CN110343159B

CN110343159B - Application of expression vector of mung bean flowering gene VrELF3

Info

Publication number: CN110343159B
Application number: CN201910757723.9A
Authority: CN
Inventors: 叶卫军; 周斌; 杨勇; 田东丰; 张丽亚; 张磊
Original assignee: Institute Of Crops Anhui Academy Of Agricultural Sciences
Current assignee: Institute Of Crops Anhui Academy Of Agricultural Sciences
Priority date: 2019-08-16
Filing date: 2019-08-16
Publication date: 2021-05-14
Anticipated expiration: 2039-08-16
Also published as: CN110343159A

Abstract

The invention discloses an application of an expression vector of a mung bean flowering gene VrELF3, wherein a nucleotide sequence of the mung bean flowering gene VrELF3 is shown as a nucleotide sequence in a sequence table Seq ID No. 1. The mung bean flowering gene VrELF3 is expressed in a plant to regulate the flowering time of the plant. The invention can promote the transgenic plant to bloom in advance, shorten the growth period and has the physiological function of regulating and controlling the flowering period of the plant.

Description

Application of expression vector of mung bean flowering gene VrELF3

Technical Field

The invention relates to a mung bean flowering gene in the technical field of plant genetic engineering, in particular to application of an expression vector of the mung bean flowering gene VrELF 3.

Background

The mung bean is rich in nutrition, the protein content of grains is as high as 19.5-33.1%, the protein content of the grains is higher than that of cereal crops such as rice, wheat, corn and the like, and the mung bean belongs to high-protein, medium-starch and low-fat food. Moreover, the mung beans are rich in various mineral elements, vitamins and active substances, have the effects of detoxifying, resisting bacteria, resisting allergy, reducing blood fat, reducing blood pressure, resisting tumors, preventing cancers and the like, and belong to medical and edible crops. The mung beans can be processed into various forms of foods such as powder, soup, porridge, noodles and the like, are popular with the public, and the straws can also be processed into feed. The root system of the mung bean has nitrogen fixation capacity with rhizobia symbiotic with the root system of the mung bean, and the soil fertility and structure can be improved by planting the mung bean, so that the requirements of self growth are met, and the mung bean can be used by succeeding crops. In addition, the mung bean has the characteristics of preference for warmth, short growth period, high seeding elasticity, barren resistance, shade resistance, high economic benefit and the like, so that the mung bean is deeply favored by broad farmers.

At present, the main production areas of mung beans are in Asia, Africa and Europe, and the distribution areas are wide. However, for a single mung bean variety or germplasm resource, due to the limitation of regional adaptability, the planting range of good varieties is severely limited. Previous studies have shown that crop region adaptability is closely related to photoperiod and fertility control genes. Therefore, the genetic analysis and molecular mechanism research on the mung bean photoperiod regulation is beneficial to improving the mung bean molecular breeding level and accelerating the breeding of the wide-range variety. In the prior art, the soybean gene has been studied to regulate the flowering time of plants, but the expression pattern is weak to be regulated by light, and the change of the flowering time of plants by the expression of mung bean gene has not been reported.

Disclosure of Invention

Aiming at the technical problems in the prior art, the invention provides the application of the expression vector of the mung bean flowering gene VrELF3, which can promote the transgenic plant to bloom in advance, shorten the growth period and regulate the flowering period of the plant.

The invention is realized by adopting the following technical scheme: the invention provides an application of an expression vector containing a mung bean flowering gene VrELF3, wherein the expression vector is an over-expression vector obtained by inserting any one of the mung bean flowering genes VrELF3 into a plant expression vector, and a promoter for starting the expression of a corresponding target gene is a strong promoter 35S; wherein the nucleotide sequence of the mung bean flowering gene VrELF3 is the nucleotide sequence shown in a sequence table Seq ID No. 1; the mung bean flowering gene VrELF3 is expressed in a plant to regulate the flowering time of the plant.

As a further improvement of the scheme, the host cell of the expression vector is obtained by transferring the expression vector into agrobacterium tumefaciens.

As a further improvement of the above scheme, the construction method of the expression vector comprises the following steps:

(1) taking the young leaves of the mung bean containing the mung bean flowering gene VrELF3, extracting RNA and carrying out reverse transcription to obtain full-length cDNA;

(2) carrying out PCR amplification by using the full-length cDNA as a template through a forward primer 5'-GGGGACAAGTTTGTACAAAA AAGCAGGCTT AATGAGGAGA GGGAAGGAT-3' in a sequence table Seq ID No.9 and a reverse primer 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTACTAGACTGAGTCATACTG-3' in a sequence table Seq ID No.10 to obtain a PCR product;

(3) firstly, performing gel electrophoresis on the PCR product and recovering, and then exchanging the recovered product into an entry vector to obtain a recombinant entry vector;

(4) extracting a plasmid of the recombinant entry vector, and exchanging the VrELF3 gene fragment into the plant expression vector to obtain the over-expression vector.

The application of the expression vector of the mung bean flowering gene VrELF3 has the following beneficial effects:

1. the expression vector of the mung bean flowering gene VrELF3 can promote transgenic plants to bloom in advance and shorten the growth period, so that the expression vector has the physiological function of regulating the flowering period of the plants and can be used for regulating the flowering period of the plants in the field of plant genetic engineering.

Drawings

FIG. 1 is an alignment chart of amino acid sequences of a protein of a mung bean flowering gene VrELF3 and a soybean GmELF3 protein in example 1 of the invention;

FIG. 2 is a comparison graph of relative expression levels of the mung bean flowering gene VrELF3 in different organs of mung bean detected by the method for detecting the expression level of the mung bean flowering gene VrELF3 in example 4 of the present invention;

FIG. 3 is a graph comparing the relative expression of VrELF3 in the transgenic line of the mung bean flowering gene VrELF3 and wild type plants in example 9 of the present invention, wherein the left WT is the wild type plant and the right WT is the positive transgenic line;

FIG. 4 is a comparison of flowering-time of mung bean after overexpression of the mung bean flowering gene VrELF3 according to example 10 of the present invention;

FIG. 5 shows a comparison of the phenotypes of transgenic lines and wild-type plants of the mung bean flowering gene VrELF3 according to example 10 of the present invention, wherein the wild-type plants are shown on the left and the transgenic lines are shown on the right.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Example 1

Referring to fig. 1, the present invention provides a mung bean flowering gene VrELF3, wherein the mung bean flowering gene VrELF3 comprises a nucleotide sequence selected from the group consisting of:

(a) a nucleotide sequence shown in a sequence table Seq ID No. 1;

(b) a nucleotide sequence complementary to the nucleotide sequence of (a);

(c) a nucleotide sequence having at least 50% homology to the nucleotide sequence of (a); in other embodiments, the nucleotide sequence of (c) may have a nucleotide sequence which is at least 60%, at least 65%, at least 70%, at least 75%, preferably at least 80%, more preferably at least 85%, more preferably at least 90%, especially at least 95% or 98% or 99% homologous to the nucleotide sequence of (a);

(d) a nucleotide sequence which encodes a protein of the same amino acid sequence as the nucleotide sequence of (a), but which differs in sequence;

(e) a nucleotide sequence encoding one of the following amino acid sequences: an amino acid sequence shown in sequence table Seq ID No.2, or an amino acid sequence which differs from the amino acid sequence shown in sequence table Seq ID No.2 by substitution, deletion and/or insertion of at least one (e.g.1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3) amino acid residue, or an amino acid sequence which has at least 50% (of course, in other embodiments, at least 60%, at least 70%, at least 75%, preferably at least 80%, more preferably at least 85%, more preferably at least 90%, especially at least 95% or 98% or 99%) homology with the amino acid sequence shown in sequence table Seq ID No. 2;

(f) an active fragment of the nucleotide sequence of any one of (a) - (e); or

(g) A nucleotide sequence complementary to the nucleotide sequence of any one of (a) to (e).

In this example, the sequencing results showed that the CDS sequence of the mung bean flowering gene VrELF3 is composed of 2121 bases as shown in Table Seq ID N0.1. In addition, in this example, the encoded protein sequence was determined based on the CDS sequence of the mung bean flowering gene VrELF3, and as shown in Seq ID No.2, it was found that the mung bean flowering gene VrELF3 may have the same biological function as the homologous gene in soybean, since the homology with GmELF3 in soybean is 78.2% (fig. 1) consisting of 706 amino acid residues. In the present example, it was found that the mung bean flowering gene VrELF3 can regulate the flowering time of plants by expressing in the plants. Therefore, the mung bean flowering gene VrELF3 can promote transgenic plants to bloom in advance and shorten the growth period, so that the mung bean flowering gene VrELF3 has the physiological function of regulating the flowering period of the plants, and can be used for regulating the flowering period of the plants in the field of plant genetic engineering.

Example 2

This example provides a protein encoded by the green bean flowering gene VrELF3 of example 1, having an amino acid sequence selected from the group consisting of:

(1) an amino acid sequence shown in a sequence table Seq ID No. 2;

(2) and (2) an amino acid sequence having an equivalent function, which is obtained by substituting, deleting, adding and/or inserting at least one amino acid in the amino acid sequence of (1).

Example 3

The embodiment provides a method for detecting a coding sequence of a mung bean flowering gene VrELF3, wherein the gene is the mung bean flowering gene VrELF3 in embodiment 1, and the method for detecting the coding sequence comprises the following steps.

(1) Taking young leaves of mung beans containing a mung bean flowering gene VrELF3 to be ground in liquid nitrogen, and extracting total RNA through a kit. In this example, young leaves of medium green 5 can be taken, ground thoroughly in liquid nitrogen, and then total RNA is extracted using the plant total RNA extraction kit TRIzol (Invitrigen).

(2) Total RNA was extracted and reverse transcribed to full-length cDNA. In this example, first strand cDNA was synthesized using TaKaRa PrimeScript^TMII 1st strand cDNA Synthesis Kit, the concrete operation is carried out according to the instruction.

(3) The full-length cDNA is taken as a template, a forward primer 5'-AAGTTCAGCCCCTACCGT-3' in a sequence table Seq ID NO.3 and a reverse primer 5'-GAATTGCTTTTGACCTATTA-3' in a sequence table Seq ID NO.4 are taken as a first pair of sequencing primers, and a forward primer 5'-TAATGGAAATGCCGCTACAG-3' in a sequence table Seq ID NO.5 and a reverse primer 5'-TACATACCAATGTGCTGTAA-3' in a sequence table Seq ID NO.6 are taken as a second pair of sequencing primers, so that PCR amplification is carried out. Wherein the total volume of the PCR reaction system is 20. mu.L, and the PCR reaction system comprises cDNA (50 ng. mu.L)^-1) mu.L of each of 2. mu.L of forward and reverse primers (10. mu.M), 2.0. mu.L of 10 XPCR buffer, 2. mu.L of dNTP mix (2mM), 0.2. mu.L of LATaq enzyme (5U/. mu.L), and water to 20. mu.L. Moreover, the PCR amplification procedure was 94 ℃ pre-denaturation for 4 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 2min, and 35 cycles; finally, the cells were extended at 72 ℃ for 10min and stored at 4 ℃.

(4) After the PCR reaction is finished, the amplified product is subjected to agarose gel electrophoresis, and then is recovered by a gel recovery kit (AxyPrep can be adopted)^TMDNA Gel Extraction Kit, Axygen) were excised, recovered and sequenced. The sequencing results of this example show that the CDS sequence of the mung bean flowering gene VrELF3 is shown in Table Seq ID No.1 and consists of 2121 bases.

Example 4

This example provides a method for detecting the expression level of the mung bean flowering gene VrELF3 in different organs of mung bean in example 1, which uses real-time fluorescent quantitative PCR (RT-PCR) to detect the expression level of the mung bean flowering gene VrELF3 in each organ of mung bean. Wherein, real-time fluorescent quantitative PCR is carried out on a LightCycler 96 platform, and SYBR Green I is used as a fluorescent dye. The detection method of the present embodiment includes the following steps.

(1) Taking root, stem, leaf, flower and pod tissues of mung bean containing a mung bean flowering gene VrELF3, respectively extracting total RNA and carrying out reverse transcription to obtain cDNA. In this example, medium green No.5 root, stem, leaf, flower, and immature pod tissues were taken, total RNA was extracted and reverse transcribed into cDNA.

(2) And (2) carrying out fluorescent quantitative PCR reaction on the cDNA of (1) by using a forward primer 5'-CCCCGGTAGACAATTTGTCA-3' in the sequence table Seq ID NO.7 and a reverse primer 5'-CAAGCAAAACCTCGGGTGAT-3' in the sequence table Seq ID NO.8 to obtain the expression level of the mung bean flowering gene VrELF3 in the tissues of roots, stems, leaves, flowers and young pods of mung beans. Wherein, the mung bean beta-tubulin gene is used as the fluorescent quantitative PCR internal reference, and the reaction system is 20 mu L: cDNA2.0. mu.L, forward and reverse primers (10. mu.M), 0.5. mu.L each, 2 XSSYBR Premix EX-Taq Mix 10. mu.L, with RNase free ddH₂Make up to 20. mu.L of O. The PCR reaction program was 94 ℃ hot start 30S, 94 ℃ 5S, 60 ℃ 30S, 40 cycles. Through experiments, the mung bean flowering gene VrELF3 is expressed in roots, stems, leaves, flowers and young pods, but is expressed in lower levels in the stems, the leaves and the young pods, and is expressed in higher levels in the roots and the flowers, as shown in FIG. 2.

Example 5

This example provides an expression vector containing the mung bean flowering gene VrELF3, the expression vector is an overexpression vector obtained by inserting the mung bean flowering gene VrELF3 of example 1 into a plant expression vector, and the promoter for promoting the expression of the corresponding target gene is strong promoter 35S.

Example 6

This example provides a host cell containing the overexpression vector of the mung bean flowering gene VrELF3, which is obtained by transferring the expression vector of example 5 into Agrobacterium tumefaciens GV 3101.

Example 7

This example provides a method for constructing an expression vector containing the mung bean flowering gene VrELF3 in example 5, wherein the method comprises the following steps of constructing primers used by an over-expression vector, amplifying a CDS sequence of VrELF3, designing specific primers according to a VrELF3 gene sequence, and adding attB linkers to the 5' ends of the primers respectively.

(1) Taking the young leaves of mung bean containing mung bean flowering gene VrELF3, extracting RNA and reversely transcribing the RNA into full-length cDNA. Wherein, the mung bean is Zhonglv No. 5.

(2) PCR amplification is carried out by using the full-length cDNA as a template through a forward primer 5'-GGGGACAAGTTTGTACAAAA AAGCAGGCTT AATGAGGAGA GGGAAGGAT-3' in a sequence table Seq ID No.9 and a reverse primer 5'-GGGGACCACT TTGTACAAGA AAGCTGGGTACTAGACTGAG TCATACTG-3' in a sequence table Seq ID No.10, and a PCR product is obtained. In this example, high fidelity enzymes were used

HS DNA Polymerase (TaKaRa Code: DR010A), reaction system: 5 mu L of template cDNA; 5 × PrimeSTAR Buffer (Mg2+ plus)10 μ L; dNTP mix (2mM each) 5. mu.L, forward and reverse primers (10. mu.M) 2. mu.L each;

HS DNA Polymerase 0.5μL，ddH₂o make up to 50. mu.L. The PCR amplification procedure was: pre-denaturation at 98 ℃ for 5 min; denaturation at 98 deg.C for 10s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 2.0min, and 30 cycles; finally, extension is carried out for 10min at 72 ℃.

(3) The PCR product is first gel electrophoresed and recovered, and the recovered product is then connected to the entry vector. In this example, the PCR product was gel-electrophoresed and recovered, and the recovered product was exchanged to the Gateway system entry vector pDONR221 by the Gateway BP clone reaction, as follows: 50-150ng of PCR Product (PCR Product), 150ng of destination vector (pDONR221), 2. mu.L of 5 × close Reaction Buffer, 2. mu.L of BP close enzyme mix, ddH₂And supplementing O to 10 mu L, mixing the mixture by briefly swirling twice, slightly centrifuging the mixture, carrying out water bath at 25 ℃ for 8h, then adding 1 mu L of protease K solution, mixing the mixture evenly, and standing the mixture at 37 ℃ for 10min to finish the reaction.

Wherein, the ligation product is transformed into escherichia coli competence DH5 alpha by a heat shock method, positive clones are selected after bacterial liquid PCR and are sequenced to obtain recombinant clones with the inserted sequence being completely the same as VrELF3 in the carrier, and the positive recombinant clones pDONR221-VrELF3 are obtained.

(4) The pDONR221-VrELF3 plasmid recombined into the portal vector was extracted and the VrELF3 gene fragment was exchanged into a plant expression vector to obtain an overexpression vector. In this example, the pDONR221-VrELF3 plasmid was extracted, and VrELF3 was exchanged into the overexpression vector pK2GW7 using the Gateway LR clone TM Enzyme Mix (Invitrogen, Cat. No.11791-019) system to construct a recombinant plasmid pK2GW7-VrELF 3. The LR reaction system is as follows:

reaction conditions are as follows: pDONR221-VrELF3 plasmid 50-150ng, destination vector (pK2GW7)150ng, 5 XL Clonase Reaction Buffer 2. mu.L, added 2. mu.L LR Clonase enzyme mix, ddH₂And supplementing O to 10 mu L, briefly vortexing twice, mixing uniformly, slightly centrifuging, adding 1 mu L of proteinase K solution after water bath at 25 ℃ for 8h, mixing uniformly, and standing at 37 ℃ for 10min to finish the reaction.

And 5 mul of reaction product is taken to transform escherichia coli DH5 alpha, after PCR of bacterial liquid, positive clone is picked for sequencing identification, and the obtained sequence which is the same as VrELF3 is positive recombinant plasmid pK2GW7-VrELF 3.

Example 8

This example provides a method for genetic transformation of Arabidopsis thaliana, which comprises the following steps.

(1) The plasmid containing the expression vector of the mung bean flowering gene VrELF3 in example 7 was mixed with Agrobacterium GV3101 in an ice bath and transformed by the electroporation method.

(2) The transformants were plated on resistant YEP medium and cultured upside down until single colonies grew. In this example, the transformed product was plated on resistant YEP medium containing Rif (rifampicin) 50mg/L and Spec (spectinomycin hydrochloride) 100mg/L, and cultured at 28 ℃ for 2 nights in an inverted state until single colonies were grown.

(3) Single colonies on resistant YEP medium were picked into YEP liquid medium and shake cultured. And (3) sucking a proper amount of bacterial liquid, adding the bacterial liquid into a YEP liquid culture medium (containing corresponding antibiotics), and culturing until the OD600 is more than 1. In this example, grown Agrobacterium was picked up as a single clone into 5mL YEP liquid medium (Rif 50mg/L for the corresponding antibiotic, spec 100mg/L) and cultured with shaking at 28 ℃ and 150rpm for 48 hours. In this example, the cultured strain was added to YEP broth (containing the corresponding antibiotic) at a volume ratio of 1:10 and cultured at 28 ℃ until OD600> 1.

(4) Removing the pod of the arabidopsis thaliana fruit in the full-bloom stage, and placing the whole arabidopsis thaliana plant in a bacterial liquid for infection. In this example, arabidopsis thaliana pods were removed cleanly during the full-bloom period of arabidopsis thaliana, and the whole arabidopsis thaliana plant with only inflorescence left was inverted together with the plug and covered in the bacterial solution containing transformed agrobacterium, and seedlings were soaked for 5min while the bacterial solution was continuously shaken.

(5) And taking out the infected arabidopsis thaliana plant for shading growth. In this example, after infection, the plants were removed, placed on their sides in trays, covered with dark black plastic cloth, placed in a growth chamber, and uncovered after 24 h.

(6) Culturing the arabidopsis thaliana plant after shading growth under the illumination, watering 1-2 times per week, and harvesting T0 generation seeds after the seeds are mature.

(7) The harvested T0 generation seeds are sterilized and disinfected, planted in a solid culture medium, vernalized in the dark, cultured in artificial climate and observed for growth. In the embodiment, harvested seeds of T0 generation are sterilized and disinfected, planted in a solid culture medium of MS +25mg/L Basta, vernalized in the dark at 4 ℃ for 3 days, the culture dish is placed in an artificial climate box for culture, and the growth condition of Arabidopsis plants is observed. Wherein transgenic seeds with BASTA resistance will grow in the selection medium, while non-transgenic seeds die by yellowing shortly after germination. And harvesting the single plant, planting seeds of T1 generation, continuously screening seedlings by using Basta to obtain positive plants, and harvesting the single plant of T2 generation. And planting T2 generation seeds on the single plant, continuously screening seedlings by using Basta, and if the T3 generation plants all show resistance, indicating that the corresponding T2 generation single plant is a homozygous positive plant.

Example 9

This example provides a mung bean flowering gene VrELF3, and a comparative experiment was performed based on example 8. In this example, wild-type and homozygous positive Arabidopsis plants were planted, and total RNA was extracted from leaves of wild-type and Arabidopsis T3 generation plants for 3-4 weeks and reverse-transcribed into cDNA. The transgenic Arabidopsis plants 35S:: VrELF3 obtained in example 8 were subjected to fluorescent quantitative PCR analysis using primers (SEQ ID NO.5 and SEQ ID NO.6) (with Arabidopsis UBQ10 gene as reference gene). The quantitative results are shown in FIG. 3, and the expression level of VrELF3 in Arabidopsis thaliana transgenic line 35S:: VrELF3 is much higher than that of the wild type, which proves that the VrELF3 gene in the transgenic line 35S:: VrELF3 is over-expressed.

Example 10

This example provides a mung bean flowering gene VrELF3, and a comparative experiment was performed based on example 8. In this example, Arabidopsis transformed plants obtained in example 8 were grown simultaneously with wild-type control, the same cultivation measures were taken for management, and the flowering time of the transgenic plants and wild-type plants was investigated. The result shows that the mung bean flowering gene VrELF3 can improve the sensitivity of plants to photoperiod and promote flowering in advance when Arabidopsis is transformed. As shown in fig. 5, wild type controls are on the left and transgenic plants are on the right. As shown in FIG. 4, the time from sowing to flowering of 14 wild-type controls was 28-31 d, and the average was 29.4 d. The flowering time of the transgenic line is 22-27 days, and the average flowering time is 24.4 days, so that the mung beans VELF 3 can obviously promote flowering of plants.

Example 11

This example provides a plant transformant comprising on its genome the mung bean flowering gene VrELF3 driven by the promoter 35S of example 6.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> institute of agricultural sciences college of Anhui province

<120> mung bean flowering gene VrELF3 and application thereof

<141> 2019-02-28

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2121

<212> DNA

<213> mung bean (Vigna radiata)

<400> 1

atgaggagag ggaaggatga tgagaaggtg atggggccaa tgttccctag gctacatgtc 60

aatgatacag aaaagggagg accaagagca ccacctagga ataagatggc cctctatgag 120

cggtttagta ttccctctca aaggttcaat tcaggtgttc tgccactcaa ccaaaatatt 180

tccagtaata ctgctccccc tacatcctca agtcagggga ctgtccctga gagaaatcat 240

gtctttcctg ttcatatgcc atcgcagaaa cctattcgtc ccgtagaaaa atgtcactct 300

cgccaatcgg aagaggcaaa tttgacttgt tctcttgaac agagaaagaa ggtatatgaa 360

gaagacttta gggttcctgt atacgttcat tcaagggttg gtcagtgtaa tgataaaagt 420

gttgagagtt tcgacaggaa aaagatcact catacaggca ctaggtattt cggttgttca 480

gttgcagggc aaagtgattg tgaaagggtt cccaaacaat ttgggtcctc acatgttagg 540

aaagatgcgc gatgtgagac tgatggtctt ccacaagtaa gtacaagtaa agaccagcca 600

ttaacgtctg tccgaagcat atcaacgaga gaaaatattg acaccttagt aaggcaagcc 660

aaggtgactc cgaatcaaga gtttcaagat tgtcatgtat caaaaaggaa caggtttaga 720

caggatgatg cttgcttacg gcaggactgt ggagtggggt cccaatccaa tgacattgga 780

cacagtggtt ctcttgttca gtcttcaagg aagattggta atggaaatgc cgctacagca 840

aacaaaacca atccagctga ggcaatcaat gacactggac atcatgatac cgggacgggc 900

agtctgatac aggggggaaa attaaatgga agtgacaatg cttcaaagat ctccccggta 960

gacaatttgt caccagtgaa catttctcca gatgatgttg ttggaataat aggtcaaaag 1020

caattctgga aagctagaag agcaattgcc caccaacaga gagtgtttgc tgtccaagtg 1080

tttgagcttc acagattgat aaaggtccaa caactgatgg ctggatcacc cgaggttttg 1140

cttgaagatg gcacttttct gggaaagtct attccaaagg gatctactcg gaagaaactt 1200

tcactggaat atgttgtaaa accttggcaa caaaccctta agcgcaaaga tgattctgaa 1260

aagttaaatc ataaaatgga atgttctgcg gagaacgcag ttggcaagac gtctctctca 1320

tcagtgaaaa acgatagcca cctttcaaac tacactcctt ttccaagaaa tcctcaacag 1380

gcaaatgtgg ctgctgacag tggaatgggc ccttggtgtt tccagcagtc agccgggcac 1440

caatggttag ttcctgttat gactccttac gacgggcttg tctacaagcc atatcctagg 1500

cctggattca caggaacaga tggtggagga tgtgggcctg ctccttttgg tggtaatttt 1560

atgaatccag cctatggaat cccaacttct catcaaggag ttggggtttc accacaaaca 1620

cctccaggaa gtcttgctta cttccctcca tatgggatga cagttatgaa tgcaacaatg 1680

tcagagtcag ctgttgatca ggtgaaccag ttctcttcac taggttctca caggtataat 1740

ggccatttac ctggagggga atctaatcat atcacaaaca atcaaagctc tcgtaattta 1800

ccaactccga gaaatggagc atcgtcacat gtcctgaaat atcagacatc taaggatttt 1860

gagttgcagg gtagtacagc aagtagtcct gatgaaatgg cacaggcatt aagcacaggg 1920

caagttgcag aaggaaggga tgttcttcct cttttcccta tggttccggc agaacctgag 1980

tctattcctc gctctcttga aaccggacaa ccaactcgag taatcaaagt cgtgccgcac 2040

aaccgaatat cagcaactgc ttcagcagct agaatttttc aatcaattca ggaagagaga 2100

aaacagtatgactcagtctag 2121

<210> 2

<211> 706

<212> PRT

<213> mung bean (Vigna radiata)

<400> 2

Met Arg Arg Gly Lys Asp Asp Glu Lys Val Met Gly Pro Met Phe Pro

1 5 10 15

Arg Leu His Val Asn Asp Thr Glu Lys Gly Gly Pro Arg Ala Pro Pro

20 25 30

Arg Asn Lys Met Ala Leu Tyr Glu Arg Phe Ser Ile Pro Ser Gln Arg

35 40 45

Phe Asn Ser Gly Val Leu Pro Leu Asn Gln Asn Ile Ser Ser Asn Thr

50 55 60

Ala Pro Pro Thr Ser Ser Ser Gln Gly Thr Val Pro Glu Arg Asn His

65 70 75 80

Val Phe Pro Val His Met Pro Ser Gln Lys Pro Ile Arg Pro Val Glu

85 90 95

Lys Cys His Ser Arg Gln Ser Glu Glu Ala Asn Leu Thr Cys Ser Leu

100 105 110

Glu Gln Arg Lys Lys Val Tyr Glu Glu Asp Phe Arg Val Pro Val Tyr

115 120 125

Val His Ser Arg Val Gly Gln Cys Asn Asp Lys Ser Val Glu Ser Phe

130 135 140

Asp Arg Lys Lys Ile Thr His Thr Gly Thr Arg Tyr Phe Gly Cys Ser

145 150 155 160

Val Ala Gly Gln Ser Asp Cys Glu Arg Val Pro Lys Gln Phe Gly Ser

165 170 175

Ser His Val Arg Lys Asp Ala Arg Cys Glu Thr Asp Gly Leu Pro Gln

180 185 190

Val Ser Thr Ser Lys Asp Gln Pro Leu Thr Ser Val Arg Ser Ile Ser

195 200 205

Thr Arg Glu Asn Ile Asp Thr Leu Val Arg Gln Ala Lys Val Thr Pro

210 215 220

Asn Gln Glu Phe Gln Asp Cys His Val Ser Lys Arg Asn Arg Phe Arg

225 230 235 240

Gln Asp Asp Ala Cys Leu Arg Gln Asp Cys Gly Val Gly Ser Gln Ser

245 250 255

Asn Asp Ile Gly His Ser Gly Ser Leu Val Gln Ser Ser Arg Lys Ile

260 265 270

Gly Asn Gly Asn Ala Ala Thr Ala Asn Lys Thr Asn Pro Ala Glu Ala

275 280 285

Ile Asn Asp Thr Gly His His Asp Thr Gly Thr Gly Ser Leu Ile Gln

290 295 300

Gly Gly Lys Leu Asn Gly Ser Asp Asn Ala Ser Lys Ile Ser Pro Val

305 310 315 320

Asp Asn Leu Ser Pro Val Asn Ile Ser Pro Asp Asp Val Val Gly Ile

325 330 335

Ile Gly Gln Lys Gln Phe Trp Lys Ala Arg Arg Ala Ile Ala His Gln

340 345 350

Gln Arg Val Phe Ala Val Gln Val Phe Glu Leu His Arg Leu Ile Lys

355 360 365

Val Gln Gln Leu Met Ala Gly Ser Pro Glu Val Leu Leu Glu Asp Gly

370 375 380

Thr Phe Leu Gly Lys Ser Ile Pro Lys Gly Ser Thr Arg Lys Lys Leu

385 390 395 400

Ser Leu Glu Tyr Val Val Lys Pro Trp Gln Gln Thr Leu Lys Arg Lys

405 410 415

Asp Asp Ser Glu Lys Leu Asn His Lys Met Glu Cys Ser Ala Glu Asn

420 425 430

Ala Val Gly Lys Thr Ser Leu Ser Ser Val Lys Asn Asp Ser His Leu

435 440 445

Ser Asn Tyr Thr Pro Phe Pro Arg Asn Pro Gln Gln Ala Asn Val Ala

450 455 460

Ala Asp Ser Gly Met Gly Pro Trp Cys Phe Gln Gln Ser Ala Gly His

465 470 475 480

Gln Trp Leu Val Pro Val Met Thr Pro Tyr Asp Gly Leu Val Tyr Lys

485 490 495

Pro Tyr Pro Arg Pro Gly Phe Thr Gly Thr Asp Gly Gly Gly Cys Gly

500 505 510

Pro Ala Pro Phe Gly Gly Asn Phe Met Asn Pro Ala Tyr Gly Ile Pro

515 520 525

Thr Ser His Gln Gly Val Gly Val Ser Pro Gln Thr Pro Pro Gly Ser

530 535 540

Leu Ala Tyr Phe Pro Pro Tyr Gly Met Thr Val Met Asn Ala Thr Met

545 550 555 560

Ser Glu Ser Ala Val Asp Gln Val Asn Gln Phe Ser Ser Leu Gly Ser

565 570 575

His Arg Tyr Asn Gly His Leu Pro Gly Gly Glu Ser Asn His Ile Thr

580 585 590

Asn Asn Gln Ser Ser Arg Asn Leu Pro Thr Pro Arg Asn Gly Ala Ser

595 600 605

Ser His Val Leu Lys Tyr Gln Thr Ser Lys Asp Phe Glu Leu Gln Gly

610 615 620

Ser Thr Ala Ser Ser Pro Asp Glu Met Ala Gln Ala Leu Ser Thr Gly

625 630 635 640

Gln Val Ala Glu Gly Arg Asp Val Leu Pro Leu Phe Pro Met Val Pro

645 650 655

Ala Glu Pro Glu Ser Ile Pro Arg Ser Leu Glu Thr Gly Gln Pro Thr

660 665 670

Arg Val Ile Lys Val Val Pro His Asn Arg Ile Ser Ala Thr Ala Ser

675 680 685

Ala Ala Arg Ile Phe Gln Ser Ile Gln Glu Glu Arg Lys Gln Tyr Asp

690 695 700

Ser Val

705

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence

<400> 3

aagttcagcccctaccgt 18

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<400> 4

gaattgcttttgacctatta 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

taatggaaatgccgctacag 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

tacataccaatgtgctgtaa 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

ccccggtagacaatttgtca 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<400> 8

caagcaaaacctcgggtgat 20

<210> 9

<211> 49

<212> DNA

<213> Artificial sequence

<400> 9

ggggacaagt ttgtacaaaa aagcaggctt aatgaggaga gggaaggat 49

<210> 10

<211> 48

<212> DNA

<213> Artificial sequence

<400> 10

ggggaccact ttgtacaaga aagctgggta ctagactgag tcatactg 48

Claims

1. The application of an expression vector containing a mung bean flowering gene VrELF3 is characterized in that the expression vector is an over-expression vector obtained by inserting a mung bean flowering gene VrELF3 into a plant expression vector, and a promoter for promoting the expression of a corresponding target gene is a strong promoter 35S; wherein the nucleotide sequence of the mung bean flowering gene VrELF3 is the nucleotide sequence shown in a sequence table Seq ID No. 1; the mung bean flowering gene VrELF3 is expressed in a plant to reduce the flowering time of the plant.

2. The use of an expression vector containing the mung bean flowering gene VrELF3 as claimed in claim 1, wherein the host cell of the expression vector is obtained by transferring the expression vector into Agrobacterium tumefaciens.

3. The use of an expression vector containing a mung bean flowering gene VrELF3 as claimed in claim 1, wherein the construction method of the expression vector comprises the following steps: