CN1316023C - Photoinduction expressed Gacab promoter and its expression function in different segments - Google Patents

Abstract

The present invention separately obtains an upstream expressive regulatory sequence 1009 bp(SEQIDNO: 1) on a composite body gene Gacab coding region 5' of light harvesting chlorophyll a/b albumen from Gossypiumarboreum. The expression regulatory sequence and different sections are systematically analyzed, people discover that-199 bp to-1 bp is basic promotors of Gacab genes, positive regulatory elements are contained between-504 bp and-199 bp, and negative regulatory elements are contained between-1009 bp and-504 bp. Therefore, 1) 504 bp segments lost by a 5' terminal at least are as useful as CaMV35S promotors in monocotyledon; 2) favorable photoinduction and special expressive promotors of blades can be obtained by further modification (comprises insertion, deficiency, displacement, repeat, etc.) of Gacab promotors or combination with other promotors, which has significant practical significance and large market economy value in plant gene engineering application.

Description

The expressive function of Gacab promotor and different sections is expressed in photoinduction

Technical field

The present invention relates to plant genetic engineering field.More particularly, the present invention relates to, by the plant expression vector and the transient expression of driving foreign gene in plant thereof of its structure from the promotor of Gossypiumarboreum Gacab gene 5 ' upstream and the expression regulation sequence of different sections thereof.The invention still further relates to this plant expression vector transformed host cells or callus and transgenic plant prepared therefrom.

Background technology

Only influence one of important factor of growth and development of plants, illumination condition affects morphogenesis, cell and ubcellular differentiation and the genetic expression of higher plant to a great extent.Can be as Arabidopis thaliana according to different illumination conditions, with the expression of environment and endogenous signal in conjunction with regulatory gene, by two remarkable different development pathways is dark morphogenesis (skotomorphogenesis) and photomorphogenesis (Photomorphogenesis), show different gene expression patterns and polymorphism, thereby reach optimum growh state (von Amim ﹠amp; Deng.Rev.Plant Physiol.Plant Mol Biol.1996,47:215-243).

The plant photomorphogenesis needs the expression of a large amount of structures, metabolism and regulatory gene simultaneously.Express very highly in the seedling that wherein a part of gene is grown under light, very lowly even express, be referred to as photoinduction gene (light-inducible gene) but express in the seedling of growth darkling.Because the variation of factors such as light quality, light quantity, photoperiod and direction of light, photoinduction expression of gene level has very big-difference.These expression of gene have tissue specificity simultaneously, and general expression in leaf is very high, in root, detect less than.The regulation and control of photoinduction gene transcription are one of important mechanisms of light regulating growth of plants (Millar ﹠amp; Kay.Proc Natl Acad Sci USA.1996,93:15491-15496; Terzaghi ﹠amp; Cashmore.Annu Rev Plant Physiol Plant Mol Biol.1995,46:445-474; Tobin﹠amp; Kehoe.Semin Cell Biol.1994,5:335-346), therefore (light responsive element LREs), helps to disclose the how mechanism of regulating growth of plants of light to study the photoinduction gene regulating sequence of specifically expressing in the plant materials and the light response element that is comprised thereof.

(chlorophyll a/b binding protein, CAB) gene is the photoinduction type gene of a quasi-representative to plant light harvesting chlorophyll a/b protein complexes.Transcribing of cab can be activated by far-red light, and the optical signal that participates in transcriptional control is mainly conducted by the ruddiness acceptor of phytochrome family.Millar and Kay (Millar﹠amp; Kay.Proc Natl Acad Sci USA.1996,93:15491-15496) research Arabidopis thaliana (Arabidopsis thaliana) cab expresses proof, except the optical signal of Photoreceptors conduction, the accurate expression of Arabidopis thaliana cab also is subjected to diel rhythm and from the coordinated regulation of development system signal.The promotor that had proved the cab gene of plants such as wheat (Triticum aestivum), petunia (Petunia hybrida) and Arabidopis thaliana already shows as light dependency and tissue specificity, and the cis element that comprises in the promotor separation and functional study (Cecillia have been carried out, et al.Plant J.1993,3:509-518; Gidoni, et al.Mol Gen Genet.1989,215:337-344; Ha ﹠amp; An.Proc Natl Acad Sci USA.1988,85:8017-8021; Degenhardt ﹠amp; Tobin.Plant Cell.1996,8:31-41; Yadav, et al.Plant J.2002,31:741-753).In the sequence of Arabidopis thaliana cab1 gene 5 ' upstream 1396bp, at least there are three dependent cis-acting elements of light, wherein two are positioned at-253～-158 bp and-1396～-766 bp, be that promotor photoinduction and tissue specificity are necessary ,-321～-253 bp then have effect (the Ha ﹠amp of enhanser; An.Proc Natl Acad Sci USA.1988,85:8017-8021).(Cecillia such as Cecillia, et al.Plant J.1993,3:509-518) find that 268 bp dna fragmentations (357～-89 bp) are a photoresponse and tissue-specific enhanser in the wheat cab1 promotor, form by three distinct elements of sequence.

In following plant genetic engineering research, effect for more economical effective performance foreign gene, or avoid gene product that receptor biological and environment are had side effects, need only timing in specific tissue or organ of foreign gene, express quantitatively, research organization's specifically expressing and inducible promoter have become one of focus of modern molecular biology research.

Summary of the invention

The present invention is from Gossypiumarboreum (Gossypium arboreum var.jinhua) (country of Chinese Academy of Agricultural Sciences germplasm storehouse, the expression regulation sequence that separates the middle cotton Gacab gene 5 ' upstream that has obtained 1009 bp #00008200), make up plant expression vector and change plant over to it, prove the function that has photoinduction and blade specific expression from the promotor of middle cotton Gacab gene.

Therefore, the present invention has cloned the promotor of Gossypiumarboreum (hereinafter unless stated otherwise, " middle cotton " and " Gossypiumarboreum " all refers to Gossypiumarboreum) photoinduction gene cab, and it has the nucleotide sequence shown in the SEQ ID NO:1.The present invention relates to express with blade specific and different section drives the characteristic of β-glucuronidase (GUS) reporter gene transient expression in plant from the photoinduction of the promotor of middle cotton Gacab gene, it is expected to provide better starting element for plant genetic engineering.

According to an aspect of the present invention, the present invention is according to known upland cotton (Gossypium hirstum) cab genes encoding region sequence (GenBank accession number: X54090), utilization adds the joint method, from the middle cotton genome, amplify the expression regulation sequence of middle cotton Gacab gene 5 ' upstream by PCR, and the segment of its different lengths is cloned on the plant expression vector, with agriculture bacillus mediated leaf dish method transformation of tobacco kind NC89, obtain transfer-gen plant.By detecting the expression of gus gene, find in transgene tobacco, to have the function of photoinduction and blade specific expression from the promoters driven gus gene of middle cotton Gacab gene.

In in this respect a preferred embodiment according to the present invention, wherein said middle cotton Gacab gene promoter refers to Gossypiumarboreum photoinduction gene cab total length promotor, have nucleotide sequence or its function equivalent or varient as SEQ ID NO:1, wherein said function equivalent or varient comprise displacement, adding, repetition or the disappearance of carrying out corresponding to the nucleotide sequence shown in the SEQ ID NO:1.Nucleotide sequence provided by the invention is lacked, adds and/or replaces one or several Nucleotide, be defined as functional derivatives, this functional derivatives can produce by technology such as the methods of knowing in this area such as rite-directed mutagenesis, synthetic, and they still have by knowing the function that technology can be verified in this area.

In this respect this preferred embodiment according to the present invention, wherein constructed plant expression vector is pcab1000, agriculture bacillus mediated leaf disc transformation method and the GUS of transfer-gen plant detect known technology by this area carry out (referring to Horsch, et al.1985,227:1229-1231; Jefferson, et al.EMBO J.1987,6:3901-3907).

To in this respect this preferred embodiment according to the present invention, used transgene receptor plant is paddy rice (Oryza sativa) or tobacco (Nicotiana tabacum), but be not limited to paddy rice or tobacco, it can be arbitrary gymnosperm or angiosperm, as monocotyledons and dicotyledons, and comprise vegetable cell, callus, whole strain plant and part thereof.

Middle cotton Gacab gene promoter of the present invention is to separate first cab promotor that obtains in the cotton, therefore, the present invention is except that having made up 1009 bp total length promotors, also made up 5 ' end deletion type middle cotton Gacab promotor of 199bp, 504 bp, 779 bp respectively, find by detecting its expression that drives gus gene: the middle cotton Gacab promotor of 199 bp, 504 bp, 779 bp and 1009bp can drive gus gene transient expression in the rice callus tissue, and wherein 504 bp middle cotton Gacab promoter expression intensity are apparently higher than the CaMV35S promotor.

In this respect the preferred embodiment according to the present invention, 5 ' the end deletion type middle cotton Gacab promotor of wherein said 779 bp, 504 bp, 199 bp, have nucleotide sequence or its function equivalent or its varient shown in SEQ ID NO:2,3,4 respectively, wherein said function equivalent or varient comprise and correspond respectively to displacement, adding, repetition or the disappearance that the nucleotide sequence shown in the SEQ ID NO:2,3,4 carries out.

In this respect this preferred embodiment according to the present invention, 5 ' the end deletion type middle cotton Gacab gene promoter of wherein said 779 bp, 504 bp, 199 bp all obtains with the amplification of PCR method, and the corresponding plant expression vector of structure is respectively pcab800, pcab500 and pcab200.

According to a further aspect in the invention, the present invention is by analyzing middle cotton Gacab total length promotor and the different transient expression of 5 ' end deletion type promoters driven gus gene in the rice callus tissue, supposition is the basic promotor of Gacab gene corresponding to-199 bp～-1 bp among the SEQ ID NO:1, comprise positive controlling element between-504 bp～-199 bp,-1009 bp～-504 bp strongly inhibited genetic expressions comprise negative regulatory element.

In in this respect a preferred embodiment according to the present invention, wherein the gene of available promoters driven of the present invention is a gus gene, but be not limited to gus gene, it can be antimycotic, antibacterium, antiviral, antiweed, pest-resistant, degeneration-resistant and relevant with output or qualitative character arbitrary goal gene.

According to a further aspect in the invention, the present invention infers according to above experiment: by the further modification to middle cotton Gacab promotor, comprise displacement, adding, repetition, disappearance, or merge with other promotors, be expected to obtain the efficiently photoinduction specific expression promoter significant to plant genetic engineering.

Therefore, according to a first aspect of the invention, the invention provides a kind of from middle cotton Gacab expression of gene controlling element, it is characterized in that it contains the nucleotide sequence shown in the SEQ ID NO:1 or its segment, or its segment combination by any way, or its function equivalent or varient, wherein said function equivalent or varient comprise displacement, adding, repetition or the disappearance of carrying out corresponding to the nucleotide sequence shown in the SEQ ID NO:1.This expression regulation element also can contain other promotors, and is attached thereto a kind of promoter, fusion of formation.Preferably, of the present invention is the promotor that contains the nucleotide sequence shown in the SEQ ID NO:4 from middle cotton Gacab expression of gene controlling element.More preferably, of the present invention is the promotor that contains the nucleotide sequence shown in the SEQID NO:3 from middle cotton Gacab expression of gene controlling element.Also have more preferably, of the present invention is the promotor that contains the nucleotide sequence shown in the SEQ ID NO:2 from middle cotton Gacab expression of gene controlling element.Even more preferably, of the present invention is the promotor that contains the nucleotide sequence shown in the SEQ ID NO:1 from middle cotton Gacab expression of gene controlling element.In addition, of the present invention from middle cotton Gacab expression of gene controlling element can be contain the nucleotide sequence segment-1009bp shown in the SEQ ID NO:1～-negative regulatory element of 504bp.In addition, of the present invention from middle cotton Gacab expression of gene controlling element can also be contain the nucleotide sequence segment-504bp shown in the SEQ ID NO:1～-the positive controlling element of 199bp.

According to a second aspect of the invention, the invention provides a kind of plant expression vector, it is characterized in that it contain above-mentioned any from middle cotton Gacab expression of gene controlling element.Preferably, the said plant expression vector of the present invention also contains the encoding sequence of goal gene, and wherein this goal gene is selected from antimycotic, antibacterium, antiviral, antiweed, pest-resistant, degeneration-resistant and relevant with output or quality trait structure and regulatory gene.Plant expression vector preferably of the present invention is the plasmid pcab1000 shown in Fig. 3-1.More preferably, plant expression vector of the present invention is the plasmid pcab800 shown in Fig. 3-2.Another preferred plant expression vector of the present invention is the plasmid pcab500 shown in Fig. 3-3.It is the plasmid pcab200 shown in Fig. 3-4 that the present invention also has another preferred plant expression vector.

According to a third aspect of the present invention, the invention provides a kind of transformed host cells, it is characterized in that it contains above-mentioned any plant expression vector.Wherein this host cell can derive from any gymnosperm and angiosperm.Most preferably, this host cell derives from paddy rice or tobacco.

According to a fourth aspect of the present invention, the invention provides a kind of plant transformed callus, it is characterized in that it contains above-mentioned any plant expression vector.Wherein this plant callus can derive from any gymnosperm and angiosperm.Most preferably, this plant callus derives from paddy rice or tobacco.

According to a fifth aspect of the present invention, the invention provides a kind of transgenic plant that prepare the method for transgenic plant and prepare thus, comprise from the callus regeneration of above-mentioned any plant transformed cell or above-mentioned any conversion becoming transgenic plant.

Description of drawings

Fig. 1: middle cotton cab gene promoter PCR product electrophorogram, size is 1009bp.Wherein, M: λ DNA/EcoR I+Hind III; 1: middle cotton cab promotor product;

Fig. 2: the structure of intermediate carrier pcab1, pcab0.8, pcab0.5 and pcab0.2;

Fig. 3: the structure of plant expression vector pcab1000, pcab800, pcab500, pcab200 and plasmid map;

Fig. 3-1, Fig. 3-2, Fig. 3-3, Fig. 3-4 represent the structure flow process and the expression casette of pcab1000, pcab800, pcab500, pcab200 plant expression vector respectively;

Fig. 4: the Gossypiumarboreum cab promotor (Gacab P) of different lengths drives the callus photo of gus gene transient expression in the rice callus tissue.Wherein, a, b, c, d and e represent to change the GUS histological chemistry detected result of the rice callus tissue of pcab200, pcab500, pcab800, pcab1000 and pBin121 respectively.The Gacab P of pcab200, pcab500, pcab800, four kinds of different lengthss of pcab1000 can both drive the gus expression of gene, but expression level is variant, the GUS expression level of its transfer pcab500 callus is the highest, and the expression intensity of 35S promoter in the pBin121, the expression intensity of pcab200, pcab800 and pcab1000 weakens.Because of pcab200 only comprises TATA box and CAAT box, so can think that-197 bp～-1 bp is the basic promotor of Gacab; The positive controlling element that comprises the Gacab promotor between-504 bp～-197 bp, the expression of enhancing gene; There is negative regulatory element between-1009 bp～-504 bp, suppresses the activity of promotor;

Fig. 5. the GUS tissue chemical analysis photo of Gossypiumarboreum Gacab promoters driven gus stably express in the tobacco Different Organs.Wherein, a: root; B: blade; Gacab P drives the gus gene at leaf expression, and the gus gene is not expressed in root, shows tangible tissue specificity;

Fig. 6. the transgene tobacco photo that Gossypiumarboreum Gacab promoters driven gus expresses in tobacco leaf after light, the dark cultivation.Wherein, a and b represent the GUS tissue chemical analysis in the transgene tobacco blade under the photoinduction condition; C and d represent under the dark culture condition not have GUS to occur in the blade of the GUS tissue chemical analysis dark place reason in the transgene tobacco blade, and efficiently expressing of gus gene arranged in the blade of optical processing, show tangible photoinduction characteristic.

Specific embodiments

Provide following embodiment to further specify the present invention below, should understand embodiment provided herein only is that the illustrative of technical solution of the present invention is explained, and does not constitute limitation of the scope of the invention.Those skilled in the art can make various modifications or variation to technical scheme of the present invention under the premise without departing from the spirit of the present invention, and these modifications or variation should be in the scope of protection of present invention.

Embodiment 1: the clone of Gossypiumarboreum Gacab gene promoter and the mensuration of sequence

1.1 the clone of Gossypiumarboreum Gacab gene promoter

Get 1～3 gram Gossypiumarboreum fresh leaves, add equivalent Al ₂0 ₃Use liquid nitrogen grinding, powder is placed the 50ml centrifuge tube, add 20ml DNA extraction damping fluid (100 mM Tris.HCl pH8.0,500mM NaCl, 10 mM beta-mercaptoethanols, 50 mM EDTA pH8.0), thermal agitation 1 minute, add 4ml 10%SDS, mixing heated 10～20 minutes in 65 ℃ gently, emerald green to color, add ice-cold 5M KAc 4 ml, placed on ice 30 minutes, then centrifugal 15 minutes of 4 ℃, 12000 rpm, get supernatant, behind 0.6 times of isopropanol precipitating, to handle with Rnase, it is standby that purifying obtains genomic dna.

According to TaKaRa LA PCR ^TMIn vitro Cloning Kit (TaKaRa company, catalog number is #DRR015) specification sheets, get the genomic dna 2.5 μ g of above-mentioned preparation, behind 37 ℃ of thorough digestion 3～6h of Hind III, whole digestion product is reclaimed with ethanol sedimentation, be dissolved in the 10 μ L deionized waters, with Hind III adapter (adaptor) (TaKaRa LA PCR with following sequence ^TMContain this adapter among the invitro Cloning Kit) connect, as template, apparatus has the primer Cassette primer C1/p-R1 of following sequence and Cassette primer C2/p-R2 to carry out the two-wheeled nest-type PRC, and wherein primer Cassette primer C 1 and Cassette primer C2 are by TaKaRa LAPCR ^TMIn vitro Cloning Kit provides, and primer p-R1 and p-R2 are synthetic according to known upland cotton cab genes encoding region sequence for the present invention.

The PCR primer:

HindIII?adaptor：

5′HO?GTACA?TATTG?TCGTT?AGAAC?GCGTA?ATACG?ACTCA?CTATA?GGGAGA3′

3′CATGT?ATAAC?AGCAA?TCTTG?CGCAT?TATGC?TGAGT?GATAT?CCCTCTTCGA?OH5′

Cassette?primer?C1：

5′GTACATATTGTCGTTAGAACGCGTAATACGACTCA?3′

p-R1：5′AGAACTTCACTGCCTTACCGGCGAATGATG?3′

Cassette?primer?C2：

5′CGTTAGAACGCGTAATACGACTCACTATAGGGAGA?3′

p-R2：5′GAGCCATGGTTGTAGAGGCCATTGTGAAGC?3′

Amplification condition is: 94 ℃, and 30 ", 55 ℃, 2 ', 72 ℃, 1 ', 30 of cycle numbers.PCR obtains about 1kb fragment (Fig. 1), reclaims the PCR product and is connected among the pMD18-T-vector (TaKaRa company, catalog number is #D5o4A) called after pcabP (Fig. 2).

1.2 the mensuration of Gossypiumarboreum Gacab promoter sequence

The pcabP sequencing result shows: the sequence of pcr amplification gained Gossypiumarboreum Gacab promotor, from first base of initiator codon ATG upstream, length is 1009 base pairs (sequence such as SEQID No:1).Sequential analysis confirms that all login sequence all do not have tangible homology among middle cotton Gacab promotor and the Genebank.

According to the general feature of eukaryotic gene promoter structure, the sequence of CAAT box is: C (T)A _2～5 G (T)NGA _2～4TT; The sequence of TATA box is: T C (G)TATA T (A)A _1～3 C (T)A.Infer in view of the above at-86～-80 places of Profilin2 promotor to have a TATA box, a CAAT box is arranged, see sequence SEQ ID No:1 at-142～-136 places.

Embodiment 2: the structure of structure 2.1 intermediate carrier pcab1, pcab0.8, pcab0.5 and the pcab0.2 of plant expression vector pcab1000 and different lengths disappearance promoter expression vector

With the pcabP plasmid DNA is template, primer p-F1000/p-R, the p-F800/p-R, p-F500/p-R and the p-F200/p-R that have following sequence according to the dna sequence dna design of the Gossypiumarboreum Gacab promotor that obtains among the embodiment 1, carry out pcr amplification respectively, the pcr amplification condition is: 94 ℃, and 30 ", 50 ℃; 1 '; 72 ℃, 1 ', 30 of cycle numbers.The PCR product that is obtained is handled with Hind III/BamHI double digestion, reclaims the purpose fragment; Handle pBluescript  II KS (+) (Stratagene company, catalog number is #212207) plasmid with Hind III/BamH I double digestion simultaneously, reclaim the carrier segments of 2.9 kb.Carrier segments is connected with target gene fragment, obtains intermediate carrier pcabl, pcab0.8, pcab0.5 and pcab0.2 (Fig. 2) respectively.

The PCR primer is as follows:

p-R：5′CT GGATCCGGTTGTAGAGGCCATTGTG?3′

BamH?I

p-F1000：5′GC AAGCTTGTCTAATAAATAATG?3′

Hind?III

p-F800：5′GC AAGCTTAGACCAACACCACTGACT?3′

Hind?III

p-F500：5′CT AAGCTTCAACATCAAGGGAGTTGT?3′

Hind?III

p-F200：5′CT AAGCTTGTGGATTAAAGATTGCC3′

Hind?III

2.2 the structure of plant expression vector pcab1000 and disappearance promoter expression vector pcab200, pcab500, pcab800

Extract pcab1, pcab0.8, pcab0.5 and pcab0.2 plasmid DNA, with Hind III/BamHI double digestion, reclaim about 1.0 kb respectively, 0.8kb, 0.5kb and the purpose fragment of 0.2kb, cut pBI121 (CLONTECH with HindIII/BamH I enzyme, #6018-1) reclaim about 11.5 kb carrier segments, this carrier segments is connected with the purpose fragment of four kinds of different lengthss, promptly the Gossypiumarboreum Gacab promotor with different lengths replaces the CaMV35S promotor, obtains pcab1000 (Fig. 3-1), pcab800 (Fig. 3-2), pcab500 (Fig. 3-3) and pcab200 (Fig. 3-4).

So far obtained to contain Gossypiumarboreum Gacab promotor total length 1009 bp (sequence such as SEQ IDNo:1) (pcab1000) and 779bp (sequence such as SEQ ID No:2) (pcab800), 504bp (sequence such as SEQ ID No:3) (pcab500) and (pcab200) plant expression vector of totally four kinds of different lengths promotor/GUS of 199bp (sequence such as SEQ ID No:4).Different plant expression vector gus expression casettes are shown in accompanying drawing 3-1, Fig. 3-2, Fig. 3-3, Fig. 3-4.

The transient expression of embodiment 3:Gacab promotor/gus gene

3.1 the preparation of rice callus tissue

(the described preparation rice callus tissue of people (Hiei Y, et al.Plant Journal, 6:271～282,1994) such as Hiei #ZD-03874) is pressed in country of Chinese Academy of Agricultural Sciences germplasm storehouse with spending 11 in the rice varieties.Earlier with the rice paddy seed that shells with 70% alcohol immersion 1min, again with the 1% chlorine bleach liquor 30min that sterilizes, aseptic water washing 5 times, place MS (GIBCOBRL, catalog number is #10632-040) 26 ℃ of lucifuges are cultivated 20d on the substratum, to peel from the callus that mature embryo scultellum director goes out, carry out succeeding transfer culture, occur until embryo callus.

3.2 particle gun bombardment rice callus tissue

Extract pcab1000, pcab800, pcab500, pcab200 and pBin121 plasmid DNA 1 μ g, the PDS-1000/He type particle gun that the bombardment particle gun adopts BioRad company to produce, using the bronze diameter is 0.4～1.0 μ m, bombardment is 7 584 kPa with helium pressure, every ware bombards about 20 rice callus tissue with 80 μ g bronzes and 1 μ g plasmid DNA, and other bombarding conditions are with reference to people such as Becker (Becker D, et al.Plant Journal, 5:299～307,1994) method.Rice callus is organized in MS substratum (Murashige T ﹠amp; Skoog F, Physiol Plant, 15:473～497,1962) last 25 ℃ cultivated 3 days, be organized as contrast with the rice callus tissue of non-conversion and the rice callus that changes pBin121, study the transient expression of different lengths middle cotton Gacab promoters driven gus gene.

3.3 rice callus is organized GUS moment detection of expression

Transformed calli is immersed an amount of X-gluc (Sigma company, catalog number is #B6650) solution, and (5mg X-gluc is dissolved in the 1ml dimethyl formamide, and continuation adds pH7.0, concentration is the NaPO of 50mM ₄To final volume be 10ml) in, (parafilm) seals with Parafilm, 37 ℃ of lucifuges are placed and are spent the night, before the microscopy, with FAA (85 milliliters of 50% alcohol: 10 milliliters of formalin: fixing 15min 5 milliliters in Glacial acetic acid), use 75%, 85%, 95%, 100% ethanol decolorization afterwards respectively, remove pigment.The result shows, the middle cotton Gacab promotor of four kinds of different lengthss can both drive the gus expression of gene, but expression level is variant, the GUS expression level of its transfer pcab500 callus is the highest, and the expression intensity of 35S promoter in the pBin121, compare with pcab500, the expression intensity of pcab200, pcab800 and pcab1000 weakens, and non-transformed calli does not have GUS and expresses (Fig. 4).

Embodiment 4: the stably express of conversion of tobacco and Gossypiumarboreum Gacab promoters driven gus gene

4.1 the preparation of LBA4404 competent cell

The single colony inoculation of picking LBA4404 (CLONTECH company, catalog number is #6027-1) (contains Streptomycin sulphate 100 μ g/ml, sucrose 5g+ peptone 5g+ extractum carnis 5g+ yeast extract 1g+MgSO in 5ml YEB ₄.7H ₂O 0.049g/L, pH7.2) in, 28 ℃, 250 rpm overnight incubation.Draw 2 ml bacterium colonies and add in the 50 ml YEB substratum, continue to be cultured to the OD600 value and be about 0.6.Bacterium liquid is gone in the aseptic centrifuge tube, ice bath 30 minutes, centrifugal 5 minutes of 5000 rpm are with the CaCl of 2ml 20 mM ₂Resuspended thalline is sub-packed in the aseptic little centrifuge tube by every pipe 200 μ l.

4.2 recombinant plasmid changes the LBA4404 cell over to

In 200 μ l LBA4404 competent cells, add 2 μ g recombinant plasmid pcab1000 respectively, put ice bath 5 minutes, went to then in the liquid nitrogen freezing 8 minutes, incubation after 5 minutes in 37 ℃ of water-baths rapidly, add 800 μ l YEB substratum, 28 ℃ of 250 pre-cultivation 4～5 hours of rpm is coated with the YEB solid plate that kantlex (50 μ g/ml) contained in the shop then, cultivates 24～48 hours for 28 ℃.The Agrobacterium bacterium colony that grows has corresponding conversion plasmid.

4.3 the genetic transformation of tobacco

(1) preparation of Agrobacterium: 28 ℃ of cultivations respectively of spending the night have the Agrobacterium 50ml of plant expression vector, and centrifugal 5 minutes of 5000 rpm collect bacterial sediment, with the washing of liquid MS nutrient solution once, use MS resuspended to OD600=0.2～0.4 again.

(2) contaminate: get tobacco bred NC89 (Nicotiana tabacum L.cv.NC89) (country of Chinese Academy of Agricultural Sciences germplasm storehouse, #00002293) aseptic seedling blade, be cut into the about 0.5 centimetre dice of the length of side by knife, in the Agrobacterium suspension, soaked 5～10 minutes, blot with sterilization filter paper then.

(3) cultivate altogether: the leaf piece is placed in not in the common culture medium of added with antibiotic (MS+IAA 0.5mg/L+6-BA 2mg/L) (top pad two layers of filter paper) cultivated altogether 3 days in 25 ℃ of lucifuges.

(4) select to cultivate: with the blade subculture to selecting in the substratum (MS+IAA 0.5mg/L+6-BA 2mg/L+Kan 100mg/L+Carb 500mg/L) in illumination box (illumination 12 hours, dark 12 hours) to be cultured to the appearance of resistant buds.

(5) acquisition of resistance seedling: callus is transferred to root media (MS+Kan 100mg/L+Carb 500mg/L), every two all succeeding transfer culture once, plants at last in the little polypots that sterile soil is housed.

4.4 the detection of transgene tobacco GUS stably express

Get the 3rd blade and the root at regeneration plant top, blade and root with the non-transgenic tobacco are contrast, carry out the GUS tissue staining by embodiment 3.2 described methods, the result shows, middle cotton Gacab promoters driven gus gene is expressed on leaf specific ground, the gus gene is not expressed in root, and no GUS expresses (Fig. 5) in the non-transgenic tobacco Different Organs.

Embodiment 5: transgene tobacco middle cotton Gacab promoters driven gus expression in tobacco leaf after light, the dark cultivation

Get the tobacco plant that pcab1000 is changeed in 10 strains that obtain among the embodiment 4, compare with the non-transgenic tobacco, 25 ℃ of dark cultivations 6 days, on the 3rd yellow leaf of top, take a sample, carry out GUS by embodiment 3.2 described methods and detect, then tobacco is placed under 25 ℃, the illumination condition of light application time 16h, light intensity 20001x, cultivated 6 days, continuation is taken a sample on same blade, carries out GUS tissue chemical analysis by embodiment 3.2 described methods.The result shows does not have GUS to occur in the blade of managing the dark place, and efficiently express (Fig. 6) of gus gene arranged in the blade of optical processing, does not all have GUS in the non-transgenic tobacco leaf of light, dark place reason and expresses.

Sequence table

＜110〉Biological Technology institute, Chinese Academy of Agricultural Sciences

＜120〉expressive function of Gacab promotor and different sections thereof is expressed in photoinduction

<160>4

<210>1

<211>1009

<212>DNA

＜213〉Gossypiumarboreum (Gossypium arboreum var.jinhua)

<220>

＜223〉Gacab promotor nucleotide sequence

<400>1

AAGCTGTC?TAATAAATAA?TGTTAATGTT?TATGGAAATG?ATTATGTTTA -961

TGTTTCATCT?TGTTTCTTGA?TGAAGCCTAA?TGAATCATAT?AGTTTTCGAC?ACTGATAATT -901

AGACTACTCG?TGGGTATTTT?TAGAAACTAT?TAAGTCAATT?ACATAATTAA?ATTTTTGGGT -841

TTTTAAAAAT?AAATTTCGAG?TTTTCTTTAT?AAGGGTTAAA?AGGACGAGAC?TTGGTATAAA -781

CTAGACCAAC?ACCACTGACT?AGTTGACATC?AATTTAAAGT?ATTTTGATAG?TGCCGCAAAA -721

CAAATTAAGC?CAGATTTTTA?TTCGTAAGAT?ATTTTACATT?TATGTATTAT?CAACCACTCA -661

AATCCTGTAA?TTTGTATTTT?TATGCTGCCA?TGATTTCAGC?ATCAATAAAC?TTCACCAAAA -601

GAAAGGAAAA?TCTATTTCAT?ATGGCTCAAA?GAAACTTCTT?TCTATGAAAA?CTCCATCTAT -541

TTTTCCATGA?AAATGAAAAG?GGAGGGAGAG?AGAAAATCAA?CATCAAGGGA?GTTGTTTAAT -481

TTATCAAGTA?ATATTTGTGT?GTATTAATTA?TAATCACTAA?AAATATTGAT?TGAATCACAA?-421

GTGAAGATTT?TATATTTAAT?TCATAATTGA?AAAAAATTTT?AAACTTTATT?TTTGAATTAT?-361

TTTTCATACA?AAACAATCCA?TTTACCTGTT?GTAGCATTGC?TTCATTGTTC?TAAACAAAAC?-301

AAACAAAAAG?GGTTCGAAAA?TTTTCAACAG?TCGAATTTCC?GTCACTATGG?TGGCCAAGCC?-241

TATGATCCTT?AAAAAATATT?GGTAGCCTGT?TAAGTGAAAT?TTTGTGGATT?AAAGATTGCC?-181

AAGTGGACAT?GCATGGCCAA?CATCAAAATC?TTGGAAGC TC?CAATGAAATG?AAAGATAGAG?-121

CAAT?box

ATATTACGTA?GATAAGGAAC?CTTACTCTCA?CCTT CCTATA?TAATAAACGC?ATCGGATTGC?-61

TATA?box

CCCTTCAATC?ACTCACCCAT?CACCAACAAA?ATCAACTGCT?TCACAATGGC?CTCTACAACC?-1

<210>2

<211>779

<212>DNA

＜213〉Gossypiumarboreum (Gossypium arboreum var.jinhua)

<220>

＜223〉5 ' end deletion type Gacab promotor nucleotide sequence

<400>2

AGACCAAC?ACCACTGACT?AGTTGACATC?AATTTAAAGT?ATTTTGATAG?TGCCGCAAAA -721

CAAATTAAGC?CAGATTTTTA?TTCGTAAGAT?ATTTTACATT?TATGTATTAT?CAACCACTCA?-661

AATCCTGTAA?TTTGTATTTT?TATGCTGCCA?TGATTTCAGC?ATCAATAAAC?TTCACCAAAA?-601

GAAAGGAAAA?TCTATTTCAT?ATGGCTCAAA?GAAACTTCTT?TCTATGAAAA?CTCCATCTAT?-541

TTTTCCATGA?AAATGAAAAG?GGAGGGAGAG?AGAAAATCAA?CATCAAGGGA?GTTGTTTAAT?-481

TTATCAAGTA?ATATTTGTGT?GTATTAATTA?TAATCACTAA?AAATATTGAT?TGAATCACAA?-421

GTGAAGATTT?TATATTTAAT?TCATAATTGA?AAAAAATTTT?AAACTTTATT?TTTGAATTAT?-361

TTTTCATACA?AAACAATCCA?TTTACCTGTT?GTAGCATTGC?TTCATTGTTC?TAAACAAAAC?-301

AAACAAAAAG?GGTTCGAAAA?TTTTCAACAG?TCGAATTTCC?GTCACTATGG?TGGCCAAGCC?-241

TATGATCCTT?AAAAAATATT?GGTAGCCTGT?TAAGTGAAAT?TTTGTGGATT?AAAGATTGCC?-181

AAGTGGACAT?GCATGGCCAA?CATCAAAATC?TTGGAAGC TC?CAATGAAATG?AAAGATAGAG?-121

CAAT?box

ATATTACGTA?GATAAGGAAC?CTTACTCTCA?CCTT CCTATA?TAATAAACGC?ATCGGATTGC?-61

TATA?box

CCCTTCAATC?ACTCACCCAT?CACCAACAAA?ATCAACTGCT?TCACAATGGC?CTCTACAACC?-1

<210>3

<211>504

<212>DNA

＜213〉Gossypiumarboreum (Gossypium arboreum var.jinhua)

<220>

＜223〉5 ' end deletion type Gacab promotor nucleotide sequence

<400>3

CAA?CATCAAGGGA?GTTGTTTAAT?-481

TTATCAAGTA?ATATTTGTGT?GTATTAATTA?TAATCACTAA?AAATATTGAT?TGAATCACAA?-421

GTGAAGATTT?TATATTTAAT?TCATAATTGA?AAAAAATTTT?AAACTTTATT?TTTGAATTAT?-361

TTTTCATACA?AAACAATCCA?TTTACCTGTT?GTAGCATTGC?TTCATTGTTC?TAAACAAAAC?-301

AAACAAAAAG?GGTTCGAAAA?TTTTCAACAG?TCGAATTTCC?GTCACTATGG?TGGCCAAGCC?-241

TATGATCCTT?AAAAAATATT?GGTAGCCTGT?TAAGTGAAAT?TTTGTGGATT?AAAGATTGCC?-181

AAGTGGACAT?GCATGGCCAA?CATCAAAATC?TTGGAAGC TC?CAATGAAATG?AAAGATAGAG?-121

CAAT?box

ATATTACGTA?GATAAGGAAC?CTTACTCTCA?CCTT CCTATA?TAATAAACGC?ATCGGATTGC?-61

TATA?box

CCCTTCAATC?ACTCACCCAT?CACCAACAAA?ATCAACTGCT?TCACAATGGC?CTCTACAACC?-1

<210>4

<211>199

<212>DNA

＜213〉Gossypiumarboreum (Gossypium arboreum var.jinhua)

<220>

＜223〉5 ' end deletion type Gacab promotor nucleotide sequence

<400>4

TTGTGGATT?AAAGATTGCC?-181

AAGTGGACAT?GCATGGCCAA?CATCAAAATC?TTGGAAGC TC?CAATGAAATG?AAAGATAGAG?-121

CAAT?box

ATATTACGTA?GATAAGGAAC?CTTACTCTCA?CCTT CCTATA?TAATAAACGC?ATCGGATTGC?-61

TATA?box

CCCTTCAATC?ACTCACCCAT?CACCAACAAA?ATCAACTGCT?TCACAATGGC?CTCTACAACC?-1

Claims (15)

1, a kind of basic promotor from middle cotton Gacab gene is characterized in that it is made up of the nucleotide sequence shown in the SEQ IDNO:4.

2, a kind of promotor from middle cotton Gacab gene is characterized in that it contains the described basic promotor of claim 1 and be made up of the nucleotide sequence shown in the SEQ ID NO:3.

3, a kind of promotor from middle cotton Gacab gene is characterized in that it contains the described basic promotor of claim 1 and be made up of the nucleotide sequence shown in the SEQ ID NO:2.

4, a kind of promotor from middle cotton Gacab gene is characterized in that it contains the described basic promotor of claim 1 and be made up of the nucleotide sequence shown in the SEQ ID NO:1.

5, a kind of plant expression vector is characterized in that it contains the described basic promotor from middle cotton Gacab gene of claim 1.

6,, it is characterized in that it contains each described promotor from middle cotton Gacab gene of claim 2-4 according to the said plant expression vector of claim 5.

7,, it is characterized in that it also contains the encoding sequence of goal gene according to the said plant expression vector of claim 6.

8, plant expression vector according to claim 7 is characterized in that described goal gene is selected from antimycotic, antibacterium, antiviral, antiweed, pest-resistant, degeneration-resistant and relevant with output or quality trait structure and regulatory gene.

9, plant expression vector according to claim 5 is characterized in that it is the plasmid pcab1000 shown in Fig. 3-1, and described plasmid pcab1000 comprises NPTII selective marker, cab1000 promotor, gus reporter gene and NOS terminator; Described cab1000 promotor has the sequence shown in SEQ ID NO:1.

10, plant expression vector according to claim 5 is characterized in that it is the plasmid pcab800 shown in Fig. 3-2, and described plasmid pcab800 comprises NPTII selective marker, cab800 promotor, gus reporter gene and NOS terminator; Described cab800 promotor has the sequence shown in SEQ ID NO:2.

11, plant expression vector according to claim 5 is characterized in that it is the plasmid pcab500 shown in Fig. 3-3, and described plasmid pcab500 comprises NPTII selective marker, cab500 promotor, gus reporter gene and NOS terminator; Described cab500 promotor has the sequence shown in SEQ ID NO:3.

12, plant expression vector according to claim 5 is characterized in that it is the plasmid pcab200 shown in Fig. 3-4, and described plasmid pcab200 comprises NPTII selective marker, cab200 promotor, gus reporter gene and NOS terminator; Described cab200 promotor has the sequence shown in SEQ ID NO:4.

13, a kind of transformed host cells is characterized in that it contains the described plant expression vector of claim 5.

14,, it is characterized in that this host cell derives from any gymnosperm and angiosperm according to the transformed host cells of claim 13.

15,, it is characterized in that this host cell derives from paddy rice or tobacco according to the transformed host cells of claim 14.

Images