CN104059919A - Plant thermal-activation inducible promoter Posheat3 and application thereof - Google Patents
Plant thermal-activation inducible promoter Posheat3 and application thereof Download PDFInfo
- Publication number
- CN104059919A CN104059919A CN201410325527.1A CN201410325527A CN104059919A CN 104059919 A CN104059919 A CN 104059919A CN 201410325527 A CN201410325527 A CN 201410325527A CN 104059919 A CN104059919 A CN 104059919A
- Authority
- CN
- China
- Prior art keywords
- plant
- posheat3
- heat shock
- expression vector
- abduction delivering
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a rice thermal-activation inducible promoter Posheat3 and an application thereof. The invention further provides an expression cassette containing the promoter, a plant expression vector and a converter. Specifically, the promoter is applied to plant transgenic engineering. The promoter provided by the invention can drive a gene to express in plants under a strict thermal activation condition, and therefore, the promoter can be used as a control switch of a biological reactor to determine expression opportunity and strength of a target gene in a plant cell; meanwhile, the promoter has extensive use in heat-resistant transgenic improvement of the plants.
Description
Technical field
The present invention relates to biotechnology and plant gene engineering technology field.Particularly, the present invention relates to a kind of plant heat shock abduction delivering promotor and application thereof, this promotor can drive target gene in plant, to express in heat shock situation in Transgenic Rice adjustment and control system.
Background technology
Due to the impact of industrialization and mankind's activity, global warming problem becomes increasingly conspicuous.The climate characteristic of the global warming that climate change group of United Nations proposes: the one, earth surface temperature on average continues to raise, and 1 Fahrenheit degree has only just risen since the century.Over nearly more than 50 years, within average every 10 years, raise 0.13 ℃.The 2nd, it is large that climate change standard deviation becomes, and extreme weather increases.Be subject to the impact of global warming, over nearly 20 years, high warm evil causes China's grain drop in production, and particularly the paddy rice underproduction frequently occurs, wherein most serious of all 1994,2003 and 2010.Summer in 2003, there is very rare thermal extremes weather in south China, and the above high temperature in 38 ℃, part rice district has continued 20 days.This time heat evil just in time occurs in Rice Heading blooming stage, to Rice Production, brings heavy losses, disaster area also reached historical.Wherein only the disaster area of Hubei and Anhui two provinces has just reached more than 80 ten thousand hm
2.
High temperature has become affects one of principal element of crop yield and quality.Cultivating resistant to elevated temperatures improved Varieties is the key that solves high crop yield On Stable Production.Vegetable cell starts the expression of heat shock responsive genes widely at transcriptional level, to maintain the stability of cell under the condition of high temperature.But composing type or overexpression crop high temperature resistance gene often under normal temps grow and output affects greatly.Therefore, utilizing crop gene controlled expression system, accurately design and control high-temperature response gene timely and appropriate discovery and express, is the key that exploitation has the high temperature resistant crop varieties of practical value.
At present, applicable control of plant gene expression system mainly contains ethanol regulator control system, glucocorticosteroid regulator control system, copper regulator control system, IPTG regulator control system and tsiklomitsin regulator control system etc.These systems have all been utilized exogenous induction material, and maintain the continuous supply of high-level continuous expression needs of foreign gene or repeatedly use inductor, and this exists in actual applications difficulty and is subject to the impact of environmental factors larger; Meanwhile, some inductor, if tsiklomitsin is easily by photolysis, can cause physiology injury to plant when copper, silver ions etc. surpass finite concentration; In addition, also there is species limitation in some regulator control system, as alcohol induced mode does not have application success in model plant Arabidopis thaliana.Heat shock regulator control system is to utilize heat-inducible promoter regulation and control goal gene, controlled by temperature, overcome and utilized inductor to the toxigenous shortcoming of plant, there is not drug residue, can not bring people and animals to injure and potential problem of environmental pollution, economic input is few and be convenient to carry out accuracy controlling under test conditions.The current heat-inducible promoter of Activities of Some Plants, as Arabidopis thaliana Hsp18.2 and soybean Hsp17.5 etc. has been applied, but monocotyledons particularly the report in paddy rice is less.
Summary of the invention
The object of this invention is to provide a kind of promotor that drives foreign gene to express under heat-inducible condition, obtain the transformant contain this promoter sequence and the application of this promotor.Wherein, related " plant " refers to monocotyledons herein, and for example paddy rice, wheat, corn, barley, Chinese sorghum or oat, be preferably paddy rice.
To achieve these goals, on the one hand, the invention provides a kind of plant heat shock abduction delivering promotor, described plant heat shock abduction delivering promotor comprises following nucleotide sequence:
This DNA sequence dna is expressed promotor for deriving from the paddy rice heat-inducible of Japanese fine paddy rice (Oryza sativa L cv.Nipponbare), is called Posheat3 or promotor Posheat3 herein.It should be noted that: in the DNA sequence dna of above-mentioned promotor, the retention sequence of the forward primer that sequence " agtacgacgc ctaagggaca ga " that italic overstriking represent used in obtaining promotor process, altogether 22bp are take in sequence beginning; The retention sequence (the corresponding sequence complementation of this retentions sequence and reverse primer) of the reverse primer that sequence " atag gacttggcat gatgggga " that italic overstriking represent used in obtaining promotor process, altogether 22bp be take in sequence end; In this DNA sequence dna, remaining part is available from the DNA sequence dna in the fine paddy rice of Japan.It is emphasized that the promotor mentioned both can refer to above-mentioned whole DNA sequence dna herein, also can refer to remove above-mentioned primer and retain the DNA sequence dna after sequence.
Preferably, the DNA sequence dna of plant heat shock abduction delivering promotor provided by the invention is promotor Posheat3.
On the other hand, the present invention also provides a kind of expression cassette that comprises above-mentioned plant heat shock abduction delivering promotor Posheat3.
Another aspect, the present invention also provides a kind of recombinant expression vector, described recombinant expression vector comprises above-mentioned plant heat shock abduction delivering promotor Posheat3, in described recombinant expression vector, described plant heat shock abduction delivering promotor Posheat3 is connected in the upstream of gene order to be expressed; Preferably, described gene to be expressed is Gus gene, described recombinant expression vector is pCAMBIA1391-Posheat3, this recombinant expression vector, for being that Posheat3 or promotor Posheat3 are implemented in the recombinant expression vector obtaining in pCAMBIA1391 by the sequence shown in SEQ ID No:1, is called pCAMBIA1391-Posheat3 herein.More preferably, described gene to be expressed is for providing high temperature resistant proterties gene for plant.
On the other hand, the present invention also provides a kind of Host Strains, and described Host Strains comprises above-mentioned plant heat shock abduction delivering promotor provided by the invention, above-mentioned expression cassette or above-mentioned recombinant expression vector; Preferably, described Host Strains is agrobacterium tumefaciens.
On the other hand, the invention provides a kind of transformant, described transformant comprises above-mentioned plant heat shock abduction delivering promotor provided by the invention, above-mentioned expression cassette, above-mentioned recombinant expression vector or above-mentioned Host Strains.Wherein, described transformant is preferably transgenic cell line, callus or plant.
Again on the one hand, the invention provides the application of above-mentioned plant heat shock abduction delivering promotor in cultivating transgenic plant.Described application comprise above-mentioned plant heat shock abduction delivering promotor provided by the invention is connected in to carrier gene order upstream to be expressed (for example, before described promoter sequence is placed in to target gene), thereby structure recombinant expression vector, is transformed into described recombinant expression vector in vegetable cell, tissue or organ and cultivates.
And preferably, described application can be for improving plant growth characteristic, and described plant is monocotyledons, and for example paddy rice, wheat, corn, barley, Chinese sorghum or oat, be preferably paddy rice.
In sum, the present inventor finds that the section of DNA fragment of Japanese fine paddy rice (Oryza sativa L cv.Nipponbare) has the characteristic that drives other genes to express under high-temperature situation, and separating clone obtains the DNA sequence dna that structure comprises the 1878bp of transcription initiation site from the fine paddy rice of Japan, and by its called after Posheat3 (the SEQ ID No:1 in sequence table).This sequence after cutting, enzyme is connected on plant binary expression vector pCAMBIA1391, obtain corresponding recombinant plasmid (being recombinant expression vector), utilize this recombinant plasmid transformed agrobacterium tumefaciens bacterial strain EHA105, then by agriculture bacillus mediated method, carry out the conversion of paddy rice, obtain transgenic rice plant.The transgenic paddy rice obtaining is carried out to histological chemistry and detect discovery, transfer-gen plant is after heat-inducible is processed, the relatively high and aobvious blueness of Gus gene expression dose on the whole, thereby the sequence that proves this 1878bp has the activity that drives genetic expression, and the Gus gene of this promoters driven is expressed after paddy rice heat-inducible is processed.
Promoter sequence of the present invention can be connected with plant binary expression vector, for replacing constitutive promoter.And this promoter sequence can be connected with required target gene, build recombinant plant expression vector, after transforming, after heat-inducible is processed, can drive target gene specific expressed in plant, thereby improve the expression amount of external source target gene in plant, increase genetically modified effect.
Technique effect
The rice starter Posheat3 that the present invention clones can regulatory gene is specific expresses in plant in heat shock situation, has in actual applications remarkable value.In genetically engineered, use this promotor can accurately control by temperature variation expression opportunity and the intensity of target gene in plant bioreactor cell, simultaneously, utilize this promotor to carry out genetic modification to variety of crops, as expressed in plant by this promoters driven target gene, can improve and improve the resistance to elevated temperatures of paddy rice.
Accompanying drawing explanation
Below, describe by reference to the accompanying drawings embodiment of the present invention in detail, wherein:
Fig. 1 is for to be implemented in the schematic diagram in pCAMBIA1391 vector plasmid by Posheat3 promotor, wherein in Fig. 1, A is pCAMBIA1391 schematic diagram, B is pCAMBIA1391-Posheat3 schematic diagram, wherein shows the gus gene that utilizes Posheat3 promoters driven to be positioned at its downstream and expresses;
Fig. 2 is for to carry out to promotor of the present invention the result schematic diagram that enzyme is cut checking.
Fig. 3 is by the Posheat3::gus transgenosis seedling sprouting after 7 days, is placed under 42 ℃ of conditions and processes respectively 1 hour and 4 hours, carrys out Analog heat-treating condition, and the seedling of take is placed in normal temperature as contrast simultaneously.The induced activity of promotor obtains by comparing the variation of (representing with colourless open tubular column) gus gene expression level under thermal treatment (representing with solid black post) and normal temps cultivation.
Embodiment
Referring to specific embodiment, the present invention is described.It will be appreciated by those skilled in the art that these embodiment are only for the present invention is described, the scope that it does not limit the present invention in any way.
Experimental technique in following embodiment, if no special instructions, is ordinary method.In following embodiment, medicinal raw material used, reagent material etc., if no special instructions, be commercially available purchase product.
The acquisition of the Posheat3 promotor that contains restriction enzyme site
The design of step 1, primer
According to the rice varieties Japan providing in NCBI fine (Oryza sativa L cv.Nipponbare) whole genome sequence, sequences Design amplimer according to paddy rice Posheat3 gene, and according to the feature of the carrier of selecting and target gene, the restriction enzyme site of design primer.
In the present embodiment with paddy rice binary expression vector pCAMBIA1391 (Figure 1A, come from CAMBIA, openly use carrier, genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved) be example, target gene is Gus gene, the primer of specific design is: forward primer (SEQ ID No:2) 5 ' end band SalI, restriction enzyme site (GTCGAC), reverse primer (SEQ ID No:3) 5 ' end band EcoRI, restriction enzyme site (GAATTC), primer sequence is as follows:
Forward primer: GTCGACAGTACGACGCCTAAGGGACAGA SalI
Reverse primer: GAATTCTCCCCATCATGCCAAGTCCTAT EcoRI
Synthetic by Shenzhen Hua Da genome company.
The acquisition of step 2, promotor Posheat3
The fine DNA of rice varieties Japan of take is template, utilizes forward primer, reverse primer amplification promotor Posheat3, and PCR system routinely adopts following amplification program:
95 ℃ of denaturation 5min; 95 ℃ of sex change 30s, 58 ℃ of annealing 30s, 72 ℃ are extended 2min30s, circulate 35 times; Last 72 ℃ are extended 10min.
Reclaim the object fragment of pcr amplification, object fragment length 1878bp, be connected to PGEM-T-Easy carrier (purchased from Promega company, in the ratio in carrier specification sheets, mix) on, according to heat shock method, transform after intestinal bacteria XL-Blue competent cell, competent cell is activated, and then object fragment is transferred in the competent cell of activation, then, through bacterium colony PCR screening, obtain positive colony, picking mono-clonal shakes bacterium liquid upgrading grain, carries out double digestion checking, as shown in Figure 2 with SalI and EcoRI.The order-checking of Invitrogen company will be delivered through the positive colony of identifying.Verify that correct clone is the promotor Posheat3 that will obtain, its nucleotide sequence is as shown in SEQ ID No:1.
The structure of plant expression vector and the conversion of Agrobacterium
In the positive colony obtaining " acquisition of promotor Posheat3 " process from above, extract plasmid, with SalI and EcoRI double digestion, reclaim promotor Posheat3 fragment.Utilize SalI and EcoRI to carry out linearization process to pCAMBIA1391 simultaneously, reclaim pCAMBIA1391, above-mentioned Posheat3 fragment is connected with T4 ligase enzyme for pCAMBIA1391 fragment (being purchased from TaKaRa company), obtain the plant expression vector pCAMBIA1391-Posheat3 (Figure 1B) of promotor Posheat3 and Gus gene fusion, utilize freeze-thaw method that plant expression vector is proceeded to agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved).
Utilize promotor Posheat3 to drive Gus reporter gene to express in paddy rice
Step 1: agriculture bacillus mediated rice transformation
Mature seed removes after clever shell, with 70% alcohol-pickled seed 1min, outwells alcohol.With 50% clorox that contains 1 Tween20 (stoste effective chlorine density is greater than 4%) solution soaking seed 40min (150r/min).Outwell clorox, aseptic washing 5 times is to solution clarification, without clorox taste.Sterilized water soaks seed and spends the night.Aleurone layer with scalper along seed peels embryo, and embryo is inoculated on calli induction media.Dark cultivation after 11 days callus and endosperm and germ separation at 30 ℃, by go bud in good condition, divide vigorous elementary callus carry out preculture after 3～5 days for Agrobacterium-mediated Transformation.
Adopt the agrobacterium tumefaciens that has proceeded to recombinant expression vector in above-mentioned " structure of plant expression vector and the conversion of Agrobacterium " process to carry out agriculture bacillus mediated genetic transformation, obtain altogether 27 strain Posheat3-pCAMBIA1391 plant (Posheat3::gus transgenic rice plant).
This genetic transformation, transformant screening and transgenic plant regeneration etc. are with reference to Yongbo Duan (Yongbo Duan, Chenguang Zhai, et al.An efficient and high-throughputprotocol for Agrobacterium mediated transformation based on phosphomannoseisomerase positive selection in Japonica rice (Oryza sativa L.) [J] .Plant CellReport, 2012.DOI10.1007/s00299-012-1275-3.) etc. the method that proposes.
The heat shock Stress treatment of step 2, Posheat3-pCAMBIA1391 plant and the heat shock of Posheat3 response are active
The Posheat3-pCAMBIA1391 plant sprouting latter 7 days is placed in respectively to normal growth temperature (28 ℃) and high temperature (42 ℃), after 1 hour and 4 hours, get respectively complete stool sample, use the plant total RNA extraction reagent box of Tian Gen biochemical technology company limited to extract the total RNA of sample, the FastQuant RT test kit reverse transcription that re-uses Tian Gen biochemical technology company limited is cDNA, take cDNA as template, take ACTIN gene as internal reference, the SuperRealPreMix Plus real-time fluorescence quantitative PCR premixed liquid of Yi Tiangen biochemical technology company limited is reaction reagent, on the PRISM7500 fluorescent PCR instrument of ABI company, the GUS expression intensity driving by qRT-PCR reaction detection Posheat3.Wherein, for demarcating the quantitative qRT-PCR primer of ACTIN gene, be:
ACTIN upstream primer: 5'-CCTTCAACACCCCTGCTATG-3 ',
ACTIN downstream primer: 5'-CAATGCCAGGGAACATAGTG-3 '
The qRT-PCR primer of expressing for detection of gus gene is:
GUS upstream primer: 5'-TACGGCAAAGTGTGGGTCAATAATCA-3 '
GUS downstream primer: 5'-CAGGTGTTCGGCGTGGTGTAGAG-3 '
Result shows, can reach normal temps growth after 1 hour through 42 ℃ of pyroprocessing time 18.63 times of the expression amount of Gus gene in Posheat3-pCAMBIA1391 plant, and processing after 4 hours is approximately 15.22 times under normal temps, the results are shown in Figure 3.This presentation of results Posheat3 has fast and significantly responds the driving activity of heat-inducible, is a heat-inducible promotor.
Specific description of embodiments of the present invention above does not limit the present invention, and those skilled in the art can make according to the present invention various changes or distortion, only otherwise depart from spirit of the present invention, all should belong to the scope of claims of the present invention.
Claims (8)
1. a plant heat shock abduction delivering promotor Posheat3, is characterized in that, described plant heat shock abduction delivering promotor Posheat3 comprises following nucleotide sequence:
2. plant heat shock abduction delivering promotor Posheat3 according to claim 1, is characterized in that, the DNA sequence dna of described plant heat shock abduction delivering promotor is the sequence shown in claim 1.
3. an expression cassette, is characterized in that, described expression cassette comprises the plant heat shock abduction delivering promotor Posheat3 described in any one in claim 1-2.
4. a recombinant expression vector, it is characterized in that, described recombinant expression vector comprises the plant heat shock abduction delivering promotor Posheat3 described in any one in claim 1-3, in described recombinant expression vector, described plant heat shock abduction delivering promotor is connected in the upstream of gene order to be expressed in carrier;
Preferably, described gene to be expressed is Gus gene, and described recombinant expression vector is pCAMBIA1391-Posheat3, and wherein pCAMBIA1391 is plant binary expression vector.
5. recombinant expression vector according to claim 4, is characterized in that, described gene to be expressed is thermotolerance gene.
6. a transformant, is characterized in that, described transformant comprises plant heat shock abduction delivering promotor, expression cassette claimed in claim 3 or the recombinant expression vector according to claim 5 described in any one in claim 1-2.
7. the application in cultivating transgenic plant according to the plant heat shock abduction delivering promotor described in any one in claim 1-3, it is characterized in that, described application comprises: will be connected in gene order upstream to be expressed in carrier according to the plant heat shock abduction delivering promotor described in any one in claim 1-3, thereby build recombinant expression vector; Described recombinant expression vector is transformed in vegetable cell, tissue or organ and is cultivated.
8. application according to claim 7, is characterized in that, described application is for improving plant growth characteristic, and described plant is monocotyledons: paddy rice, wheat, corn, barley, Chinese sorghum or oat.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410325527.1A CN104059919B (en) | 2014-07-08 | 2014-07-08 | Plant heat shock evoked promoter Posheat3 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410325527.1A CN104059919B (en) | 2014-07-08 | 2014-07-08 | Plant heat shock evoked promoter Posheat3 and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104059919A true CN104059919A (en) | 2014-09-24 |
| CN104059919B CN104059919B (en) | 2016-10-12 |
Family
ID=51547850
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410325527.1A Expired - Fee Related CN104059919B (en) | 2014-07-08 | 2014-07-08 | Plant heat shock evoked promoter Posheat3 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104059919B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103834661A (en) * | 2014-03-24 | 2014-06-04 | 安徽省农业科学院水稻研究所 | Thermal induction expression promoter Posheat1 of plant and application of promoter Posheat1 |
| CN103849622A (en) * | 2014-03-27 | 2014-06-11 | 安徽省农业科学院水稻研究所 | Plant cold-induced expression promoter Poscold 2 and application thereof |
| CN103849621A (en) * | 2014-03-24 | 2014-06-11 | 安徽省农业科学院水稻研究所 | Plant cold inducible expression promoter Poscold1 and application thereof |
| CN103865930A (en) * | 2014-03-27 | 2014-06-18 | 安徽省农业科学院水稻研究所 | Cold inducible expression promoter Poscold3 of plant stem leaf and application of promoter |
| CN104073491A (en) * | 2014-07-08 | 2014-10-01 | 安徽省农业科学院水稻研究所 | High-temperature-induced expressed plant promoter Posheat2 and application thereof |
-
2014
- 2014-07-08 CN CN201410325527.1A patent/CN104059919B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103834661A (en) * | 2014-03-24 | 2014-06-04 | 安徽省农业科学院水稻研究所 | Thermal induction expression promoter Posheat1 of plant and application of promoter Posheat1 |
| CN103849621A (en) * | 2014-03-24 | 2014-06-11 | 安徽省农业科学院水稻研究所 | Plant cold inducible expression promoter Poscold1 and application thereof |
| CN103849622A (en) * | 2014-03-27 | 2014-06-11 | 安徽省农业科学院水稻研究所 | Plant cold-induced expression promoter Poscold 2 and application thereof |
| CN103865930A (en) * | 2014-03-27 | 2014-06-18 | 安徽省农业科学院水稻研究所 | Cold inducible expression promoter Poscold3 of plant stem leaf and application of promoter |
| CN104073491A (en) * | 2014-07-08 | 2014-10-01 | 安徽省农业科学院水稻研究所 | High-temperature-induced expressed plant promoter Posheat2 and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| WWW.NCBI.NLM.NIH.GOV/GENBANK: "Genbank Accession：AL606995.3", 《WWW.NCBI.NLM.NIH.GOV/GENBANK》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104059919B (en) | 2016-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103849622B (en) | The cold abduction delivering promotor Poscold2 of one kind of plant and application thereof | |
| CN104073491B (en) | Plant high temperature induction expresses promotor Posheat2 and application thereof | |
| CN103540592B (en) | A kind of rice endosperm specific expresses promotor and application thereof | |
| CN103865930B (en) | A kind of cold abduction delivering promotor Poscold3 of plant stem-leaf and application thereof | |
| CN103882023B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro2 and application thereof | |
| CN103740720B (en) | Identification and application of rice root specific strong promoter POsRo2 | |
| CN104087588B (en) | The rice drought-inducible promoter POsDro4 of response environment water stress | |
| CN103849621B (en) | The cold abduction delivering promotor Poscold1 of one kind of plant and application thereof | |
| CN105063047A (en) | Plant seed specific expression promotor OsSee1 | |
| CN104087587B (en) | A kind of plant drouhgt stress abduction delivering promotor and application | |
| CN104046629A (en) | Plant salt inducible expression promoter POsSalt1 and application thereof | |
| CN103834661B (en) | A kind of vegetable hot abduction delivering promotor Posheat1 and application thereof | |
| CN104073493B (en) | The cold induction strongly expressed promoter Poscold4 of plant and application thereof | |
| CN103882021B (en) | One Plants drought-induced expression promoter PosDro1 and application thereof | |
| CN103031303B (en) | Identification and applications of plant pulvinus specific expression promoter ProCol1 | |
| CN105567694A (en) | High-expression-activity rice non-seed expression promoter SAFES4 and application thereof | |
| CN104059919A (en) | Plant thermal-activation inducible promoter Posheat3 and application thereof | |
| CN104073490B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro3 | |
| CN103710344A (en) | Plant endosperm specificity expression promoter pENP2 and application thereof | |
| CN104845974B (en) | The DNA fragmentation POscold5 of long-term cold stress can be responded | |
| CN103740721B (en) | A kind of Plant coleoptile specific expression promoter and application thereof | |
| CN103725680B (en) | Plant endosperm specificity expression promoter pENP3 and application thereof | |
| CN103773766A (en) | Rice root specificity expression promoter POsRo1 and application thereof | |
| CN111763672B (en) | Rice low-temperature inducible expression promoter Poscold10 and application thereof | |
| CN103540594B (en) | A kind of rice starter being mechanically damaged abduction delivering |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20161012 Termination date: 20170708 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |