CN103665129B - One kind of plant associated protein TaMYB72 at heading stage and application thereof - Google Patents
One kind of plant associated protein TaMYB72 at heading stage and application thereof Download PDFInfo
- Publication number
- CN103665129B CN103665129B CN201310698374.0A CN201310698374A CN103665129B CN 103665129 B CN103665129 B CN 103665129B CN 201310698374 A CN201310698374 A CN 201310698374A CN 103665129 B CN103665129 B CN 103665129B
- Authority
- CN
- China
- Prior art keywords
- plant
- heading stage
- seq
- tamyb72
- encoding gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Abstract
The invention discloses kind of plant associated protein TaMYB72 at heading stage and an application thereof.The invention discloses following arbitrary material in the application shortening plant heading stage and/or reduce in plant height: the albumen shown in (1) SEQ ID No.2; (2) encoding gene of albumen shown in SEQ ID No.2; (3) recombinant vectors containing (2) described encoding gene, expression cassette, transgenic cell line or recombinant bacterium.TaMYB72 albumen disclosed by the invention plays an important role in shortening plant heading stage and reduction plant height.
Description
Technical field
The present invention relates to kind of plant associated protein TaMYB72 at heading stage and an application thereof.
Background technology
Higher plant is in the growth course of its whole life history, and blooming is by the significant process changed to reproductive growth of nourishing and growing, and completes this change that to be that plant realizes normal reproductive development necessary in the suitable time.Plant has defined a kind of adaptability to environment in long-term evolution process, and it can be changed by perception day-night length and control to bloom, photoperiodism that Here it is.The research of the Molecular Biology Mechanism in model plant Arabidopis thaliana and paddy rice of flowering of plant approach has obtained very large progress, but research in staple food crop wheat is also relatively weak.
In the process of growth and development of plants, apical meristem (SAM) constantly breaks up the blade made new advances, after the nourishing and growing of certain hour, under the dual regulation and control of internal and external factor, plant tip cell starts to differentiate floral organ tissue, plant changes by nourishing and growing to reproductive growth, and blossoms and bears fruit within the suitable time, completes the life history.For Arabidopis thaliana, becoming to take time refers to be seeded into bloom during this period of time, and for paddy rice, becoming to take time just refers to heading stage, refers to extract Flag Leaf Sheath out during this period of time from being seeded into tassel.Heading (blooming) is that plant is by the important stage changed to reproductive growth of nourishing and growing.For farm crop, the length at heading stage directly determines region and the seasonal adaptation of crop varieties, and playing an important role to the high yield of kind and stable yields, is the important goal of crop breeding.
Because proterties at heading stage is subject to the impact of a series of inherence and external environment factor, so heading stage, proterties presented various change, this ensures that theres crop, to different ecotopes, there is adaptability widely.Therefore, clone controls the key gene at heading stage, and study the function and effect mechanism of these genes, for the inheritance at further investigated farm crop heading stage, provide candidate gene and theoretical basis for optionally cultivating the new crop varieties adapting to different ecological area.China different areas, the climate difference especially between north and south is very large, and the ecotopes such as intensity of illumination, sunshine duration and temperature are significantly different, therefore cultivates the kind with adaptation different ecological area and has great importance to guarantee China grain security.
Summary of the invention
The object of this invention is to provide kind of plant associated protein TaMYB72 at heading stage and an application thereof.
Following arbitrary material provided by the invention is in the application shortening plant heading stage and/or reduce in plant height:
(1) albumen shown in SEQ ID No.2;
(2) encoding gene of albumen shown in SEQ ID No.2;
(3) recombinant vectors containing (2) described encoding gene, expression cassette, transgenic cell line or recombinant bacterium.
Refer to described heading stage from being seeded into tassel and extract Flag Leaf Sheath out during this period of time.
In above-mentioned application, the nucleotide sequence of described encoding gene as in SEQ ID No.1 from 5 ' end shown in the 258th to the 1325th Nucleotide.
In above-mentioned arbitrary described application, described plant is paddy rice.
Prepare and to shorten heading stage and/or the method for transgenic plant of plant height step-down also belongs to a protection scope of the present invention, comprise the steps: the encoding gene of albumen shown in SEQ ID No.2 to import to set out in plant, obtain transgenic plant; Compared with the plant that sets out, shorten the heading stage of transgenic plant and/or plant height step-down.
In aforesaid method, the nucleotide sequence of described encoding gene as in SEQ ID No.1 from 5 ' end shown in the 258th to the 1325th Nucleotide.
In above-mentioned arbitrary described method, described plant is paddy rice.
A kind of albumen also belongs to protection scope of the present invention, shown in following (1) or (2):
(1) albumen shown in SEQ ID No.2;
(2) by the aminoacid sequence shown in SEQ ID No.2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and the identical protein of function.
The encoding gene of above-mentioned albumen also belongs to protection scope of the present invention.
In above-mentioned encoding gene, described encoding gene is following middle at least one:
1) DNA molecular shown in SEQ ID No.1;
2) in SEQ ID No.1 from 5 ' end the 258th to the 1325th DNA molecular shown in Nucleotide;
3) under strict conditions with 1) or 2) DNA molecule hybridize that limits and the DNA molecular of code for said proteins;
4) with 1) or 2) or 3) DNA molecular that limits has the identity of more than 90% and the DNA molecular of code for said proteins.
Recombinant vectors containing above-mentioned arbitrary described encoding gene, expression cassette, transgenic cell line or recombinant bacterium also belong to protection scope of the present invention.
TaMYB72 albumen provided by the invention plays an important role in shortening plant heading stage and reduction plant height.
Accompanying drawing explanation
Fig. 1 is the phenotype of paddy rice.
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Quantitative experiment in following examples, all arranges three repetitions, results averaged.
2 × Pfu PCR MasterMix is purchased from TIANGEN Biotech (Beijing) Co., Ltd., and catalog number is KP201, and this reagent is containing pfutaq enzyme.
Entry vector pDONR
tMzeo is purchased from Life Technologies, and catalog number is 12535-035.
BP Clonase
tMiI Enzyme Mix is purchased from Life Technologies, and catalog number is 11789020.
Intestinal bacteria TOP10 competent cell is purchased from Beijing Quanshijin Biotechnology Co., Ltd.
LR Clonase
tMiI Enzyme Mix is purchased from Life Technologies, and catalog number is 11791020.
vector Conversion System, purchased from Life Technologies, catalog number is 11828-019.
PCUbi1390 is disclosed in document " Peng Hao (2005) Ph D dissertation, " utilizing T-DNA insertion mutation and RNA perturbation technique Study On Rice gene function " ", and the public can obtain from Institute of Crop Science, Chinese Academy of Agricultural Science.
The structure of destination carrier pGW-CUbi1390: cut pCUbi1390 with flat terminal enzyme PmlI, obtain carrier; Utilize
vector Conversion System, by gateway cassete A(flush end) be connected into carrier, concrete method is
vector Conversion System normal process, the public can download from Life Technologies homepage, and the recombinant vectors obtained is pGW-CUbi1390.
Japan fine (O.Sativa L.spp.japonica, var nippobare, AA genome) is disclosed in document " Li Lei; Xue's fragrance a, left side shows quick, Chen Zongxiang; Pan Cunhong, Zhang Yafang, Li Yachao; Zhu Junkai; Ma Yuyin, Pan Xuebiao (2013), Yangzhou University's journal; 02 phase in 2013 ", and the public can obtain from Institute of Crop Science, Chinese Academy of Agricultural Science.
Chinese spring (Triticum aestivum L.) is at document " P.Sourdille, T.Cadalen, H.Guyomarc'h, J.Snape, M.Perretant, G.Charmet, C.Boeuf, be disclosed in S.Bernard and M.Bernard. (2003) An update of the Courtot × Chinese Spring intervarietalmolecular marker linkage map for the QTL detection of agronomic traits in wheat.Theoretical and Applied Genetics106 (3): 530-538 ", the public can obtain from Institute of Crop Science, Chinese Academy of Agricultural Science.
One sieve substratum: a sieve substratum by NB minimum medium, 2,4-D, Totomycin, Reflin and Phytgel form, pH5.8; The concentration of each composition is as follows: 2.0mg/l2,4-D, 50mg/l Totomycin, 0.5g/l Reflin, 2.5g/1Phytgel.
Two sieve substratum: two sieve substratum are made up of NB minimum medium, dormin (ABA), 6-benzyl aminopurine (BA), α-naphthaleneacetic acid (NAA), Totomycin, Reflin and phytgel, pH5.8; The concentration of each composition is as follows: 5.0mg/l dormin (ABA), 2.0mg/16-benzyladenine (BA), l.0mg/l α-naphthaleneacetic acid (NAA), 50mg/l Totomycin, 0.5g/l Reflin, 2.5g/1phytgel, pH5.8.
Three sieve substratum: three sieve substratum are made up of MS substratum (containing macroelement, trace element and organic composition), sucrose and agar, pH5.8; The concentration of each composition is as follows: 30g/l sucrose, 15g/l agar.
The structure of embodiment 1, TaMYB72 gene overexpression carrier and recombinational agrobacterium
The full length cDNA sequence of TaMYB72 is as shown in SEQ ID No.1, and the aminoacid sequence of TaMYB72 albumen is as shown in SEQID No.2.
One, Gateway technique construction TaMYB72 gene overexpression carrier is utilized
(1) attB design of primers
Design and synthesize following primer, and add attB1 and attB2 recombination site respectively at the 5' end of upstream primer (F1) and downstream primer (R1).
F1：5’-
GGGGACAAGTTTGTACAAAAAAGCAGGCTCGATGTTCTCTTCCAAGAAG-3’；
R1：5’-
GGGGACCACTTTGTACAAGAAAGCTGGGTTTATCCGTAGATCACCGAC-3’。
(sequence shown in underscore is attB recombination site)
(2) extract the total serum IgE of Chinese spring, reverse transcription is cDNA.
(3) cDNA obtained with step (two), for template, is that primer carries out pcr amplification with F1 and R1, obtains pcr amplification product.
PCR system (25.0 μ l): 12.5 μ l2 × Pfu PCR MasterMix, 3.0 μ l upstream primers (concentration is 2 μMs), 3.0 μ l downstream primers (concentration is 2 μMs), 2.0 μ l cDNA(quality are 30ng), DMSO1.5 μ l, add ddH
2o supplies system to 25.0 μ l.
PCR program: 95 DEG C of 5min; 94 DEG C of 30sec(sex change), 60 DEG C of 30sec(annealing), 72 DEG C of 1.5min(extend), 35 circulations; 72 DEG C of 5min.
(4) BP reaction
BP reaction system: the pcr amplification product 25ng that step (three) obtains, entry vector pDONR
tMzeo40ng, BP Clonase
tMiI Enzyme Mix0.3 μ l, adds sterilizing ddH
2o supplies system to 2.5 μ l.
BP response procedures: 25 DEG C of 10h.
(5) the BP reaction product that 2.5 μ l steps (four) obtain is added 30 μ l intestinal bacteria TOP10 competent cells, ice bath 15min, 42 DEG C of heat shock 90sec, are then placed in rapidly 2min on ice; Add 500 μ l SOC substratum, 37 DEG C, 225rpm/min recovery 50min; Resuscitation fluid is spread evenly across LB solid medium (containing 30 μ g/mlZeocin) surface, is inverted overnight incubation for 37 DEG C; PDONR
tMzeo carrier self is with lethal gene, can not survive on substratum, react target gene fragment by BP and can replace lethal gene, so be the entry clones (entry clone) containing target gene fragment the clone of the upper existence of LB solid medium (containing 30 μ g/ml Zeocin).
(6) entry clones step (five) obtained extracts plasmid and carries out two-way sequence verification, and sequence verification the primer is pDONR
tMzeo universal primer, sequence is as follows:
M13F：5’-GTAAAACGACGGCCAG-3’；
M13R：5’-CAGGAAACAGCTATGAC-3’。
Sequencing result shows, the plasmid obtained is at entry vector pDONR
tMthe the 258th to the 1325th DNA molecular shown in Nucleotide from 5 ' end is inserted in SEQ ID No.1, by this plasmid called after introduction plasmid (entry plasmid) between attP1 and the attP2 recombination site of Zeo.
(7) LR reaction
LR reaction system: introduction plasmid 25ng, destination carrier pGW-CUbi139040ng, LR Clonase
tMiI EnzymeMix0.3 μ l, adds sterilizing ddH
2o supplies system to 2.5 μ l.
LR response procedures: 25 DEG C, 10h.
(8) the LR reaction product that 2.5 μ l steps (seven) obtain is added 30 μ l intestinal bacteria TOP10 competent cells, ice bath 15min, 42 DEG C of heat shock 90sec, are then placed in rapidly 2min on ice; Add 500 μ l SOC substratum, 37 DEG C, 225rpm/min recovery 50min; Resuscitation fluid is spread evenly across LB solid medium (containing 50 μ g/ml kantlex) surface, is inverted overnight incubation for 37 DEG C; PGW-CUbi1390 self is with lethal gene, can not in the upper existence of LB solid medium (containing 50 μ g/ml kantlex), react target gene fragment by LR and can replace lethal gene, so the clone survived on substratum is target clone (Destiantionclone) containing target gene fragment.
(9) target clone step (eight) obtained extracts plasmid and carries out two-way sequence verification, and sequence verification the primer is promoter region, pGW-CUbi1390 vector insert two ends and terminator primer, and sequence is as follows:
Pubi：5’-TTTGTCGATGCTCACCCTG-3’；
Tnos：5’-TTGCCAAATGTTTGAACGA-3’。
Sequencing result shows, the plasmid obtained for inserting in SEQ ID No.1 the DNA molecular shown in the 258th to the 1325th Nucleotide from 5 ' end between attR1 and the attR2 recombination site of destination carrier pGW-CUbi1390, by this plasmid called after target plasmid.
Two, the structure of recombinational agrobacterium
Target plasmid transformation Agrobacterium EHA105 step one obtained, obtains recombinant bacterium; By recombinant bacterium upgrading grain, send order-checking, it is correct that result proves that recombinant bacterium builds.
Simultaneously by empty carrier pGW-CUbi1390 transformation Agrobacterium EHA105, obtain contrasting recombinant bacterium.
The acquisition of embodiment 2, transgenic plant
One, the Agrobacterium of Rice Callus is infected
(1) the fine seed of rice Japan of fetching water shells sterilizing, and tiling, to calli induction media induction two weeks, chooses the thoughtful callus particle growing diameter about 2mm of callus succeeding transfer culture two.
(2) the recombinant bacterium LB liquid nutrient medium (containing Rifampin 50mg/L+ Totomycin 50mg/L) embodiment 1 obtained, overnight incubation makes OD
600value is about 0.6-0.8, obtains bacterium liquid.
(3) get centrifugal 3 minutes of the bacterium liquid 4000rmp of about 3mL, remove supernatant, bacterium liquid is resuspended in the AMM(of about 20mL containing 100 μm of ol/L Syringylethanones) in liquid nutrient medium.28 DEG C, 150rpm shakes two hours, obtains object bacterium liquid.
(4) contaminate: callus particle step () obtained soaks 20 minutes in object bacterium liquid, then is put on the Dual culture base of one deck filter paper.Callus aseptic distillation is washed three times, each about 20 minutes after three days, then wash twice with the sterilizing containing 500mg/L carboxylic benzyl, each 30 minutes, repeatedly until washing lotion is very limpid, callus can be placed on aseptic filter paper and dries, then put it on a sieve substratum.Callus is forwarded on two sieve substratum after two weeks, then after two weeks, forward three sieve substratum to, obtain kanamycin-resistant callus tissue.
(5) kanamycin-resistant callus tissue is forwarded on division culture medium, wait for differentiation seedling.
(6) take root on the seedling of differentiation to 1/2MS substratum, then forward greenhouse and field planting to, obtain T0 for plant, T0 is for seed for results, is planted by T0, obtain the T1 of experimental group for plant for planting seed to large Tanaka.By T1 for plant selfing, obtain T1 for seed, in this approach until obtain T2 for plant.
The contrast recombinant bacterium that embodiment 1 obtains is carried out T1 that above-mentioned experiment obtains control group for plant and T2 for plant simultaneously.
Two, the T1 getting experimental group and control group respectively carries out Molecular Identification for plant and T2 for plant.
Concrete steps are as follows:
The T1 extracting experimental group and control group is for plant and the T2 genomic dna for the blade of plant, and with F2 and R2 for primer carries out PCR qualification, target sequence is the band of about 458bp.
F2：5’-CAAATGGAGGTTCAAAGGA-3’；
R2：5’-GGTGCCATCTGGAGTAGC-3’。
PCR is accredited as positive plant and is the plant turning TaMYB72 gene.For a certain T1 for plant, if the T2 that plant selfing obtains thus is all accredited as the positive through PCR for plant, then this plant is the plant turning TaMYB72 gene of isozygotying, this plant and offspring thereof be 1 isozygoty turn TaMYB72 gene strain.
Through above-mentioned identification experiment, the T2 turning TaMYB72 gene strain obtaining isozygotying is for paddy rice.
The T1 of control group carries out above-mentioned Molecular Identification for plant and T2 for plant, and result is feminine gender.
Embodiment 3, transgenic plant qualification at heading stage
The T2 turning TaMYB72 gene strain isozygotied embodiment 2 identified plants in Beijing and two places, Langfang for paddy rice and the wild-type fine paddy rice of Japan (hereinafter referred to as wild rice), investigate heading stage of transgenic paddy rice and wild rice, plant height, result as shown in figure 1 and table 1.
Figure 1A is the growing state of transgenic paddy rice and wild rice in land for growing field crops; Figure 1B is the potted plant contrast of transgenic paddy rice and wild rice.
Transgenic line in Fig. 1 be the T2 turning TaMYB72 gene strain that isozygotys for paddy rice, Japan is fine be the Japanese fine paddy rice of wild-type.
The data of heading stage and plant height are as shown in table 1.
Refer to heading stage from being seeded into tassel and extract Flag Leaf Sheath out during this period of time.
The T2 of table 1 Beijing and the plantation of two places, Langfang is for the fine paddy rice phenotypic data of transgenic paddy rice and wild-type Japan
The data of table 1 are carried out statistical study, and result is as shown in table 2.
The T2 of table 2 Beijing and the plantation of two places, Langfang analyzes for the fine paddy rice phenotypic data of transgenic paddy rice and wild-type Japan
Transgenic paddy rice in table 1 and table 2 be the T2 turning TaMYB72 gene strain that isozygotys for paddy rice, Japan is fine be the Japanese fine paddy rice of wild-type.
Table 2 shows, in heading stage, plant height, Japanese fine paddy rice there are differences TaMYB72 transgenic paddy rice with wild-type, and difference reaches pole conspicuous level, and TaMYB72 albumen can shorten the heading stage of paddy rice and reduce the height of plant in pole significantly.
Claims (6)
1. following arbitrary material is in the application shortening plant heading stage and/or reduce in plant height:
(1) albumen shown in SEQ ID No.2;
(2) encoding gene of albumen shown in SEQ ID No.2;
(3) recombinant vectors containing (2) described encoding gene, expression cassette, transgenic cell line or recombinant bacterium.
2. application according to claim 1, is characterized in that: the nucleotide sequence of described encoding gene as in SEQ ID No.1 from 5 ' end shown in the 258th to the 1325th Nucleotide.
3. application according to claim 1 and 2, is characterized in that: described plant is paddy rice.
4. prepare and shorten heading stage and/or the method for transgenic plant of plant height step-down, comprise the steps: the encoding gene of albumen shown in SEQ ID No.2 to import to set out in plant, obtain transgenic plant; Compared with the plant that sets out, shorten the heading stage of transgenic plant and/or plant height step-down.
5. method according to claim 4, is characterized in that: the nucleotide sequence of described encoding gene as in SEQ ID No.1 from 5 ' end shown in the 258th to the 1325th Nucleotide.
6. the method according to claim 4 or 5, is characterized in that: described plant is paddy rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310698374.0A CN103665129B (en) | 2013-12-18 | 2013-12-18 | One kind of plant associated protein TaMYB72 at heading stage and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310698374.0A CN103665129B (en) | 2013-12-18 | 2013-12-18 | One kind of plant associated protein TaMYB72 at heading stage and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103665129A CN103665129A (en) | 2014-03-26 |
| CN103665129B true CN103665129B (en) | 2015-08-26 |
Family
ID=50303989
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310698374.0A Active CN103665129B (en) | 2013-12-18 | 2013-12-18 | One kind of plant associated protein TaMYB72 at heading stage and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103665129B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106318968B (en) * | 2015-06-15 | 2019-07-16 | 华中农业大学 | The clone of rice ear sprouting period gene HAF1 and application |
| CN110904117B (en) * | 2019-10-24 | 2022-12-06 | 中国科学院遗传与发育生物学研究所 | Application of plant PHL2 gene in regulation of plant seed size, dry weight and fatty acid accumulation |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101353376A (en) * | 2008-08-22 | 2009-01-28 | 中国科学院遗传与发育生物学研究所 | Protein related to rice ear sprouting period and encoding genes and uses thereof |
| CN102787122A (en) * | 2012-06-21 | 2012-11-21 | 南京农业大学 | Gene OsEHD4 for controlling paddy rice heading stage and mutant and application thereof |
-
2013
- 2013-12-18 CN CN201310698374.0A patent/CN103665129B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101353376A (en) * | 2008-08-22 | 2009-01-28 | 中国科学院遗传与发育生物学研究所 | Protein related to rice ear sprouting period and encoding genes and uses thereof |
| CN102787122A (en) * | 2012-06-21 | 2012-11-21 | 南京农业大学 | Gene OsEHD4 for controlling paddy rice heading stage and mutant and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Zhang,L.,et al..ACCESSION NO. JF951955.1,Aegilops tauschii clone TaMYB72 MYB-related protein mRNA complete.《GenBank database》.2012, * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103665129A (en) | 2014-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110004154B (en) | Application of tea tree CsJAZ1 gene | |
| CN103014035B (en) | Tumorous stem mustard stress-resistant gene, plant expression vector, construction method and application thereof | |
| CN103739686A (en) | Protein related to plant yield improvement and quality improvement, and encoding gene and application thereof | |
| CN103665129B (en) | One kind of plant associated protein TaMYB72 at heading stage and application thereof | |
| CN109971763A (en) | Florescence control gene C MP1 and relevant carrier and its application | |
| US20230313151A1 (en) | Use of Gene Encoding Gibberellin 3Beta-Hydroxylase of Glycine Max, GmGA3ox1 | |
| CN104017061A (en) | Transcription factor ZmbZIP17 as well as coding gene of transcription factor and application of transcription factor to stress response | |
| CN116064568A (en) | Alfalfa MsASG166 gene and application thereof in improving drought tolerance of plants | |
| CN110904106B (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
| CN101952431A (en) | The conversion plant of growth | |
| CN105175519B (en) | Applications of the Protein S RL2 in cultivating leaf roll Qushui River rice | |
| CN107573411A (en) | Application of the wheat TaZIM1 7A albumen in crop heading stage is regulated and controled | |
| CN105132428B (en) | A kind of and the relevant ZmLRT genes of root system of plant character and its relevant biological material and application | |
| CN108148843A (en) | Chinese milk vetch LEAFY genes and its application | |
| CN107973844A (en) | Wheat heading stage GAP-associated protein GAP Ta-Hd4A and its application | |
| CN106978499A (en) | The external source Insert Fragment flanking sequences of transgenic soybean event GC1 1 and its application | |
| CN110343159B (en) | Application of expression vector of mung bean flowering gene VrELF3 | |
| CN102337276B (en) | Non-fertilization endosperm autonomous initiation gene for rice and application of gene | |
| CN101824080B (en) | Picea wilsonii transcription factor PwHAP5 and coding gene and application thereof | |
| CN116789785B (en) | High-yield and high-light-efficiency gene FarL a of long stamen wild rice and application thereof | |
| CN116121298B (en) | Application of inhibiting expression of HSRP1 gene in improving heat resistance of plants | |
| CN114107333B (en) | Application of barley receptor kinase HvSERK1 in root hair growth | |
| CN115011631B (en) | Protein for regulating drought resistance of corn at seedling stage, and coding gene and application thereof | |
| CN104098662A (en) | Rice drought resistance related protein, coding gene and application thereof | |
| CN116622725B (en) | Hybrid tulip tree LhMFT2 gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |