CN110343159A - A kind of Mung Bean Blooming gene VrELF3 and its application - Google Patents
A kind of Mung Bean Blooming gene VrELF3 and its application Download PDFInfo
- Publication number
- CN110343159A CN110343159A CN201910757723.9A CN201910757723A CN110343159A CN 110343159 A CN110343159 A CN 110343159A CN 201910757723 A CN201910757723 A CN 201910757723A CN 110343159 A CN110343159 A CN 110343159A
- Authority
- CN
- China
- Prior art keywords
- mung bean
- vrelf3
- gene
- sequence
- blooming
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Physiology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of Mung Bean Blooming gene VrELF3 and its application, Mung Bean Blooming gene VrELF3 includes nucleotide sequence selected from the group below: (a) nucleotide sequence shown in sequence table Seq ID NO.1；(b) the complementary nucleotide sequence with the nucleotide sequence of (a)；(c) there is the nucleotide sequence of at least 50% homology with the nucleotide sequence of (a)；(d) from the protein of the nucleotide sequence coded same amino acid sequence of (a) but different nucleotide sequences in sequence；(e) nucleotide sequence of one of following amino acid sequence: amino acid sequence shown in sequence table Seq ID NO.2 is encoded；(f) active fragment of any one nucleotide sequence of (a)-(e)；Or (g) nucleotide sequence complementary with any one nucleotide sequence of (a)-(e).The present invention can promote genetically modified plants Blooming, shorten breeding time, have the physiological function in the florescence of regulation plant.
Description
Technical field
The present invention relates to a kind of Mung Bean Blooming gene of field of plant genetic project technology more particularly to a kind of Mung Bean Bloomings
Gene VrELF3 further relates to the protein of Mung Bean Blooming gene VrELF3 coding, further relates to Mung Bean Blooming gene VrELF3
Expression vector and its construction method and host cell, further relate to the coded sequence detection method of Mung Bean Blooming gene VrELF3
And its in mung bean Different Organs expression detection method, further relate to a kind of genetic transforming method of arabidopsis, further relate to
A kind of vegetable transformant.
Background technique
Mung bean is full of nutrition, and grain protein content is up to 19.5%~33.1%, is higher than the standing grain such as rice, wheat, corn
Cereal crops belong to high protein, middle starch, low fat group food.Moreover, mung bean be also rich in a variety of mineral elements, vitamin,
And active material, there is removing toxic substances, antibacterial bacteriostatic, antiallergy, reducing blood lipid, blood pressure lowering, antitumor, pre- anti-cancer and other effects, belong to
Doctor eats dual-purpose crop.Mung bean can be processed into the food of the diversified forms such as powder, soup, congee, noodles, deep to be liked by masses, straw
Stalk also can be processed as feed.There is nitrogen fixing capacity in mung bean root system with the rhizobium of its symbiosis, plantation mung bean can improve soil fertility
And structure, not only meet the needs of own growth, also for succession crop use.In addition, mung bean also has happiness temperature, breeding time
The features such as short, sowing elastic big, impoverishment tolerant, resistance to shade, high financial profit, likes its depth by wide farmers.
Currently, mung bean major production areas, in Asia, Africa, Europe, distributed areas are wider.But with regard to single mung bean variety or germplasm
For resource, due to the limitation of Regional suitability, the planting range of excellent variety is seriously constrained.It is previous research shows that crop
Regional suitability and photoperiod and breeding time controlling gene are closely related.Therefore, to mung bean Photoperiod heredity parsing and
Molecular mechanism research helps to improve mung bean molecular breeding level, accelerates the breeding of wide suitable kind.In the prior art, have and grind
Study carefully the florescence for regulating and controlling plant by soybean gene, but the adjustment effect of its expression pattern light is weaker, and pass through mung bean base
The expression of cause is not reported to change the flowering time of plant.
Summary of the invention
Problem in view of the prior art, the present invention provide a kind of Mung Bean Blooming gene VrELF3 and its application, can promote to turn
Gene plant Blooming shortens breeding time, the controllable plant florescence.
The present invention is implemented with the following technical solutions: a kind of Mung Bean Blooming gene VrELF3, it includes cores selected from the group below
Nucleotide sequence:
(a) nucleotide sequence shown in sequence table Seq ID NO.1；
(b) nucleotide sequence complementary with the nucleotide sequence of (a)；
(c) there is the nucleotide sequence of at least 50% homology with the nucleotide sequence of (a)；
(d) from the protein of the nucleotide sequence coded same amino acid sequence of (a) but different nucleotide in sequence
Sequence；
(e) nucleotide sequence of one of following amino acid sequence: amino acid shown in sequence table Seq ID NO.2 is encoded
Sequence, alternatively, as the substitution of at least one amino acid residue, missing and/or insertion and with shown in sequence table Seq ID NO.2
The different amino acid sequence of amino acid sequence, alternatively, having at least with amino acid sequence shown in sequence table Seq ID NO.2
The amino acid sequence of 50% homology；
(f) active fragment of any one nucleotide sequence of (a)-(e)；Or
(g) nucleotide sequence complementary with any one nucleotide sequence of (a)-(e).
As a further improvement of the foregoing solution, the Mung Bean Blooming gene VrELF3 is in plant by being expressed,
To adjust the flowering time of the plant.
The present invention also provides a kind of protein by above-mentioned any Mung Bean Blooming gene VrELF3 coding, ammonia
Base acid sequence is selected from:
(1) amino acid sequence as shown in sequence table Seq ID NO.2；
(2) by the amino acid sequence of (1) replace, lack, add and/or be inserted at least one it is amino acids formed have it is same
Etc. functions amino acid sequence.
The present invention also provides a kind of expression vector containing Mung Bean Blooming gene VrELF3, the expression vector is will be upper
It states any Mung Bean Blooming gene VrELF3 and is inserted into Overexpression vector acquired in plant expression vector, start phase
The promoter for answering destination gene expression is strong promoter 35S.
The present invention also provides a kind of host cell containing Mung Bean Blooming gene VrELF3 Overexpression vector, the places
Chief cell is that expression vector described above is transferred to host cell acquired in Agrobacterium tumefaciems.
The present invention also provides the coded sequence detection method of above-mentioned any Mung Bean Blooming gene VrELF3 a kind of,
Itself the following steps are included:
(1) it takes the young leaflet tablet of the mung bean containing the Mung Bean Blooming gene VrELF3 to be ground into liquid nitrogen, and leads to
It crosses kit and extracts total serum IgE；
(2) total serum IgE is extracted, and reverse transcription is full-length cDNA；
(3) using the full-length cDNA as template, pass through the forward primer 5'- in sequence table Seq ID NO.3
Reverse primer 5'-GAATTGCTTTTGACCTATTA-3' in AAGTTCAGCCCCTACCGT-3', sequence table Seq ID NO.4
Forward primer 5'-TAATGGAAATGCCGCTACAG-3' and sequence for first pair of sequencing primer, in sequence table Seq ID NO.5
Reverse primer 5'-TACATACCAATGTGCTGTAA-3' in list Seq ID NO.6 is second pair of sequencing primer, carries out PCR
Reaction amplification；
(4) PCR after reaction, agarose gel electrophoresis first is carried out to amplified matter, then passes through gel reclaims kit
It carries out gel extraction and is sequenced.
The present invention also provides a kind of above-mentioned any Mung Bean Blooming gene VrELF3 tables in mung bean Different Organs
Up to horizontal detection method, which is characterized in that itself the following steps are included:
(1) root, stem, leaf, flower, the young pod tissue for taking the mung bean containing the Mung Bean Blooming gene VrELF3, are extracted respectively
Total serum IgE and reverse transcription are cDNA；
(2) pass through forward primer 5'-CCCCGGTAGACAATTTGTCA-3' and sequence table in sequence table Seq ID NO.7
It is anti-to carry out quantitative fluorescent PCR to the cDNA of (1) by reverse primer 5'-CAAGCAAAACCTCGGGTGAT-3' in Seq ID NO.8
It answers, obtains expression of the Mung Bean Blooming gene VrELF3 in the root of the mung bean, stem, leaf, flower, young pod tissue.
The present invention also provides a kind of building sides of expression vector described above containing Mung Bean Blooming gene VrELF3
Method comprising following steps:
(1) young leaflet tablet of the mung bean containing the Mung Bean Blooming gene VrELF3 is taken, RNA is extracted and reverse transcription is overall length
cDNA；
(2) pass through the forward primer 5'-GGGGACAAGT TTGTACAAAA in sequence table Seq ID NO.9
Reverse primer 5'-GGGGACCACT in AAGCAGGCTT AATGAGGAGAGGGAAGGAT-3', sequence table Seq ID NO.10
TTGTACAAGA AAGCTGGGTA CTAGACTGAG TCATACTG-3' carries out PCR amplification by template of the full-length cDNA,
Obtain PCR product；
(3) gel electrophoresis first is carried out to the PCR product and recycled, then recovery product is exchanged in entry vector, obtained
Entry vector must be recombinated；
(4) plasmid of the recombination entry vector is extracted, and the VrELF3 genetic fragment is exchanged to the plant table
Up in carrier, to obtain the Overexpression vector.
The present invention also provides a kind of genetic transforming methods of arabidopsis comprising following steps:
(1) expression vector described above containing Mung Bean Blooming gene VrELF3 and Agrobacterium are subjected to ice bath mixing,
And it is converted by electric shocking method to generate conversion product；
(2) conversion product is coated on resistance YEP culture medium, and is inverted culture, until growing single colonie；
(3) bacterium colony on resistance YEP culture medium described in picking is cultivated, to formation into YEP fluid nutrient medium on shaking table
Bacterium solution carries out culture until OD600 is greater than 1；
(4) fruit pod for removing the arabidopsis of full-bloom stage, the whole strain of arabidopsis is placed in bacterium solution and is infected；
(5) it takes out the Arabidopsis plant after infecting and carries out shading growth；
(6) Arabidopsis plant after growing shading is placed under illumination and cultivates, the harvest T0 generation kind after seed is mature
Son；
(7) first by the T0 of harvest for being planted in solid medium after seed sterilizing, and dark vernalization is carried out, then will
Plant after vernalization is cultivated under artificial climate, and observes upgrowth situation.
It include above-mentioned containing promoter 35S driving the present invention also provides a kind of vegetable transformant, on genome
The meaning Mung Bean Blooming gene VrELF3.
Mung Bean Blooming gene VrELF3 of the invention and its application, have the advantages that
1, Mung Bean Blooming gene VrELF3 can promote genetically modified plants Blooming, shorten breeding time, therefore have and adjust
The physiological function for controlling the florescence of plant, can be used for plant genetic engineering field to regulate and control the plant florescence.
Detailed description of the invention
Fig. 1 is the albumen of the Mung Bean Blooming gene VrELF3 of the embodiment of the present invention 1 and the amino acid of soybean GmELF3 albumen
Sequence alignment figure；
Fig. 2 is the detection of Mung Bean Blooming gene VrELF3 expression in mung bean Different Organs of the embodiment of the present invention 4
The comparison diagram of the relative expression quantity of method each organ detected；
Fig. 3 is in the transgenic line and WT lines of the Mung Bean Blooming gene VrELF3 of the embodiment of the present invention 9
The comparison diagram of the relative expression quantity of VrELF3, left side WT is WT lines in figure, and right side is positive transgenic strain；
Fig. 4 is the flowering time comparison diagram after the Mung Bean Blooming gene VrELF3 overexpression of the embodiment of the present invention 10；
Fig. 5 is the transgenic line of the Mung Bean Blooming gene VrELF3 of the embodiment of the present invention 10 and the phenotype of WT lines
Comparative diagram, left side is WT lines in figure, and right side is transgenic line.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to the accompanying drawings and embodiments, right
The present invention is further elaborated.It should be appreciated that described herein, specific examples are only used to explain the present invention, not
For limiting the present invention.
Embodiment 1
Referring to Fig. 1, the present invention provides a kind of Mung Bean Blooming gene VrELF3, Mung Bean Blooming gene VrELF3 includes
Nucleotide sequence selected from the group below:
(a) nucleotide sequence shown in sequence table Seq ID NO.1；
(b) nucleotide sequence complementary with the nucleotide sequence of (a)；
(c) there is the nucleotide sequence of at least 50% homology with the nucleotide sequence of (a)；In other embodiments, (c)
Nucleotide sequence and (a) nucleotide sequence can have at least 60%, at least 65%, at least 70%, at least 75%, preferably
The nucleosides of at least 80%, more preferably at least 85%, more preferably at least 90%, especially at least 95% or 98% or 99% homology
Acid sequence；
(d) from the protein of the nucleotide sequence coded same amino acid sequence of (a) but different nucleotide in sequence
Sequence；
(e) nucleotide sequence of one of following amino acid sequence: amino acid shown in sequence table Seq ID NO.2 is encoded
Sequence, alternatively, due at least one (such as 1-25,1-20,1-15,1-10,1-5,1-3) amino acid residue
Substitution, missing and/or insertion and the amino acid sequence different from amino acid sequence shown in sequence table Seq ID NO.2, or
Person has at least 50% (certainly, in other embodiments, can also be with amino acid sequence shown in sequence table Seq ID NO.2
At least 60%, at least 70%, at least 75%, preferably at least 80%, more preferably at least 85%, more preferably at least 90%, especially
At least 95% or 98% or 99%) the amino acid sequence of homology；
(f) active fragment of any one nucleotide sequence of (a)-(e)；Or
(g) nucleotide sequence complementary with any one nucleotide sequence of (a)-(e).
In the present embodiment, sequencing result shows the CDS sequence such as table Seq ID N0.1 institute of Mung Bean Blooming gene VrELF3
Show, by 2121 base compositions.In addition, the present embodiment determines its coding according to the CDS sequence of Mung Bean Blooming gene VrELF3
Protein sequence is made of as shown in Seq ID NO.2 706 amino acid residues, and the homology with GmELF3 in soybean is
78.2% (Fig. 1), therefore speculate that the homologous gene in Mung Bean Blooming gene VrELF3 and soybean may biology having the same
Function.The present embodiment carries out correlative study discovery, and Mung Bean Blooming gene VrELF3 is planted by being expressed in plant with adjusting
The flowering time of object.Therefore, the Mung Bean Blooming gene VrELF3 of the present embodiment, can promote genetically modified plants Blooming, shorten
Breeding time, therefore there is the physiological function in the florescence of regulation plant, it can be used for plant genetic engineering field to regulate and control plant flowers
Phase.
Embodiment 2
Present embodiments provide a kind of protein encoded by Mung Bean Blooming gene VrELF3 in embodiment 1, amino acid
Sequence is selected from:
(1) amino acid sequence as shown in sequence table Seq ID NO.2；
(2) by the amino acid sequence of (1) replace, lack, add and/or be inserted at least one it is amino acids formed have it is same
Etc. functions amino acid sequence.
Embodiment 3
The coded sequence detection method of Mung Bean Blooming gene VrELF3 a kind of is present embodiments provided, which is embodiment
Mung Bean Blooming gene VrELF3 in 1, and detection method includes the following steps for coded sequence.
(1) it takes the young leaflet tablet of the mung bean containing Mung Bean Blooming gene VrELF3 to be ground into liquid nitrogen, and passes through examination
Agent box extracts total serum IgE.The present embodiment can take in green No. 5 young leaflet tablets, after being fully ground in liquid nitrogen, with plant total serum IgE
Extracts kit TRIzol (Invitrigen) extracts total serum IgE.
(2) total serum IgE is extracted, and reverse transcription is full-length cDNA.In the present embodiment, the synthesis of the first chain of cDNA utilizes
TaKaRa PrimeScriptTMII 1st strand cDNA Synthesis Kit kit carry out, concrete operations illustratively into
Row.
(3) using full-length cDNA as template, pass through the forward primer 5'- in sequence table Seq ID NO.3
Reverse primer 5'-GAATTGCTTTTGACCTATTA-3' in AAGTTCAGCCCCTACCGT-3', sequence table Seq ID NO.4
Forward primer 5'-TAATGGAAATGCCGCTACAG-3' and sequence for first pair of sequencing primer, in sequence table Seq ID NO.5
Reverse primer 5'-TACATACCAATGTGCTGTAA-3' in list Seq ID NO.6 is second pair of sequencing primer, carries out PCR
Reaction amplification.Wherein, the volume that PCR reacts total system is 20 μ L, and including cDNA (50ng μ L-1) 2 μ L, forward and reverse draw
Each 1.0 μ L of object (10 μM), 10 × PCR buffer, 2.0 μ L, dNTP Mixture (2mM) 2 μ L, LATaq enzyme (5U/ μ L) 0.2uL,
Moisturizing is to 20 μ L.Moreover, PCR amplification program is 94 DEG C of initial denaturation 4min；94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C extend
2min carries out 35 circulations；Finally, 4 DEG C of preservations after 72 DEG C of extension 10min.
(4) PCR after reaction, agarose gel electrophoresis first is carried out to amplified matter, then passes through gel reclaims kit
(AxyPrep can be usedTMDNA Gel Extraction Kit, Axygen) it carries out gel extraction and is sequenced.The survey of the present embodiment
Sequence the result shows that the CDS sequence of Mung Bean Blooming gene VrELF3 as shown in table Seq ID NO.1, by 2121 base compositions.
Embodiment 4
Present embodiments provide Mung Bean Blooming gene VrELF3 expression in mung bean Different Organs in a kind of embodiment 1
Detection method, the detection method using real-time fluorescence quantitative PCR (quantitative real time, RT-PCR) detect it is green
Expression of the beans floral genes VrELF3 in each organ of mung bean.Wherein, real-time fluorescence quantitative PCR is in LightCycler 96
It is carried out on platform, uses SYBR Green I as fluorescent dye.Detection method includes the following steps for the present embodiment.
(1) root, stem, leaf, flower, the young pod tissue for taking the mung bean containing Mung Bean Blooming gene VrELF3, extract total serum IgE respectively
And reverse transcription is cDNA.In the present embodiment, green No. 5 roots, stem, leaf, flower, young pod tissue, extract total serum IgE and reverse transcription are in taking
cDNA。
(2) pass through forward primer 5'-CCCCGGTAGACAATTTGTCA-3' and sequence table in sequence table Seq ID NO.7
It is anti-to carry out quantitative fluorescent PCR to the cDNA of (1) by reverse primer 5'-CAAGCAAAACCTCGGGTGAT-3' in Seq ID NO.8
It answers, obtains expression of the Mung Bean Blooming gene VrELF3 in the root of mung bean, stem, leaf, flower, young pod tissue.Wherein, fluorescence is fixed
PCR internal reference mung bean β-tubulin gene is measured, reaction system is 20 μ L:cDNA2.0 μ L, forward and reverse primer (10 μM) is each
0.5 μ L, 2 × SYBR Premix EX-Taq Mix, 10 μ L, with RNase free ddH2O complements to 20 μ L.PCR response procedures
For 94 DEG C of thermal startings 30S, 94 DEG C of progress 5S, 60 DEG C of progress 30s, 40 circulations are carried out.It is found through experiments that, Mung Bean Blooming gene
VrELF3 has expression in root, stem, leaf, flower, young pod, but expression quantity is lower in stem, leaf and young pod, expresses in root and in spending
Amount is higher, as shown in Figure 2.
Embodiment 5
A kind of expression vector containing Mung Bean Blooming gene VrELF3 is present embodiments provided, expression vector is by embodiment
1 Mung Bean Blooming gene VrELF3 is inserted into Overexpression vector acquired in plant expression vector, and starts corresponding purpose
The promoter of gene expression is strong promoter 35S.
Embodiment 6
Present embodiments provide a kind of host cell containing Mung Bean Blooming gene VrELF3 Overexpression vector, Su Zhuxi
Born of the same parents are that expression vector in embodiment 5 is transferred to host cell acquired in Agrobacterium tumefaciems GV3101.
Embodiment 7
Present embodiments provide a kind of building side of the expression vector containing Mung Bean Blooming gene VrELF3 in embodiment 5
Method, which constructs primer used in over-express vector, for expanding the CDS sequence of VrELF3, and according to VrELF3
Gene order designs special primer, adds attB connector at the end primer 5' respectively, which includes the following steps.
(1) young leaflet tablet of the mung bean containing Mung Bean Blooming gene VrELF3 is taken, RNA is extracted and reverse transcription is overall length
cDNA.Wherein, green No. 5 in the kind use of mung bean.
(2) pass through the forward primer 5'-GGGGACAAGT TTGTACAAAA in sequence table Seq ID NO.9
Reverse primer 5'- in AAGCAGGCTT AATGAGGAGA GGGAAGGAT-3', sequence table Seq ID NO.10
GGGGACCACT TTGTACAAGA AAGCTGGGTA CTAGACTGAG TCATACTG-3' is carried out by template of full-length cDNA
PCR amplification obtains PCR product.In the present embodiment, using high fidelity enzyme PrimeHS DNA Polymerase
(TaKaRa Code:DR010A), reaction system: 5 μ L of template cDNA；5×PrimeSTAR Buffer(Mg2+plus)10μL；
5 μ L of dNTP Mixture (each 2mM), each 2 μ L of forward and reverse primer (10 μM)；PrimeHS DNA Polymerase
0.5 μ L, ddH2O complements to 50 μ L.PCR amplification program are as follows: 98 DEG C of initial denaturation 5min；98 DEG C of denaturation 10s, 55 DEG C of annealing 30s, 72
DEG C extend 2.0min, 30 circulation；Last 72 DEG C of extensions 10min.
(3) gel electrophoresis first is carried out to PCR product and recycled, then recovery product is connected in entry vector.In this reality
It applies in example, PCR product gel electrophoresis is simultaneously recycled, and recovery product is exchanged to by Gateway BP Clonase reaction
The entry vector pDONR221 of Gateway system, coupled reaction system are as follows: PCR Product (PCR product) 50-150ng,
2 μ L BP Clonase are added in 2 μ L of purpose carrier (pDONR221) 150ng, 5 × Clonase Reaction Buffer
Enzyme mix, ddH2O complements to 10 μ L, and of short duration vortex mixes twice, then 1 μ L is added in 25 DEG C of water-bath 8h in gentle centrifugation
Proteinase K solution (Proteinase K Solution) is mixed, and reaction was completed by 37 DEG C of placement 10min.
Wherein, connection product is converted into E. coli competent DH5 α with heat shock method, selects positive colony after bacterium solution PCR and send
Sequencing obtains insetion sequence and the identical recombinant clone of VrELF3 in carrier, obtains Positive recombinant clones pDONR221-
VrELF3。
(4) the pDONR221-VrELF3 plasmid of recombination entry vector is extracted, and VrELF3 genetic fragment is exchanged to plant
In expression vector, to obtain Overexpression vector.In the present embodiment, pDONR221-VrELF3 plasmid is extracted, is used
Gateway LR Clonase TM Enzyme Mix (Invitrogen company, Cat.No.11791-019) system is by VrELF3
It exchanges in Overexpression vector pK2GW7, construction recombination plasmid pK2GW7-VrELF3.LR reaction system is as follows:
Reaction condition: pDONR221-VrELF3 plasmid 50-150ng, purpose carrier (pK2GW7) 150ng, 5 × LR
2 μ L LR Clonase enzyme mix, ddH are added in 2 μ L of Clonase Reaction Buffer2O complements to 10 μ L, short
It is temporarily vortexed and mixes twice, gentle centrifugation is added 1 μ L Proteinase K Solution and mixes, 37 DEG C of placement 10min after 25 DEG C of water-bath 8h
Reaction was completed.
Moreover, 5 μ L reaction products is taken to convert bacillus coli DH 5 alpha, picking positive colony carries out sequencing identification after bacterium solution PCR,
Gained sequence identical with VrELF3 is positive recombinant plasmid pK2GW7-VrELF3.
Embodiment 8
Present embodiments provide a kind of genetic transforming method of arabidopsis comprising following steps.
(1) plasmid containing Mung Bean Blooming gene VrELF3 expression vector in embodiment 7 is carried out with Agrobacterium GV3101
Ice bath mixes, and is converted by electric shocking method.
(2) conversion product is coated on resistance YEP culture medium, and is inverted culture, until growing single colonie.In the present embodiment
In, the product after conversion is coated on the resistance containing Rif (rifampin) 50mg/L and Spec (spectinomycin hydrochloride) 100mg/L
On YEP culture medium, 28 DEG C of inversions cultivate 2 evenings so that growing single colonie.
(3) single bacterium on picking resistance YEP culture medium drops down onto YEP fluid nutrient medium, and carries out shake culture.It draws suitable
It measures bacterium solution to be added in YEP fluid nutrient medium (containing corresponding antibiotic), culture to OD600 is greater than 1.The agriculture that the present embodiment picking is grown
Bacillus monoclonal (corresponding antibiotic be Rif 50mg/L, spec 100mg/L) into 5mL YEP fluid nutrient medium, at 28 DEG C and
Shaken cultivation 48 hours under the conditions of 150rpm.The training of YEP liquid is added in 1:10 to bacterium solution after the present embodiment shaken cultivation by volume
It supports in base (containing corresponding antibiotic), cultivates at 28 DEG C to OD600 > 1.
(4) fruit pod for removing the arabidopsis fruit of full-bloom stage, the whole strain of arabidopsis is placed in bacterium solution and is infected.In this implementation
In example, arabidopsis fruit pod is removed into clean, only remaining inflorescence the whole strain of arabidopsis in arabidopsis full-bloom stage and is buckled to together with hole tray
In containing having converted in the bacterium solution of Agrobacterium, seedling 5min is soaked, bacterium solution is during which constantly rocked.
(5) it takes out the Arabidopsis plant after infecting and carries out shading growth.The present embodiment takes out plant, side after having infected
It is put in pallet, covers the black plastic cloth being protected from light, be placed in growth room, and open afterwards for 24 hours.
(6) Arabidopsis plant after growing shading is placed under illumination and cultivates, and 1-2 water can be poured weekly, to seed
T0 is harvested after maturation for seed.
(7) first by the T0 of harvest for being planted in solid medium after seed sterilizing, and dark vernalization is carried out, then will
Plant after vernalization is cultivated under artificial climate, and observes upgrowth situation.Wherein, the present embodiment is by the T0 of harvest for seed
It after sterilizing, is planted in the solid medium of MS+25mg/L Basta, after 4 DEG C of dark vernalization 3d, culture dish is placed in people
Culture, observes the upgrowth situation of Arabidopsis plant in work climate box.Wherein the transgenic seed with BASTA resistance will sieve
Growth in culture medium is selected, and shortly yellow is die after the sprouting of non-transgenic seed.Single plant harvests and plants T1 for seed, children
Seedling Basta continues screening and obtains positive plant, and T2 is harvested for single plant.Single-strain planting T2 continues to sieve for seed, seedling with Basta
Choosing, if T3 is for plant, all performance resistance illustrates that corresponding T2 for single plant is homozygous positive plant.
Embodiment 9
A kind of Mung Bean Blooming gene VrELF3 is present embodiments provided, and has carried out comparison in fact on the basis of embodiment 8
It tests.In the present embodiment, plantation wild type and homozygous positive Arabidopsis plant, extract 3-4 weeks wild type and arabidopsis T3 generation plants
Total serum IgE in strain blade, and reverse transcription is cDNA.Embodiment 8 is obtained with primer (SEQ ID NO.5 and SEQ ID NO.6)
Transgenic Arabidopsis plants 35S::VrELF3 carries out quantitative fluorescent PCR analysis (using arabidopsis UBQ10 gene as internal reference base
Cause).As shown in figure 3, in arabidopsis transgenic line 35S::VrELF3, the expression of VrELF3 is much higher than quantitative result
Wild type, this has turned out the VrELF3 gene overexpression in transgenic line 35S::VrELF3.
Embodiment 10
A kind of Mung Bean Blooming gene VrELF3 is present embodiments provided, and has carried out comparison in fact on the basis of embodiment 8
It tests.The present embodiment obtains transformation of Arabidopsis thaliana plant from embodiment 8 and plants simultaneously with wild type control, same cultivation step into
Row management, investigates the florescence of transgenic plant and wild type.The results show that the quasi- south of Mung Bean Blooming gene VrELF3 conversion
Plant pair photoperiodic sensitivity, Blooming can be improved in mustard.As shown in figure 5, left side is wild type control, right side is to turn base
Because of plant.As shown in figure 4,14 plants of wild type controls are 28~31d, average out to 29.4d from the time spent is seeded into out.And turn base
Because the flowering time of strain is 22~27d, average out to 24.4d, illustrate that mung bean VrELF3 can significantly promote plant blossom.
Embodiment 11
A kind of vegetable transformant is present embodiments provided, containing comprising embodiment 6 starts on the genome of the transformant
The Mung Bean Blooming gene VrELF3 of sub- 35S driving.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention
Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.
Sequence table
<110>Crop Inst., Anhui Prov. Academy of Agricultural Sciencies
<120>a kind of Mung Bean Blooming gene VrELF3 and its application
<141> 2019-02-28
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2121
<212> DNA
<213>mung bean (Vigna radiata)
<400> 1
atgaggagag ggaaggatga tgagaaggtg atggggccaa tgttccctag gctacatgtc 60
aatgatacag aaaagggagg accaagagca ccacctagga ataagatggc cctctatgag 120
cggtttagta ttccctctca aaggttcaat tcaggtgttc tgccactcaa ccaaaatatt 180
tccagtaata ctgctccccc tacatcctca agtcagggga ctgtccctga gagaaatcat 240
gtctttcctg ttcatatgcc atcgcagaaa cctattcgtc ccgtagaaaa atgtcactct 300
cgccaatcgg aagaggcaaa tttgacttgt tctcttgaac agagaaagaa ggtatatgaa 360
gaagacttta gggttcctgt atacgttcat tcaagggttg gtcagtgtaa tgataaaagt 420
gttgagagtt tcgacaggaa aaagatcact catacaggca ctaggtattt cggttgttca 480
gttgcagggc aaagtgattg tgaaagggtt cccaaacaat ttgggtcctc acatgttagg 540
aaagatgcgc gatgtgagac tgatggtctt ccacaagtaa gtacaagtaa agaccagcca 600
ttaacgtctg tccgaagcat atcaacgaga gaaaatattg acaccttagt aaggcaagcc 660
aaggtgactc cgaatcaaga gtttcaagat tgtcatgtat caaaaaggaa caggtttaga 720
caggatgatg cttgcttacg gcaggactgt ggagtggggt cccaatccaa tgacattgga 780
cacagtggtt ctcttgttca gtcttcaagg aagattggta atggaaatgc cgctacagca 840
aacaaaacca atccagctga ggcaatcaat gacactggac atcatgatac cgggacgggc 900
agtctgatac aggggggaaa attaaatgga agtgacaatg cttcaaagat ctccccggta 960
gacaatttgt caccagtgaa catttctcca gatgatgttg ttggaataat aggtcaaaag 1020
caattctgga aagctagaag agcaattgcc caccaacaga gagtgtttgc tgtccaagtg 1080
tttgagcttc acagattgat aaaggtccaa caactgatgg ctggatcacc cgaggttttg 1140
cttgaagatg gcacttttct gggaaagtct attccaaagg gatctactcg gaagaaactt 1200
tcactggaat atgttgtaaa accttggcaa caaaccctta agcgcaaaga tgattctgaa 1260
aagttaaatc ataaaatgga atgttctgcg gagaacgcag ttggcaagac gtctctctca 1320
tcagtgaaaa acgatagcca cctttcaaac tacactcctt ttccaagaaa tcctcaacag 1380
gcaaatgtgg ctgctgacag tggaatgggc ccttggtgtt tccagcagtc agccgggcac 1440
caatggttag ttcctgttat gactccttac gacgggcttg tctacaagcc atatcctagg 1500
cctggattca caggaacaga tggtggagga tgtgggcctg ctccttttgg tggtaatttt 1560
atgaatccag cctatggaat cccaacttct catcaaggag ttggggtttc accacaaaca 1620
cctccaggaa gtcttgctta cttccctcca tatgggatga cagttatgaa tgcaacaatg 1680
tcagagtcag ctgttgatca ggtgaaccag ttctcttcac taggttctca caggtataat 1740
ggccatttac ctggagggga atctaatcat atcacaaaca atcaaagctc tcgtaattta 1800
ccaactccga gaaatggagc atcgtcacat gtcctgaaat atcagacatc taaggatttt 1860
gagttgcagg gtagtacagc aagtagtcct gatgaaatgg cacaggcatt aagcacaggg 1920
caagttgcag aaggaaggga tgttcttcct cttttcccta tggttccggc agaacctgag 1980
tctattcctc gctctcttga aaccggacaa ccaactcgag taatcaaagt cgtgccgcac 2040
aaccgaatat cagcaactgc ttcagcagct agaatttttc aatcaattca ggaagagaga 2100
aaacagtatgactcagtctag 2121
<210> 2
<211> 706
<212> PRT
<213>mung bean (Vigna radiata)
<400> 2
Met Arg Arg Gly Lys Asp Asp Glu Lys Val Met Gly Pro Met Phe Pro
1 5 10 15
Arg Leu His Val Asn Asp Thr Glu Lys Gly Gly Pro Arg Ala Pro Pro
20 25 30
Arg Asn Lys Met Ala Leu Tyr Glu Arg Phe Ser Ile Pro Ser Gln Arg
35 40 45
Phe Asn Ser Gly Val Leu Pro Leu Asn Gln Asn Ile Ser Ser Asn Thr
50 55 60
Ala Pro Pro Thr Ser Ser Ser Gln Gly Thr Val Pro Glu Arg Asn His
65 70 75 80
Val Phe Pro Val His Met Pro Ser Gln Lys Pro Ile Arg Pro Val Glu
85 90 95
Lys Cys His Ser Arg Gln Ser Glu Glu Ala Asn Leu Thr Cys Ser Leu
100 105 110
Glu Gln Arg Lys Lys Val Tyr Glu Glu Asp Phe Arg Val Pro Val Tyr
115 120 125
Val His Ser Arg Val Gly Gln Cys Asn Asp Lys Ser Val Glu Ser Phe
130 135 140
Asp Arg Lys Lys Ile Thr His Thr Gly Thr Arg Tyr Phe Gly Cys Ser
145 150 155 160
Val Ala Gly Gln Ser Asp Cys Glu Arg Val Pro Lys Gln Phe Gly Ser
165 170 175
Ser His Val Arg Lys Asp Ala Arg Cys Glu Thr Asp Gly Leu Pro Gln
180 185 190
Val Ser Thr Ser Lys Asp Gln Pro Leu Thr Ser Val Arg Ser Ile Ser
195 200 205
Thr Arg Glu Asn Ile Asp Thr Leu Val Arg Gln Ala Lys Val Thr Pro
210 215 220
Asn Gln Glu Phe Gln Asp Cys His Val Ser Lys Arg Asn Arg Phe Arg
225 230 235 240
Gln Asp Asp Ala Cys Leu Arg Gln Asp Cys Gly Val Gly Ser Gln Ser
245 250 255
Asn Asp Ile Gly His Ser Gly Ser Leu Val Gln Ser Ser Arg Lys Ile
260 265 270
Gly Asn Gly Asn Ala Ala Thr Ala Asn Lys Thr Asn Pro Ala Glu Ala
275 280 285
Ile Asn Asp Thr Gly His His Asp Thr Gly Thr Gly Ser Leu Ile Gln
290 295 300
Gly Gly Lys Leu Asn Gly Ser Asp Asn Ala Ser Lys Ile Ser Pro Val
305 310 315 320
Asp Asn Leu Ser Pro Val Asn Ile Ser Pro Asp Asp Val Val Gly Ile
325 330 335
Ile Gly Gln Lys Gln Phe Trp Lys Ala Arg Arg Ala Ile Ala His Gln
340 345 350
Gln Arg Val Phe Ala Val Gln Val Phe Glu Leu His Arg Leu Ile Lys
355 360 365
Val Gln Gln Leu Met Ala Gly Ser Pro Glu Val Leu Leu Glu Asp Gly
370 375 380
Thr Phe Leu Gly Lys Ser Ile Pro Lys Gly Ser Thr Arg Lys Lys Leu
385 390 395 400
Ser Leu Glu Tyr Val Val Lys Pro Trp Gln Gln Thr Leu Lys Arg Lys
405 410 415
Asp Asp Ser Glu Lys Leu Asn His Lys Met Glu Cys Ser Ala Glu Asn
420 425 430
Ala Val Gly Lys Thr Ser Leu Ser Ser Val Lys Asn Asp Ser His Leu
435 440 445
Ser Asn Tyr Thr Pro Phe Pro Arg Asn Pro Gln Gln Ala Asn Val Ala
450 455 460
Ala Asp Ser Gly Met Gly Pro Trp Cys Phe Gln Gln Ser Ala Gly His
465 470 475 480
Gln Trp Leu Val Pro Val Met Thr Pro Tyr Asp Gly Leu Val Tyr Lys
485 490 495
Pro Tyr Pro Arg Pro Gly Phe Thr Gly Thr Asp Gly Gly Gly Cys Gly
500 505 510
Pro Ala Pro Phe Gly Gly Asn Phe Met Asn Pro Ala Tyr Gly Ile Pro
515 520 525
Thr Ser His Gln Gly Val Gly Val Ser Pro Gln Thr Pro Pro Gly Ser
530 535 540
Leu Ala Tyr Phe Pro Pro Tyr Gly Met Thr Val Met Asn Ala Thr Met
545 550 555 560
Ser Glu Ser Ala Val Asp Gln Val Asn Gln Phe Ser Ser Leu Gly Ser
565 570 575
His Arg Tyr Asn Gly His Leu Pro Gly Gly Glu Ser Asn His Ile Thr
580 585 590
Asn Asn Gln Ser Ser Arg Asn Leu Pro Thr Pro Arg Asn Gly Ala Ser
595 600 605
Ser His Val Leu Lys Tyr Gln Thr Ser Lys Asp Phe Glu Leu Gln Gly
610 615 620
Ser Thr Ala Ser Ser Pro Asp Glu Met Ala Gln Ala Leu Ser Thr Gly
625 630 635 640
Gln Val Ala Glu Gly Arg Asp Val Leu Pro Leu Phe Pro Met Val Pro
645 650 655
Ala Glu Pro Glu Ser Ile Pro Arg Ser Leu Glu Thr Gly Gln Pro Thr
660 665 670
Arg Val Ile Lys Val Val Pro His Asn Arg Ile Ser Ala Thr Ala Ser
675 680 685
Ala Ala Arg Ile Phe Gln Ser Ile Gln Glu Glu Arg Lys Gln Tyr Asp
690 695 700
Ser Val
705
<210> 3
<211> 18
<212> DNA
<213>artificial sequence
<400> 3
aagttcagcccctaccgt 18
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<400> 4
gaattgcttttgacctatta 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
taatggaaatgccgctacag 20
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 6
tacataccaatgtgctgtaa 20
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<400> 7
ccccggtagacaatttgtca 20
<210> 8
<211> 20
<212> DNA
<213>artificial sequence
<400> 8
caagcaaaacctcgggtgat 20
<210> 9
<211> 49
<212> DNA
<213>artificial sequence
<400> 9
ggggacaagt ttgtacaaaa aagcaggctt aatgaggaga gggaaggat 49
<210> 10
<211> 48
<212> DNA
<213>artificial sequence
<400> 10
ggggaccact ttgtacaaga aagctgggta ctagactgag tcatactg 48
Claims (10)
1. a kind of Mung Bean Blooming gene VrELF3, which is characterized in that it includes nucleotide sequences selected from the group below:
(a) nucleotide sequence shown in sequence table Seq ID NO.1；
(b) nucleotide sequence complementary with the nucleotide sequence of (a)；
(c) there is the nucleotide sequence of at least 50% homology with the nucleotide sequence of (a)；
(d) from the protein of the nucleotide sequence coded same amino acid sequence of (a) but different nucleotides sequences in sequence
Column；
(e) nucleotide sequence of one of following amino acid sequence: amino acid sequence shown in sequence table Seq ID NO.2 is encoded
Column, alternatively, as the substitution of at least one amino acid residue, missing and/or insertion and with shown in sequence table Seq ID NO.2
The different amino acid sequence of amino acid sequence, alternatively, having at least with amino acid sequence shown in sequence table Seq ID NO.2
The amino acid sequence of 50% homology；
(f) active fragment of any one nucleotide sequence of (a)-(e)；Or
(g) nucleotide sequence complementary with any one nucleotide sequence of (a)-(e).
2. Mung Bean Blooming gene VrELF3 as described in claim 1, which is characterized in that the Mung Bean Blooming gene VrELF3 is logical
It crosses and is expressed in plant, to adjust the flowering time of the plant.
3. a kind of protein encoded by Mung Bean Blooming gene VrELF3 as stated in claim 1 or 2, which is characterized in that
Its amino acid sequence is selected from:
(1) amino acid sequence as shown in sequence table SeqID NO.2；
(2) by the amino acid sequence of (1) replace, lack, add and/or be inserted at least one it is amino acids formed have same function
The amino acid sequence of energy.
4. a kind of expression vector containing Mung Bean Blooming gene VrELF3, which is characterized in that the expression vector is will be such as right
It is required that Mung Bean Blooming gene VrELF3 described in 1 or 2 is inserted into Overexpression vector acquired in plant expression vector, open
The promoter for moving corresponding destination gene expression is strong promoter 35S.
5. a kind of host cell containing Mung Bean Blooming gene VrELF3 Overexpression vector, which is characterized in that the host is thin
Born of the same parents are that expression vector as described in claim 4 is transferred to host cell acquired in Agrobacterium tumefaciems.
6. a kind of coded sequence detection method of Mung Bean Blooming gene VrELF3 as stated in claim 1 or 2, feature exist
In comprising following steps:
(1) it takes the young leaflet tablet of the mung bean containing the Mung Bean Blooming gene VrELF3 to be ground into liquid nitrogen, and passes through examination
Agent box extracts total serum IgE；
(2) total serum IgE is extracted, and reverse transcription is full-length cDNA；
(3) using the full-length cDNA as template, pass through the forward primer 5'- in sequence table Seq ID NO.3
Reverse primer 5'-GAATTGCTTTTGACCTATTA-3' in AAGTTCAGCCCCTACCGT-3', sequence table Seq ID NO.4
Forward primer 5'-TAATGGAAATGCCGCTACAG-3' and sequence for first pair of sequencing primer, in sequence table Seq ID NO.5
Reverse primer 5'-TACATACCAATGTGCTGTAA-3' in list Seq ID NO.6 is second pair of sequencing primer, carries out PCR
Reaction amplification；
(4) PCR after reaction, first to amplified matter carry out agarose gel electrophoresis, then by gel reclaims kit progress
Gel extraction is simultaneously sequenced.
7. a kind of Mung Bean Blooming gene VrELF3 as stated in claim 1 or 2 expression in mung bean Different Organs
Detection method, which is characterized in that itself the following steps are included:
(1) root, stem, leaf, flower, the young pod tissue for taking the mung bean containing the Mung Bean Blooming gene VrELF3, extract total serum IgE respectively
And reverse transcription is cDNA；
(2) pass through forward primer 5'-CCCCGGTAGACAATTTGTCA-3' and sequence table Seq in sequence table Seq ID NO.7
Reverse primer 5'-CAAGCAAAACCTCGGGTGAT-3' in ID NO.8 carries out quantitative fluorescent PCR reaction to the cDNA of (1), obtains
Take expression of the Mung Bean Blooming gene VrELF3 in the root of the mung bean, stem, leaf, flower, young pod tissue.
8. a kind of construction method of the expression vector as described in claim 4 containing Mung Bean Blooming gene VrELF3, special
Sign is comprising following steps:
(1) young leaflet tablet of the mung bean containing the Mung Bean Blooming gene VrELF3 is taken, RNA is extracted and reverse transcription is overall length
cDNA；
(2) pass through the forward primer 5'-GGGGACAAGT TTGTACAAAA AAGCAGGCTT in sequence table Seq ID NO.9
Reverse primer 5'-GGGGACCACTTTGTACAAG in AATGAGGAGA GGGAAGGAT-3', sequence table Seq ID NO.10
AAAGCTGGGTACTAGACTGAGTCATACTG-3' carries out PCR amplification by template of the full-length cDNA, obtains PCR product；
(3) gel electrophoresis first is carried out to the PCR product and recycled, then recovery product is exchanged in entry vector, weighed
Group entry vector；
(4) plasmid of the recombination entry vector is extracted, and the VrELF3 genetic fragment is exchanged to the plant to express and is carried
In body, to obtain the Overexpression vector.
9. a kind of genetic transforming method of arabidopsis, which is characterized in that itself the following steps are included:
(1) by the expression vector and Agrobacterium progress ice bath as described in claim 4 containing Mung Bean Blooming gene VrELF3
It mixes, and is converted by electric shocking method；
(2) conversion product is coated on resistance YEP culture medium, and is inverted culture, until growing single colonie；
(3) bacterium colony on resistance YEP culture medium described in picking is cultivated, to the bacterium solution of formation into YEP fluid nutrient medium on shaking table
Culture is carried out until OD600 is greater than 1；
(4) fruit pod for removing the arabidopsis of full-bloom stage, the whole strain of arabidopsis is placed in bacterium solution and is infected；
(5) it takes out the Arabidopsis plant after infecting and carries out shading growth；
(6) Arabidopsis plant after growing shading is placed under illumination and cultivates, and harvest T0 is for seed after seed is mature；
(7) first by the T0 of harvest for being planted in solid medium after seed sterilizing, and dark vernalization is carried out, then by vernalization
Plant afterwards is cultivated under artificial climate, and observes upgrowth situation.
10. a kind of vegetable transformant, which is characterized in that include containing promoter 35S driving on its genome such as claim 1
Or Mung Bean Blooming gene VrELF3 described in 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910757723.9A CN110343159B (en) | 2019-08-16 | 2019-08-16 | Application of expression vector of mung bean flowering gene VrELF3 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910757723.9A CN110343159B (en) | 2019-08-16 | 2019-08-16 | Application of expression vector of mung bean flowering gene VrELF3 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110343159A true CN110343159A (en) | 2019-10-18 |
| CN110343159B CN110343159B (en) | 2021-05-14 |
Family
ID=68185270
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910757723.9A Active CN110343159B (en) | 2019-08-16 | 2019-08-16 | Application of expression vector of mung bean flowering gene VrELF3 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110343159B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112794890A (en) * | 2021-03-25 | 2021-05-14 | 南京农业大学 | Flowering regulatory protein ELF 3-beta and coding gene and application thereof |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000009658A2 (en) * | 1998-08-17 | 2000-02-24 | The State University Of Oregon Acting By And Through The State Board Of Higher Education On Behalf Of The University Of Oregon | Gene regulating circadian clock function and photoperiodism |
| US20070050866A1 (en) * | 2005-08-31 | 2007-03-01 | Tomohiro Kiyosue | Control of hypocotyllength and flowering time by COL8 gene |
| CN101432431A (en) * | 2006-03-07 | 2009-05-13 | 先锋高级育种国际公司 | Compositions and methods for increasing plant tolerance to high population density |
| CN101704885A (en) * | 2009-12-14 | 2010-05-12 | 四川农业大学 | Protein for controlling heading stage and seed size of paddy rice and encoding gene thereof |
| CN102776201A (en) * | 2011-05-09 | 2012-11-14 | 华中农业大学 | Application of OsELF 3 gene in controlling heading stage of paddy rice |
| CN104404043A (en) * | 2014-11-19 | 2015-03-11 | 云南省农业科学院生物技术与种质资源研究所 | Promoter of gene Me094 related to bacterial-blight resistance of Oryza meyeriana |
| CN104561041A (en) * | 2015-01-04 | 2015-04-29 | 中国科学院东北地理与农业生态研究所 | Soybean growth period gene J and encoding protein thereof |
| CN104830849A (en) * | 2015-05-04 | 2015-08-12 | 安徽省农业科学院作物研究所 | Molecular markers of soybean mosaic virus resistant gene (RSC8) and applications thereof |
| WO2017032711A1 (en) * | 2015-08-21 | 2017-03-02 | Gratia Mundi Gmbh | Active combinations, compositions and methods for enhancing hair growth |
| CN108642078A (en) * | 2018-05-18 | 2018-10-12 | 江苏省农业科学院 | Method based on CRISPR/Cas9 gene editing technology selection and breeding Mung Bean Bloomings pollination mutant and special gRNA |
-
2019
- 2019-08-16 CN CN201910757723.9A patent/CN110343159B/en active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000009658A2 (en) * | 1998-08-17 | 2000-02-24 | The State University Of Oregon Acting By And Through The State Board Of Higher Education On Behalf Of The University Of Oregon | Gene regulating circadian clock function and photoperiodism |
| US20070050866A1 (en) * | 2005-08-31 | 2007-03-01 | Tomohiro Kiyosue | Control of hypocotyllength and flowering time by COL8 gene |
| CN101432431A (en) * | 2006-03-07 | 2009-05-13 | 先锋高级育种国际公司 | Compositions and methods for increasing plant tolerance to high population density |
| CN101704885A (en) * | 2009-12-14 | 2010-05-12 | 四川农业大学 | Protein for controlling heading stage and seed size of paddy rice and encoding gene thereof |
| CN102776201A (en) * | 2011-05-09 | 2012-11-14 | 华中农业大学 | Application of OsELF 3 gene in controlling heading stage of paddy rice |
| CN104404043A (en) * | 2014-11-19 | 2015-03-11 | 云南省农业科学院生物技术与种质资源研究所 | Promoter of gene Me094 related to bacterial-blight resistance of Oryza meyeriana |
| CN104561041A (en) * | 2015-01-04 | 2015-04-29 | 中国科学院东北地理与农业生态研究所 | Soybean growth period gene J and encoding protein thereof |
| CN104830849A (en) * | 2015-05-04 | 2015-08-12 | 安徽省农业科学院作物研究所 | Molecular markers of soybean mosaic virus resistant gene (RSC8) and applications thereof |
| WO2017032711A1 (en) * | 2015-08-21 | 2017-03-02 | Gratia Mundi Gmbh | Active combinations, compositions and methods for enhancing hair growth |
| CN108642078A (en) * | 2018-05-18 | 2018-10-12 | 江苏省农业科学院 | Method based on CRISPR/Cas9 gene editing technology selection and breeding Mung Bean Bloomings pollination mutant and special gRNA |
Non-Patent Citations (5)
| Title |
|---|
| GENBANK DATABASE: "PREDICTED: Vigna radiata var. radiata protein EARLY FLOWERING 3 (LOC106762260), mRNA", 《GENBANK DATABASE》 * |
| GENBANK DATABASE: "protein EARLY FLOWERING 3 [Vigna radiata var. radiata]", 《GENBANK DATABASE》 * |
| KEYUAN JIAO等: "Genetic control of compound leaf development in the mungbean (Vigna radiata L.)", 《HORTICULTURE RESEARCH》 * |
| 叶卫军等: "分子标记在绿豆遗传连锁图谱构建和基因定位研究中的应用", 《植物遗传资源学报》 * |
| 魏华等: "植物生物钟及其调控生长发育的研究进展", 《植物学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112794890A (en) * | 2021-03-25 | 2021-05-14 | 南京农业大学 | Flowering regulatory protein ELF 3-beta and coding gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110343159B (en) | 2021-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105949295B (en) | With the albumen and its encoding gene of flowering of plant time correlation and application | |
| CN102724865A (en) | Modified transgene encoding a growth and/or development related protein in plants | |
| CN108949806A (en) | Transgenic plant cells and the method for producing genetically modified plants | |
| CN112626080B (en) | R gene for controlling soybean-rhizobium matching property, protein and application thereof | |
| CN101583713A (en) | Plant having increased yield of seeds | |
| CN110684796B (en) | Method for specifically knocking out soybean lipoxygenase gene by CRISPR-Cas9 and application thereof | |
| CN110066774A (en) | Corn receptoroid kinase gene ZmRLK7 and its application | |
| CN109161553A (en) | A kind of pears transcription factor PbBP and its application | |
| CN105420257A (en) | Application of maize secretory phospholipase A2 gene ZmsPLA2-2 to changes in plant drought resistance properties | |
| CN102964437A (en) | Soybean nuclear factor protein and encoding genes of protein and applications of protein and encoding genes | |
| CN104388448B (en) | A kind of corn phospholipase A_2 gene ZmsPLA2-1 and its application | |
| CN106967728A (en) | A kind of pumpkin adversity gene CmNAC1 and its application | |
| CN107325162A (en) | SPL genes and its application in enhancing Heat Resistance of Plant performance | |
| CN110343159A (en) | A kind of Mung Bean Blooming gene VrELF3 and its application | |
| CN110438133A (en) | A kind of Mung Bean Blooming gene VrFT2a and its application | |
| CN110387376A (en) | A kind of Mung Bean Blooming gene VrFT5a and its application | |
| CN107573411B (en) | Application of wheat TaZIM1-7A protein in regulation and control of crop heading period | |
| CN109748960A (en) | Regulate and control gene and its application of aluminum-resistant poison transcription factor STOP1 albumen | |
| CN116064568A (en) | Alfalfa MsASG166 gene and application thereof in improving drought tolerance of plants | |
| CN102296084B (en) | Use of auxin efflux carrier PINFORMED1 (PIN1) family genes in breeding corn and broomcorn | |
| CN114807168A (en) | Mung bean VrMIB1 gene and application thereof | |
| CN103911386A (en) | Artificial fusion gene for improving stress tolerance of plants | |
| CN114540373A (en) | Gene for reducing cadmium content in rice grains and application thereof | |
| CN106011152A (en) | Transcription factor TFSALT1 for improving salt resistance of rice, and application thereof | |
| CN114457089B (en) | Gene for increasing length of tomato root hair and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |