CN102021179B - Application of rice gene KT484 to improvement of stress tolerance performance of plants - Google Patents

Abstract

The invention discloses a gene KT484 which comes from rice and is related to tolerance performance. Proved by experiments, the gene transformation rice of the invention can remarkably improve the rice resistance to adversity stress drought and low temperature. The protein and the encoding gene thereof have important academic and practical meanings to the research of a plant stress tolerance mechanism and the improvement of plant stress tolerance and related properties, can exert important action in the stress tolerance gene engineering improvement of plants (particularly cereal crops) and have wide application prospects.

Description

A paddy gene KT484 is in the application that improves on the plant stress tolerance ability

Technical field

The present invention relates to plant genetic engineering and biology field, be specifically related to plant stress tolerance relevant gene and application thereof.

Background technology

Transcription factor is the key gene of one type of regulate gene expression, and growing of crop played important regulatory role.Utilize the bioinformation means, the transcription factor gene of inferring from genomic level according to the constructional feature of transcription factor is one group of gene that most possibly has clear and definite function.For many years, the clone of transcription factor and functional study are one of focuses of scientific research always.A large amount of transcription factor that scientists has been utilized different study route isolation identification has been enriched the transcription factor DB, has also therefrom found some relevant regulatory factors with economical character, for the character improvements of farm crop provides the important gene resource.

Transcription factor is the key gene of regulate gene expression, and growing of crop played important regulatory role.For many years; The clone of transcription factor and functional study are one of focuses of scientific research always; A large amount of transcription factor that scientists has been utilized different study route isolation identification; Some regulatory factors relevant have also therefrom been found, for the character improvements of farm crop provides the important gene resource with economical character.Paddy rice is the unifacial leaf model plant, is again the important food crop of China.After the rice genome examining order was accomplished, many DBs were analyzed rice genome.It is predicted; In long-grained nonglutinous rice and japonica rice, comprise 2 respectively; 025 and 2,384 transcription factors belong to 63 transcription factor gene families; Like WRKY (111/113, long-grained nonglutinous rice/japonica rice), bZIP (88/109), AP2/EREBP (174/182), AUX/IAA (30/46), MYB (136/138), HB (84/103) etc.According to bibliographical information and database function note in the past; Here both comprised the peculiar transcription factor family of plant; Like WRKY, also comprise and closely-related some other transcription factor families such as growth and development of plants, resistance, like bZIP, AP2/EREBP, MYB etc.Utilize these DBs; In conjunction with gene expression informations such as gene chip hybridization, est sequences; From genomic level prediction and separating rice transcription factor full-length cDNA; And utilize the system of rice conversion efficiently set up to make its overexpression in paddy rice, and it is carried out the mass-producing functional verification, further the phenotype through the research transgenic paddy rice changes and the characteristics such as change of anti-adversity are inferred the function of transcription factor; On the basis of work such as the Plant Transformation of a large amount of repeatability, phenotype analytical, Function Identification; Searching has practical value in the improvement farm crop the important regulatory factor of plant; And be applied to the character improvement of crop; Thereby effectively solve the practical problems in the agriculture prodn, have important significance for theories and using value.

Summary of the invention

The purpose of this invention is to provide a paddy gene KT484 relevant, to be used to improve the resistance of reverse ability of plant with resistance of reverse.

Gene KT484 provided by the present invention derives from Oryza paddy rice (Oryza sativa L.), and coding has the protein of following aminoacid sequence:

1) the SEQ ID NO:1 in the sequence table;

SEQ ID NO:1 in the sequence table is made up of 250 amino-acid residues, is albumen KT484.

The encoding sox of KT484 both can be the cDNA sequence of said gene among the present invention, also can be the genomic dna sequence of said gene, or had 90% above homology and the proteic dna sequence dna of coding identical function with said gene.Encoding sox with aminoacid sequence shown in the SEQ ID NO:1 can have the nucleotide sequence of SEQ ID NO:2 in the sequence table.

Contain expression carrier of the present invention, transgenic cell line and host bacterium and all belong to protection scope of the present invention.

The arbitrary segmental primer of amplification KT484 is to also within protection scope of the present invention.

Another object of the present invention provides a kind of method that improves plant stress tolerance.

The method of raising plant stress tolerance provided by the present invention is that plant stress tolerance obtains to improve with code book invention KT484 gene transfered plant tissue, cell or the organ relevant with resistance of reverse.

In the method for above-mentioned raising plant stress tolerance, the KT484 gene that paddy rice is relevant with resistance of reverse among the present invention both can be the cDNA sequence of said gene, also can be the genomic gene sequence of said gene; Having 90% above homology and coding identical function proteic dna sequence dna with said gene, is the cDNA of said gene or genomic gene sequence to be separated and/or modified and/or design with known method obtain.What it should be appreciated by those skilled in the art is; The minor alteration of Nucleotide identity may cause the reduction or the reinforcement of this gene usefulness in the specific gene sequence; And (for example in some application; Antisense or inhibition technology altogether) in, partial sequence plays a role through regular meeting and full length sequence equally effectively.The method that gene order changes or shortens, and the method for testing the validity of these genes that change all is well known to those skilled in the art.

The relevant KT484 gene with resistance of reverse of paddy rice of the present invention or its homologous sequence can import plant tissue, cell or organ through plant expression vector; The carrier that sets out that is used to make up said plant expression vector can be any one and can be used for the carrier etc. that agrobacterium tumefaciens or Agrobacterium rhizogenes transform the binary vector of plant or can be used for the plant micropellet bombardment, like pBin serial carrier (like pBin19 etc.), pBI serial carrier (like pBI 101 etc.), Gateway ^TWSerial carrier (like pH2GW7 etc.), pCAMBIA serial carrier (like pCAMBIA 3301 etc.), per8, pX6 or other plant expression vector of deriving; The said carrier that sets out also can be the carrier that can in prokaryotic organism, duplicate, like pENTER-TOPO, pUC serial carrier or pBluescript serial carrier etc.

When using paddy rice is relevant with resistance of reverse among the present invention KT484 gene or its homologous sequence structure plant expression vector, before its transcription initiation Nucleotide, can add any enhancement type, composing type, organizing specific type or induction type (ABA, arid, saline and alkaline or chemically induced etc.) promotor.Said constructive expression's promotor can be cauliflower mosaic virus (CAMV) 35S promoter, corn Ubiquitin promotor or paddy rice actin1 promotor etc.; Said tissue specificity expression promoter can be root-specific expression promotor, blade specific is expressed promotor, dimension pipe specific expressing promoter, seed-specific expression promotor, flower specific expression promotor or pollen specific expression promotor; Like 2S1 promotor (GenBank number: NM_118848.2; GI:30687489) and NapinA (GenBank number: M64633.1, GI:349405) promotor etc.; Said inducible promoter can be and receives inductive promotors such as low temperature, arid, ABA, ethene, saline and alkaline or chemistry.Above-mentioned promotor can be used separately or be used in combination with other plant promoter.In addition; When using gene constructed plant expression vector of the present invention; Also can use enhanser, comprise translational enhancer and/or transcriptional enhancer, these enhanser zones can be ATG initiator codon or neighboring region initiator codon etc.; But must be identical with the reading frame of encoding sequence, to guarantee the correct translation of whole sequence.The source of said translation wave and initiator codon is widely, can be natural, also can be synthetic.Translation initiation region can be from transcription initiation zone or structure gene.

For the ease of transgenic plant cells or plant being identified and screening; Can process used plant expression vector, can produce the enzyme of colour-change or the gene of luminophor (gus gene, GFP gene, luciferase genes etc.) as adding the coding that in plant, to express, have antibiotic marker thing (neomycin phosphotransferase (NPTII) gene, hygromix phosphotransferase (Hygromycin phosphotransferase) gene, qingfengmeisu qiong affinity tag or kantlex affinity tag etc.) or the anti-chemical reagent marker gene (like anti-weedkiller gene) of resistance etc.Said host plant cell, tissue or the organ that contains neomycin phosphotransferase (NPTII) gene can be screened by kantlex or its substituted derivatives such as G418 etc., and the host plant cell, tissue or the organ that contain hygromix phosphotransferase (Hygromycin phosphotransferase) gene can be screened by Totomycin.From the security consideration of transgenic plant, can not add any selected marker, directly with adverse circumstance screening transformed plant.After aforesaid method screens, also can adopt Southern, PCR or dot blot equimolecular detection means that transfer-gen plant is detected, whether transform goal gene to confirm it.

Wherein, the present invention is the carrier that sets out with pCAMBIA1300, the plant expression vector called after pCactF-KT484 that contains the paddy rice of the present invention KT484 gene relevant with resistance of reverse of structure.The plant expression vector that carries the paddy rice of the present invention KT484 gene relevant with resistance of reverse or its homologous sequence can be through using protoplastis-chemical mediated method (Ca ²⁺, PEG), combination transformed plant cells, tissue or the organ of any or several method in sharp, the particle gun of Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversions, pollen tube importing, microinjection, electricity, conventional biological method such as agriculture bacillus mediated, and plant transformed cell, tissue or organ cultivated into plant; Said tissue and organ can comprise fruit pod, callus, stem apex, blade and the seed etc. of host plant.

In addition, carry out succeeding transfer culture through the transfer-gen plant that conversion is had the paddy rice of the present invention KT484 gene relevant or its homologous sequence with resistance of reverse after, can therefrom further filter out the transfer-gen plant of gene pure.In addition, also can expand this transfer-gen plant numerous, but the resistance of reverse of render transgenic plant is further improved.The expansion of said transgenic plant is numerous to comprise vegetative propagation and/or seminal propagation.

Method of the present invention all is suitable for dicotyledons and monocotyledons; Therefore; Saidly both dicotyledonss such as tobacco, rape, cotton, soybean, willow, eucalyptus, yam or herbage can be derived from, also monocotyledonss such as paddy rice, corn, wheat, barley, jowar, millet or turfgrass can be derived from by plant transformed cell, tissue or organ.

The invention provides a nuclear locating sequence gene KT484 that paddy rice is relevant with resistance of reverse.Experiment showed, gene transformation paddy rice of the present invention can be improved the tolerance of paddy rice to low temperature and arid environment stress.Albumen of the present invention and encoding sox thereof are for the anti-contrary Study on Mechanism of plant; And improve the resistance of reverse of plant and the improvement of correlated character has important theory and practical significance; To in the anti-contrary genetically engineered improvement of plant (particularly cereal crop), play a significant role, have a extensive future.

Below in conjunction with specific embodiment the present invention is explained further details.

Description of drawings

The T-DNA district collection of illustrative plates of Fig. 1 expression vector pCactF.LB and RB are respectively left margin and the right margin of T-DNA; Hyg representes hygromycin resistance; P35S representes the promotor of 35S gene; CaMV35S ter representes the terminator of 35S gene; PAct1 representes the promotor of paddy rice Actin1 gene; 3flag representes 3 times flag sequence label; OCS representes the terminator of ocs gene; HindIII, KpnI, SpeI, XbaI, SalI and PstI represent the restriction enzyme site of restriction enzyme respectively.

The resistance to cold analysis of Fig. 2 KT484 transgenic line.A: seedling growth conditions before the deepfreeze; B: seedling growth conditions after the deepfreeze; C: recovery normal cultured seedling growth conditions after 7 days; D: survival rate statistics after the deepfreeze.

The expression analysis of Fig. 3 KT484 transgenic line." 1 " is the plasmid contrast; " 2 " spend 11 in being; " 3 " are for changeing empty carrier strain system; " 4-7 " is each strain system of KT484 transgenic; KT484 is the amplified production of KT484 gene; Actin is the amplified production of paddy rice internal control gene Actin.

Embodiment

Method therefor is ordinary method if no special instructions among the following embodiment, and concrete steps can be referring to " molecular cloning ".The primer and dna sequence dna are synthetic by Shanghai Ying Jun Bioisystech Co., Ltd; Order-checking is accomplished by the Huada Gene Research Center, Beijing; Nucleic acid restriction endonuclease in the vector construction process and T4 dna ligase etc. are all available from NEB company, and the method that the equal reference reagent box of method provides is carried out.Carrier framework used in the experiment comes from pCAMBIA1300.

1, the separation of KT484 gene

Begin to design 5 ' end primer from the coding initiation site ATG of KT484 gene, design 3 ' end primer in the termination codon place:

Primer 1:5 ' GCACGCtctaga ATGGAGCCATCATCACAACCTCA3 '

Primer 2: 5 ' GCACGCgtcgac TTAATCACTTTGCTGCTCTGCAGG3 '

The tctaga sequence is the restriction enzyme site of restriction enzyme XbaI in the primer 1, and the sequence of underscore sign is the encoding sequence of KT484 gene; The gtcgac sequence is the restriction enzyme site of restriction enzyme SalI in the primer 2, and the sequence of underscore sign is the encoding sequence of KT484 gene.

Extract total RNA of the Japanese fine paddy rice of seedling phase; Obtain cDNA as template through reverse transcription; Total length with above primer amplification KT484 gene; Its size is 753bp, and its nucleotide sequence is shown in SEQ ID NO:2 in the sequence table, and coded protein amino acid sequence is shown in the SEQ ID NO:1 in the sequence table.

Concrete reaction is: get total RNA of about 2 μ g, add 1 μ l, 10 * DNase buffer, the DNase of 1 μ l; Mend DEPC treated water to 10 μ l system, mixing is behind 37 ℃ of incubation 30min; The RQ DNase stop solution that adds 1 μ l, 65 ℃ of incubation 10min with termination reaction after, add 2 μ l Oligo (dT) 18primer (0.1 μ g/ μ l); 4 μ l, 5 * First-strand buffer, 1 μ l Ribonuclease inhibitor (40U/ μ l), 2 μ l, 4 * dNTP (each 10mM); 1 μ l MMLV Reverse Transcriptase (200U/ μ l), careful mixing, 37 ℃ are incubated 1 hour.Handled 5 minutes for 90 ℃ then, cooled on ice, centrifugal collection promptly obtains corresponding reverse transcription product cDNA.With 10 times of the cDNA dilutions that obtains, get the template of 1 μ l, each 1 μ l of upstream and downstream primer (10 μ M), LA Taq enzyme (5U/ μ l) 0.5 μ l, 4 * dNTPs (each 10mM), 1 μ l, 2 * GCbuffer (Mg as the PCR reaction ²⁺) 25 μ l, H ₂O 20.5 μ l.The PCR reaction conditions is 95 ℃ of 5min of preheating, 94 ℃ of 1min of sex change, and the 56 ℃ of 30sec that anneal extend 72 ℃ of 1min50sec, 34 circulations.After reaction finishes, pcr amplification product is carried out 1% agarose gel electrophoresis detect, obtained the dna fragmentation that size conforms to expected results respectively.Reclaim respectively and the above-mentioned fragment of purifying, connect among the carrier pEASY-T1 (full formula King Company), through heat shock method transformed into escherichia coli (E.coli) TOP10 bacterial strain; Selecting positive bacterium colony joins 5ml and contains in the LB liquid nutrient medium of 50mg/L kantlex; Cultivated 12-16 hour in 37 ℃, the shaking table of 200rpm, extract plasmid, obtain containing the segmental recombinant plasmid of purpose respectively; After sequence verification is correct; Downcut purpose fragment KT484 with XbaI and SalI double digestion, be connected into the pCactF plant expression vector that carries out identical double digestion, make up and obtain carrier pCactF-KT484.Picking colony PCR is accredited as the male bacterium colony and carries out sequence verification.The T-DNA district collection of illustrative plates of plant expression vector pCactF is as shown in Figure 1.

2, the acquisition of KT484 transgenic paddy rice

Will be with agrobacterium-mediated transformation by the gene KT484 rice transformation relevant of embodiment 2 acquisitions with resistance of reverse, concrete grammar is following:

Utilize the heat shock method to change above-mentioned recombinant vectors pCactF-KT484 over to Agrobacterium AGL0 bacterial strain (Chinese Academy of Sciences's heredity is given), utilize Agrobacterium that paddy rice is carried out cotransformation.

Partial blade with the paddy rice transfer-gen plant that obtains; Extract total DNA by ordinary method; Under the guiding of forward primer 5 '-ACTCACCGCGACGTCTGT-3 ' and reverse primer 5 '-TTCCTTTGCCCTCGGACG-3 '; The pcr amplification hygromycin phosphotransferase gene obtains the positive transfer-gen plant of 1009bp dna fragmentation through amplification, and detected result shows with aforesaid method and obtained to transform the transgenic paddy rice that pCactF-KT484 is arranged.

3, the resistance to cold analysis of KT484 transgenic paddy rice strain system

The T1 of results KT484 is for transgenic paddy rice seed, and the strain system that chooses more than 6 carries out low temperature stress.Its sprouting of 3 angels is cultivated in the water seed soaking, carries out resistance screening with the 50mg/L Totomycin then, simultaneously to spend 11 to compare in the paddy rice that changes empty carrier; Screen after 5 days, adjoining tree is all dead, statistics transfer-gen plant resistance seedling and dead seedling number; Analyze the resistance of transfer-gen plant and separate ratio, that selects resistance seedling and non-resistant seedling separates than is about 3: 1 strain system, and the result shows the T1 transgenic line that has obtained to have the KT484 that unit point inserts; When treating seedling length to the 8cm left and right sides; Seedling is transferred in the triangular flask every bottle 10 strain, three repetitions from petridish.Be cultured to tri-leaf period (the 3rd leaf unfolded fully), its growth conditions such as Fig. 2 A.Begin 4 ℃ of cold sieves, young leaves, Lao Ye roll up back 1 to 2 day (Fig. 2 B) entirely when contrast, normal cultured again, during nutritive medium in the triangular flask changed once in 2 days, with the fresh state of maintenance nutritive medium.The low temperature The selection result is shown in Fig. 2 C; Change empty carrier contrast strain and be that major part is all turned to be yellow, wilted, death; And transfer-gen plant shows very strong tolerance to low temperature and restorability, recovers survival rate statistics after a week shown in Fig. 2 D, and the survival rate of transgenic line is all compared according to wanting high.

After obtaining the KT484 transgenic paddy rice T2 seed in generation, we have carried out the resistance to cold experiment again, and result and above-mentioned experimental result are consistent.This description of test KT484 gene has the paddy rice of enhancing and tolerates cryogenic ability.

4, the expression analysis of KT484 transgenic paddy rice strain system

The KT484 Gene RT-PCR detects primer:

Primer 3:5 ' GATAAAGTCGAGGGGGGGCC 3 '

Primer 4:5 ' GCACGCgtcgacTTAATCACTTTGCTGCTCTGCAGG 3 '

KT484 Gene RT-PCR amplified fragments is 773bp.

The Actin Gene RT-PCR detects primer:

Primer 5:5 '-TGTTCCTGCCATGTATGT-3 '

Primer 6:5 '-ATGTCCCTCACAATTTCC-3 '

Actin Gene RT-PCR amplified fragments is 252bp.

Above primer is a template with KT484 transgenic paddy rice seedling cDNA respectively, the negative control template be normal growth in spend 11 seedling cDNA, detect the expression of these genes in transgenic paddy rice and change, PCR detection architecture and program are:

10×buffer 2μl

10mM dNTP 0.4μl

10 μ M primers F, 0.4 μ l

10 μ M primer R, 0.4 μ l

Taq polymerase 0.4μl

cDNA 1μl

ddH ₂O 15.4μl

The PCR reaction conditions is: sex change in advance: 95 ℃, and 5 minutes; Sex change: 94 ℃, 30 seconds,, annealing: 55 ℃, 30 seconds, extend: 72 ℃, 2min, 28 circulations; 72 ℃, 10 minutes.

After reaction finishes, the PCR product is carried out 1.5% agarose gel electrophoresis detect, the PCR detected result is seen Fig. 3, and wherein swimming lane " 1 " is the plasmid contrast; " 2 " spend 11 in being; " 3 " are for changeing empty carrier strain system; " 4-7 " is each strain system of KT484 transgenic; KT484 refers to the amplified production of this gene; Actin refers to the amplified production of paddy rice actin gene.Visible by figure, the KT484 gene all has expression in transgenic paddy rice.

Sequence table (SEQUENCE LISTING)

< 110>Beijing Weiming Kaituo Crops Design Center Ltd

< 120>paddy gene KT484 are in the application that improves on the plant stress tolerance ability

<130>JSP100459

<150>CN200910237959.6

<151>2009-11-25

<160>2

<170>PatentIn version 3.3

<210>1

<211>250

<212>PRT

< 213>paddy rice (Oryza sativa L.ssp.japonica)

<400>1

Met Glu Pro Ser Ser Gln Pro Gln Pro Ala Ile Gly Val Val Ala Gly

1 5 10 15

Gly Ser Gln Val Tyr Pro Ala Tyr Arg Pro Ala Ala Thr Val Pro Thr

20 25 30

Ala Pro Ala Val Ile Pro Ala Gly Ser Gln Pro Ala Pro Ser Phe Pro

35 40 45

Ala Asn Pro Asp Gln Leu Ser Ala Gln His Gln Leu Val Tyr Gln Gln

50 55 60

Ala Gln Gln Phe His Gln Gln Leu Gln Gln Gln Gln Gln Arg Gln Leu

65 70 75 80

Gln Gln Phe Trp Ala Glu Arg Leu Val Asp Ile Glu Gln Thr Thr Asp

85 90 95

Phe Lys Asn His Ser Leu Pro Leu Ala Arg Ile Lys Lys Ile Met Lys

100 105 110

Ala Asp Glu Asp Val Arg Met Ile Ser Ala Glu Ala Pro Val Ile Phe

115 120 125

Ala Lys Ala Cys Glu Ile Phe Ile Leu Glu Leu Thr Leu Arg Ser Trp

130 135 140

Met His Thr Glu Glu Asn Lys Arg Arg Thr Leu Gln Lys Asn Asp Ile

145 150 155 160

Ala Ala Ala Ile Thr Arg Thr Asp Met Tyr Asp Phe Leu Val Asp Ile

165 170 175

Val Pro Arg Asp Asp Leu Lys Glu Glu Gly Val Gly Leu Pro Arg Ala

180 185 190

Gly Leu Pro Pro Leu Gly Val Pro Ala Asp Ser Tyr Pro Tyr Gly Tyr

195 200 205

Tyr Val Pro Gln Gln Gln Val Pro Gly Ala Gly Ile Ala Tyr Gly Gly

210 215 220

Gln Gln Gly His Pro Gly Tyr Leu Trp Gln Asp Pro Gln Glu Gln Gln

225 230 235 240

Glu Glu Pro Pro Ala Glu Gln Gln Ser Asp

245 250

<210>2

<211>753

<212>DNA

< 213>paddy rice (Oryza sativa L.ssp.japonica)

<400>2

atggagccat catcacaacc tcagccggca attggtgttg ttgctggtgg atcacaagtg 60

taccctgcat accggcctgc agcaacagtg cctacagctc ctgctgtcat tcctgccggt 120

tcacagccag caccgtcgtt ccctgccaac cctgatcaac tgagtgctca gcaccagctc 180

gtctatcagc aagcccagca atttcaccag cagcttcagc agcagcaaca gcgtcaactc 240

cagcagtttt gggctgaacg tctggtcgat attgaacaaa ctactgactt caagaaccac 300

agcttgccac ttgctaggat aaagaagatc atgaaggcag atgaggacgt tcgcatgatc 360

tccgcagagg ctcctgtgat ctttgcgaaa gcatgtgaga tattcatact ggagctgacc 420

ctgagatcat ggatgcacac ggaggagaac aagcgccgta ccttgcagaa gaatgacata 480

gcagctgcca tcaccaggac ggatatgtac gatttcttgg tagatatagt tcccagggat 540

gacttgaagg aggagggagt tgggctccct agggctggat tgccgccctt gggtgtccct 600

gctgactcat atccgtatgg ctactatgtg ccacagcagc aggtcccagg tgcaggaata 660

gcgtatggtg gtcagcaagg tcatccgggg tatctgtggc aggatcctca ggaacagcag 720

gaagagcctc ctgcagagca gcaaagtgat taa 753

Claims (7)

1. method that strengthens paddy rice low temperature tolerance; It is characterized in that the encoding sox of plant anti-adversity associated protein is inserted expression vector; Acquisition contains the recombinant expression vector of plant anti-adversity associated protein encoding sox; This recombinant expression vector is imported the purpose plant, and screening obtains resistance to cold enhanced plant from the plant that the plant of expressing said plant anti-adversity associated protein or said plant anti-adversity associated protein expression amount increase; Wherein, the aminoacid sequence of said plant anti-adversity associated protein is shown in SEQ ID NO:1.

2. the described method of claim 1, it is characterized in that: the encoding sox of said plant resistance to environment stress GAP-associated protein GAP is the nucleotide sequence shown in the SEQ ID NO:2 in the sequence table.

3. the described method of claim 1 is characterized in that: said resistance relevant protein encoding sox is imported plant tissue, cell or organ, will be cultivated into plant by plant transformed cell, tissue or organ again, obtain the transgenic plant that resistance of reverse improves.

4. the described method of claim 1; The characteristic of wherein said expression vector is: the carrier that sets out that is used to make up said plant expression vector is a kind ofly to can be used for the carrier that agrobacterium tumefaciens or Agrobacterium rhizogenes transform the binary vector of plant or can be used for the plant micropellet bombardment, or the carrier that can in prokaryotic organism, duplicate.

5. the described method of claim 4, the characteristic of wherein said expression vector is: when making up plant expression vector with said resistance relevant protein encoding sox, drive its expression with a kind of composing type, organizing specific type or inducible promoter.

6. the described method of claim 4, the wherein said carrier that sets out is the pCAMBIA serial carrier.

7. the described method of claim 6, the wherein said carrier that sets out is pCAMBIA1300.

Images