn, barley, Chinese sorghum or oat, be preferably paddy rice.
To achieve these goals, on the one hand, the invention provides a kind of plant high temperature induction and express promotor, described plant high temperature induction is expressed promotor and is comprised the DNA sequence dna shown in SEQ ID No:1 in sequence table.In sequence table, the DNA sequence dna shown in SEQ ID No:1 is expressed promotor for the paddy rice high temperature induction that derives from Japanese fine paddy rice (Oryza sativa L cv.Nipponbare), is called Posheat2 or promotor Posheat2 herein.
Preferably, the DNA sequence dna that plant high temperature induction provided by the invention is expressed promotor is the sequence shown in SEQ ID No:1, i.e. Posheat2 or promotor Posheat2.
On the other hand, the invention provides a kind of plant high temperature induction and express promotor Posheat2, the DNA sequence dna shown in its DNA sequence dna and SEQ ID No:1 has at least 80% homology; Or described plant high temperature induction is expressed promotor Posheat2 and add, replace, insert or delete mutant or allelotrope or the derivative that one or more Nucleotide generate in the DNA sequence dna shown in SEQ ID No:1; Or described plant high temperature induction is expressed promotor Posheat2 and is had the product of hybridizing with the DNA sequence dna shown in SEQ ID No:1.These plant high temperature inductions are expressed the DNA sequence dna shown in promotor Posheat2 sequence and SEQ ID No:1 and are had identical function, drive target gene to express in plant.
On the other hand, the present invention also provides a kind of expression cassette that comprises above-mentioned plant high temperature induction expression promotor Posheat2.
Another aspect, the present invention also provides a kind of recombinant expression vector, described recombinant expression vector comprises above-mentioned plant high temperature induction and expresses promotor Posheat2, in described recombinant expression vector, described plant high temperature induction expression promotor Posheat2 is connected in the upstream of gene order to be expressed; Preferably, described gene to be expressed is Gus gene, described recombinant expression vector is pCAMBIA1391-Posheat2, this recombinant expression vector is to be that Posheat2 or promotor Posheat2 are implemented in the recombinant expression vector obtaining in pCAMBIA1391 by the sequence shown in SEQ ID No:1, is called pCAMBIA1391-Posheat2 herein.
On the other hand, the present invention also provides a kind of Host Strains, and described Host Strains comprises above-mentioned plant high temperature induction provided by the invention and expresses promotor Posheat2, above-mentioned expression cassette or above-mentioned recombinant expression vector; Preferably, described Host Strains is agrobacterium tumefaciens.
On the other hand, the invention provides a kind of transformant, described transformant comprises above-mentioned plant high temperature induction provided by the invention and expresses promotor Posheat2, above-mentioned expression cassette, above-mentioned recombinant expression vector or above-mentioned Host Strains.Wherein, described transformant is preferably transgenic cell line, callus or plant.
Again on the one hand, the invention provides above-mentioned plant high temperature induction and express promotor Posheat2 in the application of cultivating in transgenic plant.Described application comprises (for example expresses gene order upstream to be expressed that promotor Posheat2 is connected in carrier by above-mentioned plant high temperature induction provided by the invention, before described promotor Posheat2 sequence is placed in to target gene), thereby structure recombinant expression vector, is transformed into described recombinant expression vector in vegetable cell, tissue or organ and cultivates.
And preferably, described application can be for improving plant growth characteristic, and described plant is monocotyledons, and for example paddy rice, wheat, corn, barley, Chinese sorghum or oat, be preferably paddy rice.
The DNA sequence dna of the promotor Posheat2 providing in the present invention is (with identical in SEQ ID No:1 in sequence table):
It should be noted that: in the DNA sequence dna of above-mentioned promotor, the retention sequence of the forward primer that the sequence " caaaagaaac tgacacacgc ca " that sequence beginning represents taking italic overstriking is used in obtaining promotor process, 22bp altogether; The retention sequence (the corresponding sequence complementation of this retention sequence and reverse primer) of the reverse primer that the sequence " tcactgccct tcttgctttt gc " that sequence end represents taking italic overstriking is used in obtaining promotor process, altogether 22bp; In this DNA sequence dna, remaining part is available from the DNA sequence dna in the fine paddy rice of Japan.It is emphasized that the promotor mentioned both can refer to above-mentioned whole DNA sequence dna herein, also can refer to remove above-mentioned primer and retain the DNA sequence dna after sequence.
In sum, the DNA sequence dna of the present inventor separating clone LOC_Os11g31530.1 upstream region of gene 1662bp including transcription initiation site from the fine paddy rice of Japan (Oryza sativa L cv.Nipponbare), and by its called after Posheat2 (the SEQ ID No:1 in sequence table).This sequence after cutting, enzyme is connected on plant binary expression vector pCAMBIA1391, obtain corresponding recombinant plasmid (being recombinant expression vector), utilize this recombinant plasmid transformed agrobacterium tumefaciens bacterial strain EHA105, then carry out the conversion of paddy rice by agriculture bacillus mediated method, obtain transgenic rice plant.The transgenic paddy rice obtaining is carried out to GUS and express detection by quantitative discovery, transfer-gen plant is after high temperature induction is processed, Gus gene expression dose on the whole improves, thereby the sequence that proves this 1662bp has the activity that drives genetic expression, and the Gus gene of this promoters driven is expressed after paddy rice high temperature induction is processed.
Promoter sequence of the present invention can be connected with plant binary expression vector, for replacing constitutive promoter.And this promoter sequence can be connected with required target gene, build recombinant plant expression vector, after transforming, after high temperature induction is processed, can drive target gene specific expressed in plant, thereby improve the expression amount of external source target gene in plant, increase genetically modified effect.
Technique effect
The rice starter Posheat2 that the present invention clones can concentrate and express by regulatory gene under high temperature induction in plant, has in actual applications remarkable value.By this promotor, variety of crops is carried out to genetic modification, as expressed in plant by this promoters driven target gene, can improve and improve the growth characteristics (especially resistance to elevated temperatures) of paddy rice, thereby cultivate the high temperature resistant Transgenic Rice of practicability and effectiveness.
Brief description of the drawings
Below, describe by reference to the accompanying drawings embodiment of the present invention in detail, wherein:
Posheat2 promotor is implemented in the schematic diagram in pCAMBIA1391 vector plasmid by Fig. 1, wherein in Fig. 1, A is pCAMBIA1391 schematic diagram, B is pCAMBIA1391-Posheat2 schematic diagram, wherein shows the gus gene that utilizes Posheat2 promoters driven to be positioned at its downstream and expresses;
Fig. 2 is the result schematic diagram of promotor of the present invention being carried out enzyme and cut checking.
Fig. 3 is by the Posheat2::gus transgenosis seedling sprouting after 7 days, be placed under 42 DEG C of conditions and process respectively 1 hour, 4 hours, 8 hours, 12 hours and 24 hours, carry out Analog heat-treating condition, be placed in normal temperature as contrast taking seedling simultaneously, in figure, colourless open tubular column represents relative expression's intensity of gus gene in the transfer-gen plant of normal temperature processing, and solid black post is relative expression's intensity of gus gene in 42 DEG C of transfer-gen plants under pyroprocessing.
Embodiment
Referring to specific embodiment, the present invention is described.It will be appreciated by those skilled in the art that these embodiment are only for the present invention is described, the scope that it does not limit the present invention in any way.
Experimental technique in following embodiment, if no special instructions, is ordinary method.Biochemical reagents, carrier consumptive material etc. used in following embodiment, if no special instructions, is commercially available purchase product.
The acquisition of the Posheat2 promotor that contains restriction enzyme site
The design of step 1, primer
According to the rice varieties Japan providing in NCBI fine (Oryza sativa L cv.Nipponbare) whole genome sequence, according to the sequences Design amplimer of paddy rice Posheat2 gene, and according to the feature of the carrier of selecting and target gene, the restriction enzyme site of design primer.
In the present embodiment with paddy rice binary expression vector pCAMBIA1391 (Figure 1A, come from CAMBIA, openly use carrier, genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved) be example, target gene is Gus gene, the primer of specific design is: forward primer (SEQ ID No:2) 5 ' end band HindIII, restriction enzyme site (AAGCTT), reverse primer (SEQ ID No:3) 5 ' end band BamHI, restriction enzyme site (GGATCC), primer sequence is as follows:
Forward primer: AAGCTTCAAAAGAAACTGACACACGCCA HindIII
Reverse primer: GGATCCGCAAAAGCAAGAAGGGCAGTGA BamHI
Synthetic by Shenzhen Hua Da genome company.
The acquisition of step 2, promotor Posheat2
Taking the fine DNA of rice varieties Japan as template, utilize forward primer, reverse primer amplification promotor Posheat2, PCR system routinely, adopts following amplification program:
95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C are extended 2min30s, circulate 35 times; Last 72 DEG C are extended 10min.
Reclaim the object fragment of pcr amplification, object fragment length 1662bp, be connected to PGEM-T-Easy carrier (purchased from Promega company, mix in the ratio in carrier specification sheets) on, transform after intestinal bacteria XL-Blue competent cell according to heat shock method, competent cell is activated, and then object fragment is transferred in the competent cell of activation, then, obtain positive colony through bacterium colony PCR screening, picking mono-clonal shakes bacterium liquid upgrading grain, carries out double digestion checking with HindIII and BamHI, as shown in Figure 2.The order-checking of Invitrogen company will be delivered through the positive colony of qualification.Verify that correct clone is the promotor Posheat2 that will obtain, its nucleotide sequence is as shown in SEQ ID No:1.
The structure of plant expression vector and the conversion of Agrobacterium
In the positive colony obtaining " acquisition of promotor Posheat2 " process from above, extract plasmid, with HindIII and BamHI double digestion, reclaim promotor Posheat2 fragment.Utilize HindIII and BamHI to carry out linearization process to pCAMBIA1391 simultaneously, reclaim pCAMBIA1391, above-mentioned Posheat2 fragment is connected with T4 ligase enzyme for pCAMBIA1391 fragment (being purchased from TaKaRa company), obtain the plant expression vector pCAMBIA1391-Posheat2 (Figure 1B) of promotor Posheat2 and Gus gene fusion, utilize freeze-thaw method that plant expression vector is proceeded to agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved).
Utilize promotor Posheat2 to drive Gus reporter gene to express in paddy rice
Step 1: agriculture bacillus mediated rice transformation
Mature seed removes after clever shell, with 70% alcohol-pickled seed 1min, outwells alcohol.With 50% clorox that contains 1 Tween20 (stoste effective chlorine density is greater than 4%) solution soaking seed 40min (150r/min).Outwell clorox, aseptic washing 5 times is to solution clarification, without clorox taste.Sterilized water soaks seed and spends the night.Along the aleurone layer of seed, embryo is peeled with scalper, embryo is inoculated on calli induction media.Dark cultivation after 11 days callus and endosperm and germ separation at 30 DEG C, by go bud in good condition, divide vigorous elementary callus carry out preculture after 3~5 days for Agrobacterium-mediated Transformation.
Adopt the agrobacterium tumefaciens that has proceeded to recombinant expression vector in above-mentioned " structure of plant expression vector and the conversion of Agrobacterium " process to carry out agriculture bacillus mediated genetic transformation, this genetic transformation, transformant screening and transgenic plant regeneration etc. are with reference to Yongbo Duan (Yongbo Duan, Chenguang Zhai, et al.An efficient and high-throughput protocol for Agrobacterium mediated transformation based on phosphomannose isomerase positive selection in Japonica rice (Oryza sativa L.) [J] .Plant Cell Report, method 2012.DOI10.1007/s00299-012-1275-3.) etc. proposing.
Obtain altogether 17 strain Posheat2-pCAMBIA1391 plant (Posheat2::gus transgenic rice plant).
The heat shock Stress treatment of step 2, Posheat2-pCAMBIA1391 plant and the heat shock of Posheat2 response are active
The Posheat2-pCAMBIA1391 plant sprouting latter 7 days is placed in respectively to normal growth temperature (28 DEG C) and high temperature (42 DEG C), 1 hour, 4 hours, 8 hours, after within 12 hours and 24 hours, processing, get respectively complete stool sample, use the plant total RNA extraction reagent box of Tian Gen biochemical technology company limited to extract the total RNA of sample, the FastQuant RT test kit reverse transcription that re-uses Tian Gen biochemical technology company limited is cDNA, taking cDNA as template, taking ACTIN gene as internal reference, taking the SuperReal PreMix Plus real-time fluorescence quantitative PCR premixed liquid of Tian Gen biochemical technology company limited as reaction reagent, on the PRISM7500 of ABI company fluorescent PCR instrument, the GUS expression intensity driving by qRT-PCR reaction detection Posheat2.Wherein, for the quantitative qRT-PCR primer of demarcating ACTIN gene be:
ACTIN upstream primer: 5'-CCTTCAACACCCCTGCTATG-3 ',
ACTIN downstream primer: 5'-CAATGCCAGGGAACATAGTG-3 '
The qRT-PCR primer of expressing for detection of gus gene is:
GUS upstream primer: 5'-TACGGCAAAGTGTGGGTCAATAATCA-3 '
GUS downstream primer: 5'-CAGGTGTTCGGCGTGGTGTAGAG-3 '
Result demonstration, in Posheat2-pCAMBIA1391 plant, the expression amount of Gus gene, rising gradually after 42 DEG C of pyroprocessing, can reach 68 times under normal temps after 24 hours, the results are shown in Figure 3.This presentation of results Posheat2 has the driving activity that continues response high temperature stress, is a high temperature induction promotor.
Specific description of embodiments of the present invention above does not limit the present invention, and those skilled in the art can make according to the present invention various changes or distortion, only otherwise depart from spirit of the present invention, all should belong to the scope of claims of the present invention.
Claims (9)
1. a kind of plant high temperature induction is expressed promotor Posheat2, it is characterized in that, described plant abduction delivering promotor Posheat2 comprises the DNA sequence dna shown in SEQ ID No:1.
2. plant high temperature induction according to claim 1 is expressed promotor Posheat2, it is characterized in that, the DNA sequence dna that described plant high temperature induction is expressed promotor Posheat2 is the sequence shown in SEQ ID No:1.
3. plant high temperature induction according to claim 1 is expressed promotor Posheat2, it is characterized in that, the DNA sequence dna shown in DNA sequence dna and the SEQ ID No:1 of described plant high temperature induction expression promotor Posheat2 has at least 80% homology;
Or described plant high temperature induction is expressed promotor Posheat2 and add, replace, insert or delete mutant or allelotrope or the derivative that one or more Nucleotide generate in the DNA sequence dna shown in SEQ ID No:1;
Or described plant high temperature induction is expressed promotor Posheat2 and is had the product of hybridizing with the DNA sequence dna shown in SEQ ID No:1.
4. an expression cassette, is characterized in that, described expression cassette comprises the plant high temperature induction described in any one in claim 1-3 and expresses promotor Posheat2.
5. a recombinant expression vector, it is characterized in that, described recombinant expression vector comprises the plant high temperature induction described in any one in claim 1-3 and expresses promotor Posheat2, in described recombinant expression vector, described plant high temperature induction expression promotor Posheat2 is connected in the upstream of gene order to be expressed in carrier;
Preferably, described gene to be expressed is Gus gene, and described recombinant expression vector is pCAMBIA1391-Posheat2, and wherein pCAMBIA1391 is plant binary expression vector.
6. a Host Strains, it is characterized in that, described Host Strains comprises the plant high temperature induction described in any one in claim 1-3 and expresses promotor Posheat2, expression cassette claimed in claim 4 or recombinant expression vector according to claim 5, wherein, described Host Strains is agrobacterium tumefaciens.
7. a transformant, it is characterized in that, described transformant comprises the plant high temperature induction described in any one in claim 1-3 and expresses promotor Posheat2, expression cassette claimed in claim 4 or recombinant expression vector according to claim 5 or Host Strains claimed in claim 6.
8. express promotor Posheat2 in the application of cultivating in transgenic plant according to the plant high temperature induction described in any one in claim 1-3 for one kind, it is characterized in that, described application comprises: be connected in gene order upstream to be expressed in carrier by expressing promotor Posheat2 according to the plant high temperature induction described in any one in claim 1-3, thereby build recombinant expression vector; Described recombinant expression vector is transformed in vegetable cell, tissue or organ and is cultivated.
9. application according to claim 8, is characterized in that, described application is for improving plant growth characteristic, and described plant is monocotyledons: paddy rice, wheat, corn, barley, Chinese sorghum or oat.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410325505.5A CN104073491B (en) | 2014-07-08 | 2014-07-08 | Plant high temperature induction expresses promotor Posheat2 and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410325505.5A CN104073491B (en) | 2014-07-08 | 2014-07-08 | Plant high temperature induction expresses promotor Posheat2 and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104073491A true CN104073491A (en) | 2014-10-01 |
CN104073491B CN104073491B (en) | 2016-04-20 |
Family
ID=51595097
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410325505.5A Expired - Fee Related CN104073491B (en) | 2014-07-08 | 2014-07-08 | Plant high temperature induction expresses promotor Posheat2 and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104073491B (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104059919A (en) * | 2014-07-08 | 2014-09-24 | 安徽省农业科学院水稻研究所 | Plant thermal-activation inducible promoter Posheat3 and application thereof |
CN106868017A (en) * | 2017-03-02 | 2017-06-20 | 湖南农业大学 | A kind of adjusting and controlling rice seedling stage heat resistance gene TBZ1 and application |
CN112680446A (en) * | 2020-12-29 | 2021-04-20 | 深圳大学 | Corn heat-inducible promoter ZmBI-1-pro and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101781652A (en) * | 2010-02-09 | 2010-07-21 | 北京林业大学 | High temperature inducible promoter |
CN101979559A (en) * | 2010-10-29 | 2011-02-23 | 复旦大学 | High-temperature induced promoter and application thereof |
-
2014
- 2014-07-08 CN CN201410325505.5A patent/CN104073491B/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101781652A (en) * | 2010-02-09 | 2010-07-21 | 北京林业大学 | High temperature inducible promoter |
CN101979559A (en) * | 2010-10-29 | 2011-02-23 | 复旦大学 | High-temperature induced promoter and application thereof |
Non-Patent Citations (3)
Title |
---|
PANDIT ET AL.: "AC136491.4", 《GENBANK》 * |
聂丽娜等: "植物基因启动子的克隆及其功能研究进展", 《植物遗传资源学报》 * |
郝中娜等: "水稻OsWRKY89基因启动子的表达特性", 《中国水稻科学》 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104059919A (en) * | 2014-07-08 | 2014-09-24 | 安徽省农业科学院水稻研究所 | Plant thermal-activation inducible promoter Posheat3 and application thereof |
CN106868017A (en) * | 2017-03-02 | 2017-06-20 | 湖南农业大学 | A kind of adjusting and controlling rice seedling stage heat resistance gene TBZ1 and application |
CN112680446A (en) * | 2020-12-29 | 2021-04-20 | 深圳大学 | Corn heat-inducible promoter ZmBI-1-pro and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN104073491B (en) | 2016-04-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104946649B (en) | A kind of Rice Anther specific expression promoter OsAnth1 | |
CN103849622A (en) | Plant cold-induced expression promoter Poscold 2 and application thereof | |
CN104073491B (en) | Plant high temperature induction expresses promotor Posheat2 and application thereof | |
CN103540592B (en) | A kind of rice endosperm specific expresses promotor and application thereof | |
CN103882023B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro2 and application thereof | |
CN103865930B (en) | A kind of cold abduction delivering promotor Poscold3 of plant stem-leaf and application thereof | |
CN103088022B (en) | Plant-salt-induced expression promoter | |
CN105063047A (en) | Plant seed specific expression promotor OsSee1 | |
CN104087588A (en) | Rice drought-induced promoter POsDro4 responding to environmental water stress | |
CN104087587B (en) | A kind of plant drouhgt stress abduction delivering promotor and application | |
CN103834661B (en) | A kind of vegetable hot abduction delivering promotor Posheat1 and application thereof | |
CN103740720A (en) | Identification and application of rice root specific strong promoter POsRo2 | |
CN104046629A (en) | Plant salt inducible expression promoter POsSalt1 and application thereof | |
CN103849621A (en) | Plant cold inducible expression promoter Poscold1 and application thereof | |
CN104073493B (en) | The cold induction strongly expressed promoter Poscold4 of plant and application thereof | |
CN103031303B (en) | Identification and applications of plant pulvinus specific expression promoter ProCol1 | |
CN104845974B (en) | The DNA fragmentation POscold5 of long-term cold stress can be responded | |
CN103882021A (en) | Plant drought induced expression promoter PosDro1 and application thereof | |
CN105087591B (en) | Paddy rice root tip specific expression promoter POsRo3 | |
CN103710344A (en) | Plant endosperm specificity expression promoter pENP2 and application thereof | |
CN104845973B (en) | The strong evoked promoter POscold6 of paddy rice low clone and application | |
CN104073490B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro3 | |
CN103740721B (en) | A kind of Plant coleoptile specific expression promoter and application thereof | |
CN103725680B (en) | Plant endosperm specificity expression promoter pENP3 and application thereof | |
CN105087590B (en) | A kind of promoter element POsCold8 and its application method and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160420 Termination date: 20170708 |