CN102174570B - Plant expression vector for controlling artificially synthesized antimicrobial peptide gene by using specific vascular promoter and method for culturing anti-verticillium wilt cotton by using same - Google Patents

Abstract

The invention provides a plant expression vector for controlling an artificially synthesized antimicrobial peptide gene by using a specific vascular promoter and a method for culturing anti-greensickness cotton by using the same. In the method, an artificially synthesized antimicrobial peptide gene spCEMA (Signal Peptide modified Cecropin A-Melittin) under the control of a specific vascular promoter AAP2 is integrated to a cotton genome to realize the specific expression of the gene spCEMA in a cotton vascular tissue, so that the disease resistance of cotton to greensickness is obviously improved. By inoculating different pathogenic bacteria of different greensickness types to genetically modified cotton obtained with the method in a homozygosis plant infected field, a disease index is less than 15, which is reduced by more than 85% in contrast with that of non-genetically modified cotton.

Description

Utilize the plant expression vector of the antibacterial peptide gene of tieing up pipe specific promoter control synthetic and the method for cultivating verticillium wilt-resistant cotton thereof

Technical field

The invention belongs to the plant gene engineering technology field.The transgene cotton preparation method who is specifically related to tie up the antibacterial peptide gene plant expression vector of pipe specific promoter control synthetic and contains above-mentioned expression vector; In addition, the invention still further relates to a kind of genetic engineering technique that utilizes and improve cotton to the method for resistance to verticillium wilt.

Technical background

Cotton is most important natural fiber crop in the world, also is the valuable cargo that China involves the interests of the state and the people, and Cotton Industry all has very important effect to China's textile industry and even the whole national economic development.But cotton verticillium wilt is since 1935 import China into, and the harm that Cotton in China is produced increases the weight of year by year.Verticillium has become the key constraints that current cotton is realized high yield, stable yields.This disease dependent territory passes vascular bundle diseases, be characterized in distributing wide, harm is heavy, host range is wide, the route of transmission is many, the pathogenic bacteria survival time is of a specified duration, is one of destructive disease of tool in the Cotton Production.The more important thing is that the Upland Cotton of China master cultivation lacks the germ plasm resource of high resisting verticillium, never find the measure that can effect a radical cure in the production, therefore, verticillium is called as " cancer " of Cotton Production.Production practice prove, the selection and popularization disease-resistant variety is that to prevent and treat verticillium most economical effectively, and is unique effective approach (Gu Benkang etc., 1996).

Go through the effort of decades, utilize the conventional breeding means, China has obtained partly verticillium to be had the local variety of certain resistance against diseases, but because the verticillium wilt pathogen variation is fast, microspecies are many, have obvious Virulence, resistance of wide spectrum cotton variety for this specific character of verticillium wilt pathogen does not have substantially, therefore be disease-resistant cotton seed at a regional representation, under different physiology and geographical conditions, the phenomenon of disease resistance forfeiture just occur.On the other hand, the anti-source of high resisting verticillium lacks in the upland cotton cultivar, has directly caused Cotton in China resisting verticillium breeding process slow, and particularly the breeding of anti-defoliation verticillium does not have progress substantially.For this reason, the problem of resisting verticillium resource shortage and to seek new disease resistant and breeding method extremely urgent in solve producing is badly in need of obtaining to have the anti-source of wide spectrum and durable resistance to alleviate the massive losses that verticillium causes in the Cotton Production.

Along with molecular biological development, utilize genetically engineered to separate, clone and the conversion resistant gene, not only can improve the disease resistance of plant in directional property ground, and the genotype source is abundant, not limited by anti-source sibship, breeding cycle is short, and nonexistence shape negative correlation is chain in theory, and a time cloning also can be used for repeatedly transforming.Therefore, adopt the multiple breeding methods such as biotechnology, accelerating the resisting verticillium breeding process becomes inevitable.

Antibacterial protein or antibacterial peptide (AMP, antimicrobial protein or peptide) be that a class is by biogenic albumen or polypeptide with anti-microbial activity, be distributed widely in animal, plant and the microorganism, have the characteristics such as has a broad antifungal spectrum, anti-microbial activity height and resistance are lasting.In addition, the antibacterial mechanisms of antibacterial peptide is special, causes the mode that entocyte leaks to destroy pathogenic bacteria mainly with form the duct at film, causes pathogenic bacteria to be difficult to produce resistance (Yeaman etc., 2003).Therefore, the disease resistance of utilizing antibacterial protein or antibacterial peptide to improve plant is subject to extensive concern.In the plant disease-resistant molecular breeding strategy, being used to from the antibacterial protein of plant or the disease resistance of antibacterial peptide raising plant is one of the most frequently used method, because the antibacterial peptide of plant origin changes identification and the integration that is easier to recipient plant in the plant over to.Pathogenic bacteria easily produced resistance or has the cause of disease specificity after but the antibacterial peptide of plant origin changed plant over to, therefore, obtain verticillium wilt pathogen to different physiological strains and have relatively difficulty of wide spectrum and durable resistance.And the antibacterial protein in the non-plant source of synthetic or antibacterial peptide can overcome this deficiency of antimicrobial peptide of plant origins, but this class antibacterial protein or antibacterial peptide may have a strong impact on growing of plant.Such as, Guo Yulong etc. (2003) utilize particle gun with antibacterial peptide gene CEMAChange cotton over to, the transgene cotton blade is yellowish green alternate striated, and the electron-microscope scanning result shows that the CEMA antibacterial peptide has a strong impact on the chloroplast lamellae structure.

In the plant genetic engineering, controlling gene is expressed the selection aspect of promotor, usually at first selects the CaMV35S promotor of constitutive expression, realizes that the foreign gene overexpression is with the function of research gene.But specific to the disease-resistant gene engineering, usually according to the characteristics of different diseases, the needed target antibacterial protein of organizing specific or abduction delivering or antibacterial peptide are with the invasion of opposing pathogenic bacteria or the growth of inhibition pathogenic bacteria.As, Rajesh Narhari Patkar(2006) etc., inducible promoter PAL regulation and control utilized Ns-LTP-likeGene is expressed in paddy rice, Effective Raise the resistance of transgenic paddy rice to multiple diseases such as rice blast.Verticillium dahliae mainly begins to infect from the root of plant, then along with the vascular tissue at plant root, stem and each position of blade is expanded gradually to plant top, in the suitable situation of condition, can be developed to the plant top, cause whole plant morbidity even dead, cause Severe Reduction and reduce fibrous quality.

Summary of the invention

An object of the present invention is to provide a kind of disease resistance that can improve plant, do not affect again the antibacterial peptide gene of the utilization dimension pipe pipe specific promoter AAP2 control synthetic of growth and development of plants SpCEMAPlant expression vector.

The present invention utilizes gene engineering method, with the AAP2 promotor and SpCEMAAntibacterial peptide gene is built in the suitable expression vector simultaneously, has namely obtained the plant expression vector of AAP2 promoter to control antimicrobial peptide gene of the present invention.The plant expression vector that obtains has the constitutional features shown in Fig. 3 P5-AAP2-spCEMA.This carrier is changed in the plant, can obtain dimension pipe specifically expressing SpCEMAThe transgenic plant of gene.

Another object of the present invention provides and contains simultaneously dimension pipe specific promoter AAP2 and antibiotic protein gene SpCEMATransformant.Utilize gene engineering method that above-mentioned plant expression vector is transformed suitable host and can obtain transformant of the present invention.

Another purpose of the present invention provides a kind of method of cultivating the resisting verticillium transgene cotton.The method of cultivation resisting verticillium transgene cotton provided by the present invention is to utilize agrobacterium tumefaciens-mediated transformation will tie up pipe specific promoter AAP2 control SpCEMAThe recombinant plant expression vector P5-AAP2-spCEMA of gene imports in the cotton cells, and through tissue culture, transgenic plant Molecular, and the disease-resistant evaluation of indoor and outdoor and screening obtain transgene cotton that resistance to verticillium wilt is improved.

The purpose of the method for cultivation verticillium wilt-resistant cotton provided by the invention realizes like this: a kind of plant expression vector that utilizes dimension pipe specific promoter control antibiotic protein gene is characterized in that, for containing dimension pipe specific promoter AAP2 control antibiotic protein gene SpCEMAPlant expression vector, from Arabidopis thaliana, extract the laggard performing PCR amplification of total DNA, amplified production is connected with the pUC-T carrier again, then transform the bacillus coli DH 5 alpha competent cell, screening positive clone obtains the promotor of Arabidopis thaliana AAP2 gene, and the long 2136bp of this promotor is with the constitutive promoter CaMV35S on its replacement plant expression vector p5-spCEMA, make up a new expression of plants body, called after p5-AAP2-spCEMA.

Further, described plant expression vector utilizes electric shocking method to transform agrobacterium tumefaciens, the recombinant bacterium that contains p5-AAP2-spCEMA of acquisition.

Further, described plant expression vector utilizes agrobacterium tumefaciens-mediated transformation to carry out genetic transformation, the transgenic cell line that contains the described plant expression vector of p5-AAP2-spCEMA of acquisition.

Further, the application of described plant expression vector in preparation transgenosis verticillium wilt-resistant cotton.

Further, contain the transgene cotton preparation method of the described plant expression vector of p5-AAP2-spCEMA, comprise the following steps:

Step 1: will tie up pipe specific promoter AAP2 sequence, antibacterial peptide gene SpCEMASequence is operationally inserted respectively in the expression vector, makes up plant expression vector;

Step 2: change the described plant expression vector of step 1 over to the host agrobacterium tumefaciens, obtain transformant;

Step 3: by transformant plant expression vector is integrated in the cotton, obtains transgene cotton;

Step 4: transgene cotton obtains the homozygous transgene cotton of disease-resistant proterties genetic stability through indoor disease-resistant evaluation and proterties separation screening;

Step 5: the homozygous transgene cotton of disease resistance inheritance stability is the transgene cotton new resources of disease-resistant evaluation and screening acquisition resisting verticillium through the field again.

Further, a kind of method of cultivating verticillium wilt-resistant cotton is characterized in that, changes respectively above-mentioned p5-AAP2-spCEMA plant expression vector over to the cotton gene group, realize antibiotic protein gene specifically expressing in the transgene cotton vascular tissue, improve cotton to the resistance against diseases of verticillium.

The transgenic cotton floral material of cultivating less than 15, can reduce more than 85% to the disease index of defoliation and non-defoliation verticillium than the non-transgenic contrast.

Beneficial effect of the present invention is, utilizes genetic engineering technique at first to make up dimension pipe specific promoter AAP2 control antibacterial peptide gene SpCEMAPlant expression vector, then plant expression vector is changed over to the cotton gene group.Regeneration plant after the checking of strict molecular biology, the T of 4-6 sheet true leaf ₀, T ₁And T ₂For the defoliation verticillium wilt pathogen of seedling respectively at the indoor inoculation high density of artificial climate, obtain resistance through Resistance Identification and screening and improve strain ASP-21, and screen the Transgenic wheat line that acquisition no longer separates.Homozygous lines in Field inoculation defoliation and non-defoliation verticillium wilt pathogen, is further identified the resistance stability of transgene cotton again.

T isozygotys ₃Show that for the disease-resistant qualification result in field seedling stage, transgenic line was compared with the wild-type contrast, the disease index of inoculation defoliation and non-defoliation verticillium wilt pathogen can reduce more than 85%.The disease index of plant strain growth later stage stem interior tissue shows that the disease index of each position stem interior tissue also can reduce more than 80% compared with the control.The browning phenomenon of transgenic line plants stems interior tissue mainly concentrates on the middle part vascular tissue of bottom stem section, and xylem does not partly have macroscopic illness on every side, and all serious brownization in inner each position of wild-type adjoining tree stem.Illustrate that but spCEMA expresses the establishment verticillium dahliae and grows in plant inside in vascular tissue, and then improve cotton to the resistance of verticillium.Plant strain growth is observed and the result of fibrous quality detection shows, SpCEMAGene specifically expressing in the transgene cotton vascular tissue neither affects growing of plant and fertility, does not also affect cotton fiber quality simultaneously.Therefore, the transgene cotton that the method for utilizing the present invention to cultivate verticillium wilt-resistant cotton obtains not only can improve the resistance against diseases to verticillium, and the material that obtains can be applied to Cotton Production.

The present invention is used to from the dimension pipe specific promoter AAP2 of Arabidopis thaliana control antibacterial peptide gene SpCEMA, reach the purpose of antibacterial peptide gene specifically expressing in the transgenic cotton plant vascular tissue, effectively control verticillium dahliae further infecting and expanding in plant, reached the purpose of resisting verticillium.

The inventive method is simple and easy to do, and effect is remarkable, and the verticillium wilt-resistant cotton material of acquisition can provide new resource for the verticillium wilt resistance of cotton by same breeding, serves Cotton Production, and produces huge economic benefit.The inventive method is not only applicable to cultivate the cotton of resisting verticillium, equally is applicable to the cultivation that other has the disease-resistant material of vascular tissue Characteristics of Damage yet.

Description of drawings:

Fig. 1 is p5-AAP2-spCEMA expression vector establishment schema.

Fig. 2 is that p5 double base plant expression vector is transformed collection of illustrative plates.

Fig. 3 is transgene cotton petiole and leaf tissue GUS chemical staining result;

A and C: transgenic cotton plant blade and petiole; B and D: wild-type cotton plants blade and petiole.

Fig. 4 is SpCEMATransgene cotton PCR detected result;

M:Marker2000; 1: the contrast of wild-type plant; 2: the water contrast; 3: the plasmid positive control; 4-13:AAP2:: SpCEMATransfer-gen plant.Black arrow is shown the specific band of 150bp.

Fig. 5 is in the transgene cotton SpCEMAThe RT-PCR detected result of gene transcript expression;

1: the negative non-transgenic plant (null) of the GUS that separates in the non-homozygous lines of transgenosis; 2-7: AAP2:: SpCEMAThe transgene cotton strain; SpCEMA: take the negative plant cDNA of transgenosis and GUS as template amplification SpCEMAThe result of gene; HIS: take the negative plant cDNA of transgenosis and GUS as template amplification HIS3The result of gene; RNA as template: take RNA as template amplification HIS3The result of gene. SpCEMA30 circulations of gene amplification, HIS320 circulations of gene amplification.

Fig. 6 is phytotron inoculation defoliation verticillium wilt pathogen 15d, AAP2:: SpCEMATransgene cotton T ₀, T ₁And T ₂Disease index for strain;

Null: the non-transgenic cotton plants that separates in the transgene cotton strain of not isozygotying; ASP-21:AAP2:: SpCEMAThe transgene cotton strain.

Fig. 7 is phytotron inoculation defoliation verticillium wilt pathogen 15d, AAP2:: SpCEMAThe transgenic cotton plant phenotype;

Null: the non-transgenic cotton plants that separates in the transgene cotton strain of not isozygotying; SpCEMA:AAP2:: SpCEMATransgenic cotton plant.

Fig. 8 is Field inoculation defoliation verticillium wilt pathogen 30d, AAP2:: SpCEMAThe sickness rate of transgene cotton strain and disease index;

Null: the non-transgenic cotton plants that separates in the transgene cotton strain of not isozygotying; ASP-21:AAP2:: SpCEMAThe transgene cotton strain.

Fig. 9 is Field inoculation defoliation verticillium wilt pathogen 30d, AAP2:: SpCEMAThe transgenic cotton plant phenotype.

Figure 10 is the disease index of the plant strain growth later stage stem interior tissue of Field inoculation defoliation verticillium wilt pathogen;

Null: the non-transgenic cotton plants that separates in the transgene cotton strain of not isozygotying; ASP-21:AAP2:: SpCEMAThe transgene cotton strain.

Figure 11 is the phenotype of the plant strain growth later stage stem interior tissue of Field inoculation defoliation verticillium wilt pathogen.

Figure 12 is the non-defoliation verticillium wilt pathogen of Field inoculation 30d, AAP2:: SpCEMAThe sickness rate of transgene cotton and disease index;

Null: the non-transgenic cotton plants that separates in the transgene cotton strain of not isozygotying; ASP-21:AAP2:: SpCEMAThe transgene cotton strain.

Figure 13 is the non-defoliation verticillium wilt pathogen of Field inoculation 30d, AAP2:: SpCEMAThe phenotype of transgene cotton.

Figure 14 is the disease index of the plant strain growth later stage stem interior tissue of the non-defoliation verticillium wilt pathogen of Field inoculation;

Null: the non-transgenic cotton plants that separates in the transgene cotton strain of not isozygotying; ASP-21:AAP2:: SpCEMAThe transgene cotton strain.

Figure 15 is the phenotype of the plant strain growth later stage stem interior tissue of the non-defoliation verticillium wilt pathogen of Field inoculation.

Embodiment:

The present invention is described in further detail below in conjunction with accompanying drawing, but following explanation do not limit the present invention, any to distortion of the present invention and change, only otherwise break away from spirit of the present invention, all should belong to the defined scope of claims of the present invention.

Medicine and reagent in the invention process example is not specifically described is domestic conventional chemical reagent, the equal reference that the material method is not specifically described " molecular cloning experiment guide " (Sambrook and Russell, 2001).

1, the extraction of DNA

1.1 DNA extraction damping fluid:

(1) DNA of plants Extraction buffer:

CTAB extracting solution: 100 mmol/L Tris-HCl (pH8.0), 20 mmol/L EDTA (pH8.0), 1.5 mol/L NaCl, 2% CTAB (w/v), 4% PVP40 (w/v) and 2% mercaptoethanol (v/v) add before PVP and mercaptoethanol use.

TE solution: 10mmol/L Tris-HCl pH8.0,1 mmol/L EDTA.

(2) alkaline lysis plasmid extraction damping fluid:

STE solution: 0.1 mol/L NaCl, 10 mmol/L Tris-HCl (pH 8.0), 1 mmol/L EDTA (pH 8.0).

Solution I: 50 mmol/L glucose, 25 mmol/L Tris-HCl (pH 8.0), 10 mmol/L EDTA (pH8.0).

Solution II: 0.2 mol/L NaOH, 1%(w/v) SDS.

Solution III: 50 mL, 5 mol/L potassium acetates, 11.5 mL Glacial acetic acid, 28.5 mL water.

1.2 the extraction of plasmid DNA:

The extraction of agrobacterium tumefaciens plasmid DNA is by a holy method (1993) slightly modified of Lu.

Get agrobacterium tumefaciens bacterium liquid 1 mL, centrifugal 1 min of 10,000 r/min collects thalline; Behind the resuspended thalline of 200 mL STE, centrifugal (10000 r/min, 1 min) collects thalline; Add 180 mL solution I and the resuspended thalline of 20 mL N,O-Diacetylmuramidases, 37 ° of C temperature are bathed 30 min, add 400 mL solution II, turn upside down repeatedly, and ice bath is no more than 3 min; Add again the solution III of 300 mL ice precooling, turn upside down repeatedly ice bath 3 min.12,000 r/min, 4 ° of centrifugal 10 min of C change supernatant liquor in another centrifuge tube over to; Isopyknic phenol: chloroform: primary isoamyl alcohol (25:24:1) and isopyknic chloroform: successively each extracting of primary isoamyl alcohol (24:1) once; Supernatant liquor is changed over to another centrifuge tube again, add the dehydrated alcohol of 2 times of volumes, room temperature leaves standstill 2 min behind the mixing; 12 000 r/min, 4 ° of centrifugal 10 min collecting precipitation DNA of C, then with 75% washing with alcohol precipitation once; Drying at room temperature, 50 mL TE dissolution precipitations namely obtain plasmid DNA.

1.3 the extracting method of plant genome DNA:

Adopt improved method of CTAB (Doyle, 1987; Xiao Yuehua etc. 2002a) extract plant tissue DNA, and method is:

Plant young tender leaf or stem etc. are organized 0.5-1g, and rapid grinding powder in liquid nitrogen adds the CTAB extracting solution of 65 ℃ of preheatings of 3 mL, the quick oscillation mixing, and 65 ℃ of water-bath 30 min add 1 mL, 5 mol/L KAc ice baths, 20 min.Use isopyknic chloroform: primary isoamyl alcohol (24:1) extracting 1 time, 10,000rpm, 4 ℃ of centrifugal 5min, supernatant liquor adds the Virahol of 2/3 times of volume-20 ℃ precooling, mixing,-20 ℃ leave standstill 30 min, choose flocks with glass rod, and rinsing is for several times repeatedly with 75% ethanol, use again the dehydrated alcohol rinsing once, be resuspended in 500 μ L TE solution after air-dry.The RNaseA 2 μ L that add 10mg/mL, process 1h for 37 ℃, then use phenol (pH8.0): chloroform: primary isoamyl alcohol (25:24:1) and chloroform: each extracting of primary isoamyl alcohol (24:1) once, 10,000rpm, 4 ℃ of centrifugal 5min, the dehydrated alcohol that supernatant liquor adds 2 times of volumes precipitates the centrifugal supernatant liquor of abandoning.Precipitate the ethanol rinsing with 75%, air-dry, be dissolved in 200 μ l TE ,-20 ℃ save backup.

2, the extraction of cotton RNA:

2.1 RNA Extraction buffer:

CTAB Extraction buffer: 2%CTAB(w/v), 2% polyvinylpyrrolidone PVP40(w/v), 100mmol/L Tris-HCl(pH8.0, the water preparation that DEPC processes), 25mmol/L EDTA, 0.5g/L spermidine Spermidine, 2.0mol/L NaCl, 2% mercaptoethanol (v/v adds before using).

SSTE lysate: 1mol/L NaCl, 0.5%SDS(w/v), 10mmol/L Tris-HCl(pH8.0), 1.0mmol/L EDTA.

2.2 RNA extracting method:

Extract total RNA of cotton tissue with the CTAB method.Get about 3g cotton tissue fresh material, rapid grinding powder in liquid nitrogen, pack into the 50ml centrifuge tube of DEPC water treatment, then the RNA extracting solution that adds 65 ℃ of preheatings of 15ml, put upside down 65 ℃ of water-bath 3min behind the mixing, 8,000 rpm, 4 ° of centrifugal 10 min of C, change supernatant liquor the 50ml centrifuge tube of a new DEPC water treatment over to, use isopyknic chloroform: twice of primary isoamyl alcohol (24:1) extracting.10,000rpmm gets supernatant liquor behind the centrifugal 5min of room temperature, adds 1/4 volume, 10 mol/L LiCl solution, place more than the 6h for 4 ℃, and 10,000rpm, 4 ° of centrifugal 10 min of C abandon supernatant liquor, and precipitation is dissolved with 500 μ L SSTE.Use isopyknic phenol (pH4.5): chloroform: primary isoamyl alcohol (25:24:1) and chloroform: each extracting of primary isoamyl alcohol (24:1) once again, 10,000rpm, the centrifugal 5min of room temperature, supernatant liquor adds the dehydrated alcohol of 2 times of volume-70 ° C precoolings, more than-70 ° of C precipitation 30min.12,000rpm, 4 ° of centrifugal 10 min of C abandon supernatant liquor, and precipitation is processed water dissolution with the DEPC of 200 μ L, and after native gel electrophoresis and ultraviolet spectrophotometer scanning detected the RNA quality ,-80 ° of C saved backup.

3, the clone of dimension pipe specific promoter AAP2:

3.1 the PCR of vascular-specific expression promotor AAP2 clone:

According to the characteristics of Arabidopis thaliana Amino acid permease gene2 (AAP2) gene, take arabidopsis thaliana genomic dna as template, sequence 1 and sequence 2 are primer amplification AAP2The promoter sequence of gene, the reaction system that makes up 25 μ L is: 10 * Ex PCR buffer is (without Mg ²⁺) 2.5 μ L; 2.5mmol/L dNTPs 2 μ L; 25mmol/L MgCl ₂(magnesium chloride) 2 μ L; Primer 1 (5 μ mol/L) 2 μ L; Primer 2 (5 μ mol/L) 2 μ L; Ex Taq archaeal dna polymerase 1U; The about 60ng of genomic dna.

PCR reaction conditions: 94 ℃ of 5min; 94 ℃ of 1min; 50 ℃ of 1min; 72 ℃ of 2min 30sec (every circulation primary temperature reduces by 1 ℃); 94 ℃ of 1min; 40 ℃ of 1min; 72 ℃ of 2min 30sec (25 circulations); 72 ℃ of 10min.

3.2 the recovery of amplified production:

PCR product electrophoresis on sepharose is quantitative, reclaims test kit (Roche) with dna fragmentation and reclaims amplified fragments, and all operations is all undertaken by the test kit specification sheets.

3.3 connect and conversion:

The AAP2 recovery fragment that pcr amplification obtains is cloned into pUC-T (TaKaRa) carrier by ligase enzyme test kit specification sheets.Then will connect product and transform the bacillus coli DH 5 alpha competent cell, screening positive clone is according to a conventional method identified the fragment of plasmid and insertion.

3.4 sequential analysis:

The AAP2 promoter fragment that obtains is carried out sequencing, and the result shows, PCR gained fragment total length 2148bp, and the long 2136bp of AAP2 promoter fragment, sequencing result is seen sequence 7.

4, SpCEMAThe structure of plant expression vector:

4.1 AAP2:: SpCEMAThe structure of plant expression vector:

In order to make up AAP2:: SpCEMA Plant expression vector utilizes respectively double digestion pBI121-of EcoR I and Hind III SpCEMAWith p5 expression vector plasmid, 35S is controlled SpCEMAThe Expression element of gene is cloned into respectively the p5 plant expression vector, obtains p5-35S-spCEMA, is abbreviated as p5-spCEMA.And then the 35S promoter of target gene Expression element is replaced into the AAP2 promotor, namely obtain AAP2:: SpCEMAPlant expression vector, and called after p5-AAP2- SpCEMAMake up schema and see Fig. 1.All restriction enzymes are finished according to the working instructions operation all available from Roche company.

The P5 plant expression vector is to reelect pBI121 carrier commonly used to get, and the schema of transformation is seen Fig. 2.

4.2 plant expression carrier plasmid changes agrobacterium tumefaciens lba4404 over to:

With reference to Bio-RAD MicroPulser instruction manual book, with the vascular tissue specifically expressing that makes up SpCEMAThe plant expression vector P5-AAP2-of gene SpCEMAImport agrobacterium tumefaciens lba4404 by the electric shock conversion method.Extract the Agrobacterium plasmid, and utilize BamH I and Pst I to carry out the double digestion checking, obtain the Agrobacterium LBA4404 transformant.

5, the genetic transformation of cotton:

5.1 Agrobacterium tumefaciens mediated Cotton Transformation is commonly used substratum:

Minimum medium: MSB(MS inorganic salt+B5 is organic) (T. Murashige, 1962; O.L. Gamborg, 1968);

Seed germination substratum: 1/2 MSB+20g/L sucrose+6g/L agar, tap water preparation, natural pH;

Be total to culture medium: MSB+0.5mg/L IAA(indolylacetic acid)+0.1mg/L KT(6-chaff aminopurine)+30g/L glucose+100 μ mol/L Syringylethanones+2.0g/L Gelrite (Sigma), pH5.4;

Bacterium culture medium is taken off in screening: MSB+0.5mg/L IAA+0.1mg/L KT+75mg/L Km(kantlex)+500mg/L cef (cephamycin)+30g/L glucose+2.0g/L Gelrite, pH5.8;

Calli induction media: MSB+0.5mg/L IAA+0.1mg/L KT+75mg/L Km+200mg/L cef+30g/L glucose+2.0g/L Gelrite, pH5.8;

Embryo callus subculture inducing culture: MSB+0.1mg/L KT+30g/L glucose+2.0g/L Gelrite, pH5.8;

Fluid suspension culture base: MSB+1.91g/L saltpetre+0.1mg/L KT+30g/L glucose, pH5.8;

Body embryo maturation medium: MSB+15g/L sucrose+15g/L glucose+0.1mg/L KT+2.5g/L Gelrite, pH6.0;

Seedling substratum: SH+0.4g/L activated carbon+20g/L sucrose, pH6.0.（Schenk?&?Hildebrandt，1972）

5.2 Cotton Transformation concrete operation method:

(1) transform the acquisition of explant and the preparation of During Agrobacterium liquid:

The upland cotton seed shells, and seed benevolence 0.1% mercuric chloride sterilization 10min after aseptic water rinsing 5-6 time, is inoculated in the seed germination substratum, 28 ℃ of dark cultivation 5-7d.Aseptic hypocotyl is cut into the long segment of 3-5mm, as transforming explant.

(2) transform the preparation of using During Agrobacterium liquid:

Utilize method of scoring to obtain to integrate the single bacterium colony of Agrobacterium of plant expression vector p5-AAP2-spCEMA, then picking list colony inoculation enters to add 50mg/L Km and 125mg/L Sm(Streptomycin sulphate) 10mL liquid YEB substratum (5g/L sucrose, 1g/L bacterium yeast extract, 10g/L bacterium tryptone, 0.5g/L MgSO ₄7H ₂O, pH7.0), then 28 ℃, 200rpm overnight incubation are inoculated bacterium liquid into 20mL in 5% ratio and are not contained antibiotic liquid YEB, and 28 ℃, 200rpm are cultured to OD600 and are about 0.5.Get the centrifugal 5min of 5mL bacterium liquid 6000rpm and collect thalline, do not add the resuspended thalline of Gelrite co-culture media body substratum with 5mL again, resuspended bacterium liquid is the During Agrobacterium liquid of contaminating explant.

(3) inducing of hypocotylar genetic transformation and embryo callus subculture:

Explant is contaminated 20min with During Agrobacterium liquid, bacterium liquid inclines, suck the unnecessary bacterium liquid in explant surface with aseptic filter paper again, hypocotyl segment after the dip-dye is inoculated in common culture medium, 26 ℃ of dark 2d that cultivate, hypocotyl is seeded to screening takes off bacterium culture medium, the calli induction media of the additional kantlex (Km) of the follow-up substitution of 20d and cephamycin (cef) carries out inducing of callus, interval 20d subculture once, the follow-up substitution embryo callus subculture of 60d inducing culture, obtain to carry out fluid suspension culture behind the embryo callus subculture, to obtain the consistent embryo callus subculture of raised growth.

(4) inducing with seedling of body embryo cultivated:

The embryo callus subculture of fluid suspension culture, 30 order stainless steel sift net filtrations, the embryo callus subculture Uniform Dispersion ground inoculation under the sieve enters body embryo maturation medium, and about 15d produces a large amount of body embryos, and its subculture is entered the SH substratum, promotes the further seedling of body embryo.The regrowth of 3-4 leaf is transplanted into the greenhouse and breeds.

6, AAP2:: SpCEMAThe acquisition of transgene cotton and Molecular

Cotton Transformation according to above-mentioned 5 and renovation process, with AAP2:: SpCEMAChange the cotton gene group over to.Go through inducing of Km kanamycin-resistant callus tissue, embryo callus subculture and body embryo, then body embryo seedling obtains AAP2:: SpCEMATransgenic cotton plant.

6.1 the GUS histochemical stain of transfer-gen plant:

The GUS staining fluid:500mg/L X-Gluc, 0.1mol/L K ₃Fe (CN) ₆, 0.1mol/L K ₄Fe (CN) ₆, 1% Triton X-100(v/v), 0.01mol/L Na ₂EDTA, 0.1mol/L phosphoric acid buffer (pH7.0).

AAP2:: SpCEMAPlant expression vector all contains 35S promoter control GUSGene, therefore, transfer-gen plant at first can utilize GUS histochemical staining method to carry out Rapid identification.With reference to Jefferson(1987) the petiole of method clip Km resistance seedling and leaf tissue a little, add respectively in the GUS histochemical stain liquid, 37 ℃ of dyeing 2h, 95% ethanol decolorization then removes to green.Blueness shown in Figure 3 occurring at last is the transgenic positive plant, otherwise is the non-transgenic plant.

6.2 AAP2:: SpCEMAThe transgene cotton pcr analysis:

Take the Young Cotton leaflet tablet as material, extract total DNA of transfer-gen plant and wild-type plant, then take total DNA as template, sequence 3 and 4 is primer amplification SpCEMAGene fragment.

PCR reacts the total system of 25 μ l, comprises 1 * PCR buffer, the MgCl of 1.5mmol/L ₂, the dNTPs of 0.2mmol/L, upstream and downstream primer are 0.2 μ mol/L, 25ng DNA, 1U Taq archaeal dna polymerase.

PCR reaction parameter: 94 ℃ of pre-amplification 5min, then 94 ℃, 30s; 55 ℃, 30s; 72 ℃, 60s; 30 circulations, at last again 72 ℃ extend 10min.Amplified production 1.0% agarose gel electrophoresis detects.The part amplification is seen Fig. 4.The result shows, the acquisition of can both increasing of all transfer-gen plants through the GUS test positive SpCEMAThe special band of target.

6.3 SpCEMART-PCR analyze:

AAP2:: SpCEMATransgenic cotton plant extracts the RNA of transgenosis and non-transgenic plant (null) respectively take tender stem segments as material, presses the chain cDNA of synthetic each the sample RNA of cDNA one chain synthetic agent box specification sheets, then take cDNA as template amplification SpCEMAThe specific fragment of gene. SpCEMAThe upstream and downstream primer of gene is respectively sequence 3 and sequence 4.With the cotton histone HIS3Gene is interior mark. HIS3Primer be sequence 5 and sequence 6(Zhu YQ etc., 2003).

25 μ l PCR reaction systems comprise: 1 * PCR buffer, the MgCl of 1.5mmol/L ₂, the dNTPs of 0.2mmol/L, upstream and downstream primer are 0.2 μ mol/L, 25ng DNA, 1U Taq archaeal dna polymerase.

RT-PCR result shows (Fig. 5), in the transgenic cotton plant SpCEMAGene can both effectively carry out transcriptional expression, and does not all detect in the wild-type plant SpCEMAThe expression of gene.

7, transgene cotton is to the disease-resistant authentication method of verticillium:

7.1 the disease-resistant evaluation inoculation preparation of pathogenic bacteria

Defoliation and non-defoliation verticillium wilt pathogen that a little solid PD substratum (potato culture) of picking is preserved are inoculated the substratum into liquid PD, 180rpm, 26 ℃ of shaking culture 7d, again in 10%(bacterium liquid/PD substratum) ratio inoculate the substratum into liquid PD, 180rpm, 26 ℃ of shaking culture 10d filter mycelia and the impurity that goes in the bacteria-removing liquid with four layers of sterile gauze, and deionized water is adjusted defoliation verticillium wilt pathogen spore concentration and reached 10 ⁸Individual/ml, non-defoliation verticillium wilt pathogen spore concentration reaches 10 ⁹Individual/ml is as inoculation bacterium liquid.

7.2 the indoor disease-resistant authentication method of artificial climate:

T ₀For transgene cotton 4-6 sheet true leaf, all the other are 3-4 sheet true leaf from generation to generation, and growth phase adopts consistent seedling plant hinders root filling bacterium liquid method inoculation pathogenic bacteria.Transplant the engagement alms bowl and slowly water bacterium liquid 100mL, allow the moistening soil group that cotton plants is arranged of bacterium liquid as far as possible, inoculation is watered permeable two days later, to keep the humidity of soil in the basin alms bowl.In 20 ℃ of (night)-25 ℃ (daytime), humidity is grown under the dark photoperiod condition of cultivating of 14h illumination/10h more than 80% after the inoculation, and (0 grade: the cotton plants appearance is without illness by 5 grades of sick grade standards for inoculation 15d; 1 grade: the cotton plant blade is aobvious illness below 1/3; 2 grades: cotton plant blade 1/3-2/3 shows illness; 3 grades: the cotton plant blade is aobvious illness more than 2/3; 4 grades: illness all appears in the cotton plant blade, blade and flower abscission serious or plant polished rod even death) the sick level of statistics plant, and sickness rate and the disease index of calculating plant.T ₀Each inoculation of generation is all take wild-type and unloaded carrier transgene cotton seedling as contrast.All the other each from generation to generation take wild-type and not the GUS feminine gender non-transgenic plant that separates of homozygous lines as contrast.Defoliation verticillium wilt pathogen inoculum density is 10 ⁸Individual spore/ml, non-defoliation verticillium wilt pathogen inoculum density is 10 ⁹Individual spore/ml.

7.3 the disease-resistant authentication method in sick garden, field:

The planting seed of homozygous lines results is in the seedbed, and when 3-4 sheet true leaf seedling replanting entered sick garden, field, employing was hindered root filling bacterium liquid method and inoculated respectively defoliation and non-defoliation verticillium wilt pathogen.By the plantation of the density of 2000 strain/mus, every strain pouring verticillium wilt pathogen liquid 200ml during transplanting allows the bacterium liquid nutrition group that drench as far as possible, then holds up moistening soil around seedling, and transplanting is watered permeable two days later, with assurance seedling normal growth.Sickness rate and the disease index of statistics plant behind the inoculation 30d.The plant strain growth later stage is divided into upper, middle and lower three parts with cane, and (0 grade: stem inside is without variable color by 5 grades of sick grade standards to cut open bar; 1 grade: the dimmed brown of cane partly accounts for below 25% of section; 2 grades: variable color partly accounts for 50%; 3 grades: variable color partly accounts for more than 70%; 4 grades: the whole dimmed brown of cane xylem) the sick level of statistics cane different sites interior tissue, and calculate disease index.Be located away from the negative plant of GUS of Transgenic wheat line not and wild-type plant as contrast take inoculation, and arrange and do not inoculate the contrast of wild-type plant.Inoculation test is tested triplicate by at random district's group arrangement, and each repeats 60 strain seedling.Defoliation verticillium wilt pathogen inoculum density is 10 ⁸Individual spore/ml, non-defoliation verticillium wilt pathogen inoculum density is 10 ⁹Individual spore/ml.

8, the indoor AAP2: of artificial climate: SpCEMAThe transgene cotton seedling is to the resistance of verticillium:

Obtain resistance to verticillium wilt to be improved significant transgene cotton strain, AAP2: in order to screen: SpCEMATransgene cotton is the homozygous lines plant not, carries out disease-resistant evaluation and screening respectively at phytotron inoculation defoliation verticillium wilt pathogen.

Artificial climate is indoor, AAP2:: SpCEMADifferent transgenic line plant inoculation defoliation verticillium wilt pathogen 15d, T ₀, T ₁And T ₂The disease index of the non-transgenic cotton plants that generation does not separate in the homozygous lines all reaches 100, and AAP2:: SpCEMAStrain ASP-21 T ₀, T ₁And T ₂Disease index for strain is respectively 34.2,26.9 and 20.4, compares with the contrast of non-transgenic cotton, and difference reaches utmost point conspicuous level (P＜0.01) (Fig. 6).Inoculation 15d, the non-transgenic adjoining tree seriously falls ill, and plant is because of severe infections defoliation verticillium wilt pathogen leaf abscission, and disease-resistant plant leaf does not have illness, the leaf look bud green, growth normal (Fig. 7).Disease index and the illness of transgene cotton strain show, dimension pipe specifically expressing in the cotton SpCEMAGene can significantly improve cotton to the disease resistance of defoliation verticillium.

9, field AAP2:: SpCEMATransgene cotton is to the resistance of defoliation verticillium:

9.1 Field AAP2:: SpCEMACpTI-Bt Transgenic Cotton at Seedling is to the resistance of defoliation verticillium:

By the disease-resistant authentication method in sick garden, above-mentioned 7 fields to AAP2:: SpCEMAThe transgene cotton homozygous lines is carried out disease-resistant evaluation and screening.The result shows, 3-4 sheet true leaf seedling inoculation defoliation verticillium wilt pathogen 30d is located away from not that sickness rate and the disease index of the non-transgenic plant of Transgenic wheat line are respectively 100.0% and 95.2, and dimension pipe specifically expressing SpCEMASickness rate and the disease index of transgene cotton strain ASP-21 be respectively 27.3% and 11.4, compare with the non-transgenic adjoining tree, difference all reaches utmost point conspicuous level (P＜0.01) (Fig. 8).

The phenotype of inoculation 30d plant is seen Fig. 9, the non-transgenic plant obscission occurred because of the infection blade of verticillium wilt pathogen, the wild-type plant of most inoculations is dead because of serious morbidity, and the not obvious or slight morbidity of transgenic cotton plant blade illness, plant strain growth is normal.

9.2 Field AAP2:: SpCEMAThe resistance of transgenic cotton flower growth later stage stem interior tissue performance:

Behind results fiber and the seed plant cane is divided into upper, middle and lower three parts, then cut open the disease index of bar statistics stem interior tissue, the result shows (Figure 10), the disease index on non-transgenic cotton plants the lower portion of the stem, middle part and top be respectively 100.0,95.7 and 87.5, ASP-21 strain plant be respectively 20.0,12.5 and 7.5.Compare with the non-transgenic cotton plants, difference all reaches utmost point conspicuous level (P＜0.01).The plant strain growth later stage is cutd open center vascular tissue and all brownization variable colors of xylem part of bar non-transgenic cotton plants stem inside, and transgenic cotton plant only the center vascular tissue brown spot is arranged, xylem and most plant middle part and top vascular tissue all do not have brown scab generation (Figure 11) on every side.

The phenotype of the inner disease index of transgene cotton strain plants stems and stem interior tissue shows, dimension pipe specifically expressing synthetic in the cotton SpCEMAGene can both the Effective Raise cotton to the resistance of defoliation verticillium.

10, field AAP2:: SpCEMATransgene cotton is to the resistance of non-defoliation verticillium:

10.1 field AAP2:: SpCEMACpTI-Bt Transgenic Cotton at Seedling is to the resistance of non-defoliation verticillium:

Be clear and definite AAP2:: SpCEMATransgene cotton is to the resistance of the pathogenic microbial verticillium of difference, the disease-resistant strain ASP-21 of transgenosis that the indoor disease-resistant evaluation of artificial climate and screening obtain, inoculate non-defoliation verticillium wilt pathogen in the time of Field inoculation defoliation verticillium wilt pathogen, sickness rate and the disease index of inoculation 30d statistics plant.The result shows (Figure 12), inoculates non-defoliation verticillium wilt pathogen 30d, and sickness rate and the disease index of the contrast of non-transgenic cotton are respectively 98.7% and 92.3, dimension pipe specifically expressing SpCEMATransgenic line ASP-21 be respectively 20.0% and 13.8, compare difference with non-transgenic contrast and all reach utmost point conspicuous level (P＜0.01).Inoculation 30d, non-transgenic contrast is morbidity all, obvious illness has all appearred in most plant leafs, and transgenic line only indivedual plant lower blade a little scab is arranged, show obvious disease resistance (Figure 13).

Seedling stage, sickness rate, disease index and the illness of transgenic cotton plant showed, dimension pipe specifically expressing synthetic SpCEMAThe same energy of gene Effective Raise cotton is to the resistance of non-defoliation verticillium.

10.2 field AAP2:: SpCEMAThe resistance to non-defoliation verticillium of transgenic cotton flower growth later stage stem interior tissue performance

The transgenic cotton plant of the non-defoliation verticillium wilt pathogen of the Field inoculation growth later stage is cutd open bar, according to the disease index of the method statistic plants stems interior tissue of embodiment 7.The result shows (Figure 14), and the disease index on non-transgenic plant strain growth later stage the lower portion of the stem, middle part and top is respectively 100.0,92.1 and 89.4; The ASP-21 strain is respectively 25.0,16.7 and 0.0.Compare with the non-transgenic contrast, the difference of different sites disease index has all reached utmost point conspicuous level (P＜0.01).The plant strain growth later stage, the center vascular tissue of non-transgenic contrast stem different sites and all brownization variable colors of xylem part, and transfer-gen plant only the center vascular tissue light discolouration is arranged, the central upper portion vascular tissue and on every side xylem part all do not have the spot (Figure 15) of obvious browning.

AAP2:: SpCEMADisease index and the brownization variable color degree of transgenic cotton plant growth later stage stem interior tissue show AAP2:: SpCEMATransgene cotton is obvious to non-defoliation resistance to verticillium wilt.

Above-mentioned example shows that the present invention utilizes the antibacterial peptide gene of dimension pipe specific promoter AAP2 control synthetic SpCEMA, realize this gene in transgene cotton, tie up the pipe specifically expressing, the Effective Raise transgene cotton is to the resistance of defoliation and non-defoliation verticillium.The inventive method is simple and easy to do, and effect is remarkable, has good market outlook.

Sequence table:

Sequence 1:AAP2 promotor cloned upstream primer:

5’-?AACTGCAGCTCAAAAGCTCCAGTCTTAGATAA-3’?(32bp)。

Sequence 2:AAP2 promotor cloned downstream primer:

5’-?CGGGATCCTATGAACTAGGAATCCTAAGGAGAT-3’?(33bp)。

Sequence 3: in the transgene cotton SpCEMAGene PCR and RT-PCR amplification upstream primer sequence:

5’-TGGCTTGTGCTTCCTTTTC-3’(19bp)。

Sequence 4: in the transgene cotton SpCEMAGene PCR and RT-PCR amplification downstream primer sequence:

5’-CCTTACTTGGTCAACTTCA-3’?(19bp)。

Sequence 5: cotton HIS3The gene amplification upstream primer:

5’-?GAAGCCTCATCGATACCGTC?-3’(20bp)。

Sequence 6: cotton HIS3The gene amplification downstream primer:

5’-?CTACCACTACCATCATGGC?-3’(19bp)。

Sequence 7:AAP2 promotor full length sequence (2148bp contains the restriction enzyme site of interpolation):

1? CTGCAGCTCA?AAAGCTCCAG?TCTTAGATAA?GGTGAATACA?TGGAAGGAAC?GGTCAAAGAC?GTGTAAGCAG

71?CCCGGAAAGC?AGGTGAAGGG?TGTCGCGCAC?CCCTTTTAAA?TATCGACTTC?ACCCTTGAAA?GCTCGGAGTA

141?CACCACAGAT?GCATCACTAA?AGATTTTGTC?GGCACGCTGA?AGTAAGCTAT?CTCGTGCCTC?CTCATAAGCT

211?GAAGTCTCAC?AGTCACTCTC?ATCATCGGTG?CTTGAGTCTC?CTTCTACTAT?CAGGGAATAT?CCATCAGCCT

281?GCTTTCTCTA?TTCTAGAATA?GCTGAAGCAT?GTCTTTCAGT?AATTACCTTC?ATCTGATCTT?CAATTGCCGT

351?GATTAAGTAA?CCGTTTTTCT?GCGAAAGAAA?GAAGATTGAC?AACAGCCGTT?TGATGGAAAT?GAAAGCACCA

421?GATACACAGA?CAAATGCAAC?ACATATTCCC?TTGGAAAAGG?ACAAAAGTAA?AAGAGCAGGC?AGAAGAGGAG

491?TACCTGCATA?AAGTTGCGGA?AAACAGATTT?GAAGTCACTG?ATTTCCTGCA?AAGAGGCATA?CTTGTAAACA

561?GGAGCAGATG?GACAACTTTC?AGCAGCTGCG?ATGCTCATAG?TCAAATTCTC?ATCAGGTTCC?TGGATCATCA

631?GAAACCAAAT?TAGATAGAAC?AATAAATAGA?AAGAAGGCAA?GTTCAAAGAG?CAATACCTTA?GCAAGCTCCT

701?CTGGTCTCCC?GGCATACATC?TGCGGTTGCT?CCTGTGGCAT?ACGCGAATTC?ACTCTTTCAT?CATAAGCATT

771?GCATATTCTA?TCAAGCGCAG?CCATCTTATC?ATCAGCTGTT?TGCGGCATCG?GACAGACGAA?GACATAAGAC

851?AAACCATCCA?TACCAATGCT?GCGCACTCGC?TCACCGTTGA?ATACTATCTC?CATGGGCCTC?TCATCCTGAC

921?TATGTTCCTT?CAAACGCTGC?TGCATCTGCT?CTTGCGTATA?AAATTCGTCC?CCCCTTGATA?AGTCGAGCAG

991?CCAAGAGGAT?TTGGCATGGT?CTCTGCCCTT?CGCATCGTCG?TCGTTCTTCG?TGGGAATGGC?CGGGAGCTTT

1061?CTACGTTTCC?ACGGGTAAAG?ATCAGAAGAG?GAAGGTTTCG?CCGGGTAAAG?ATCAGAAGAG?GAAGGTTTCG

1131?CCGCGGCGGT?TGCATCTTCA?CCGTCGATTT?CATCGTTACA?GCGACGCCGG?TAATTCCTAG?GTTGCTTAGT

1201?TCCCATTCTC?TCTCTAAAAT?TAGGGCTCGA?AATGAATTGT?TGAACAAGAT?AGAGATCTTT?TTCTGATCCC

1271?CGTCGAACAT?TTATTCAAGG?CCAAAAAAAG?CACACGGGAA?TTTAGAGTAC?CAATACATAT?CAAAACCTAA

1341?TGGGCTTTGA?ATGGTTGCAT?GTGTGTGTTT?ATTTCTGATA?TGCAAAGCGA?TCGATAGTCT?TTTCCATACA

1411?AGTGTAAACT?GTAAACAACG?TAATTAAGCA?TAACAATACA?ACTCTTTCTT?CTCTTTTTTT?TTGTAAACAC

1481?AAAATAAAAT?TACATCAATT?CATGCTTTTC?CTAGTTCATC?TGACATTTTC?CAAAATTCAT?GTTCCATTGA

1551?GTCCCTAATA?CTTGTTCATA?TTCATATTAG?GGTACATGAA?TAAAAGTTAT?CATTCTTGAA?ACTACTAAAT

1621?TTTCATAGTT?TATTTTTCTT?CTTTTCGTTT?CACTTTCGAA?CAAAACACTA?CGCGTGGCAT?TTGCAATGAA

1691?TTCCACATTA?TATGGAATAA?CACCATGATG?AACATTCTAC?ATATATAATT?ATTATGTTTA?AGCACTTAGA

1761?CAGCATAAAT?TCTTTCTAAT?TATATAAATC?TAACCTTGTT?ACATTGTACA?TCTATAAATT?ACTTGAAGAA

1831?ATAACGAGTT?CTATTTCTTT?TTAAAAATTA?AAAATACTAT?ACCATATCTC?AGTGATTAAG?TTGAACCAAA

1901?AGGTACGGAG?GAGAAACAAG?CATTTGATTC?TTCCTTATTT?TATTTTATTC?ATCTCTCACT?AATGATGGTG

1971?GAGAAAAAAA?GAAAATACCT?AACAAACAAA?TATATATTGT?CATACAAAAA?TATTTCTATA?TTTTTAGTTA

2051?ATTAGTTTAT?ATTCCTCACT?TTTCAGGGCT?TATATAAGAA?AGTGAGCAAA?CACAAATCAA?AATGCAGCAG

2201?CAAATACTAT?CATCACCCAT?CTCCTTAGGA?TTCCTAGTCA?TA GGATCC。

Sequence 8: SpCEMAGene order (synthetic 168bp):

1?ATGGAGAAGA?AGTCTCTTGC?TGGCTTGTGC?TTCCTTTTCT?TGGTTCTTTT?TGTTGCTCAA?GAAATTGTGG

71?TGACTGAAGC?TAAGTGGAAG?TTGTTCAAGA?AGATCGGTAT?CGGTGCTGTT?TTGAAGGTTT?TGACTACTGG

141?ATTGCCAGCT?TTGAAGTTGA?CCAAGTAA。

Claims (5)

1. utilize the plant expression vector of the antibacterial peptide gene of dimension pipe specific promoter control synthetic, it is characterized in that, for containing dimension pipe specific promoter AAP2 control artificial synthetic antimicrobial peptide gene SpCEMAPlant expression vector; Extract the laggard performing PCR amplification of the total DNA of Arabidopis thaliana, be connected with the pUC-T carrier again, transform the bacillus coli DH 5 alpha competent cell, screening positive clone obtains the promotor of Arabidopis thaliana AAP2 gene, then with the constitutive promoter CaMV35S on its replacement plant expression vector p5-spCEMA, make up an expression of plants body, called after p5-AAP2-spCEMA;

Wherein, take arabidopsis thaliana genomic dna as template, sequence 1 and sequence 2 are primer amplification AAP2The promoter sequence of gene, promotor AAP2 sheet segment length 2248bp is shown in sequence 7.

2. plant expression vector according to claim 1 is characterized in that, utilizes electric shocking method to transform agrobacterium tumefaciens, the recombinant bacterium that contains described p5-AAP2-spCEMA of acquisition.

3. the application of plant expression vector claimed in claim 1 in preparation transgenosis verticillium wilt-resistant cotton.

4. contain the transgene cotton preparation method of the described plant expression vector of claim 1, comprise the following steps:

Step 1: will tie up pipe specific promoter AAP2 sequence, antibacterial peptide gene SpCEMASequence is operationally inserted respectively in the expression vector, makes up plant expression vector;

Step 2: change the described plant expression vector of step 1 over to the host agrobacterium tumefaciens, obtain transformant;

Step 3: by transformant plant expression vector is integrated in the cotton, obtains transgene cotton;

Step 4: transgene cotton obtains the homozygous transgene cotton of resisting verticillium proterties genetic stability through indoor disease-resistant evaluation and proterties separation screening;

Step 5: more disease-resistant evaluation and the screening through the field of the homozygous transgene cotton of disease resistance inheritance stability, the transgene cotton of acquisition resisting verticillium.

5. a method of cultivating verticillium wilt-resistant cotton is characterized in that, changes respectively the described plant expression vector of claim 1 over to the cotton gene group, realizes antibacterial peptide gene specifically expressing in the transgene cotton vascular tissue, improves cotton to the resistance against diseases of verticillium.

Images