CN114990156B - Recombinant vector based on RNAi interference sclerotinia sclerotiorum OAH gene, construction method and application thereof - Google Patents

Abstract

The invention discloses a recombinant vector based on RNAi interference sclerotinia sclerotiorum OAH genes, a construction method and application thereof, and particularly relates to the interference of expression, cloning and oxalic acid synthesis and technical application of the OAH genes in the sclerotinia sclerotiorum by RNAi interference technology. The invention separates and clones the key pathogenic protein OAH nucleotide sequence of the sclerotinia sclerotiorum from the sclerotinia sclerotiorum, takes the nucleotide sequence as an interference fragment, and targets and silences the gene expression of the sclerotinia sclerotiorum OAH, and the sequence is shown as SEQ ID NO: 1. The invention verifies the function of RNAi interference sclerotinia sclerotiorum OAH gene. The gene engineering technology is used for silencing the sclerotinia sclerotiorum OAH gene expression, influencing oxalic acid synthesis and accumulation, reducing the area of lesions after the sclerotinia inoculation of transgenic rape leaves and stems, improving the resistance of the transgenic rape to the sclerotinia sclerotiorum, and having important application prospect for enhancing the resistance of the brassica napus to the sclerotinia sclerotiorum.

Description

Recombinant vector based on RNAi interference sclerotinia sclerotiorum OAH gene, construction method and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a recombinant vector based on RNAi interference sclerotinia sclerotiorum OAH genes, and a construction method and application thereof.

Background

Sclerotinia sclerotiorum (Sclerotinia sclerotiorum) is the most important disease restricting rape production. The range of disease treatment is very wide and can be parasitic for more than 75 plants of 278 families and 400 genera, which cause huge economic losses worldwide each year (Boland G., hall R.Index of plant hosts of Sclerotinia sclerotiorum [ J ] Can J Plant Pathol,1994, 16:93-108). Sclerotinia sclerotiorum causes not only yield reduction but also quality degradation of rapes (Zhang Xiaojuan, zhang Yu, hu Shengwu. Sclerotinia sclerotiorum resistance mechanism and disease resistance genetic breeding research progress, molecular plant breeding, 2016,14 (3): 704-711). The current method for preventing and controlling sclerotinia mainly depends on a chemical prevention method and disease-resistant variety breeding, but the chemical prevention method has more defects, such as low prevention effect, difficult spraying in the flowering phase, easy pesticide residue, easy environmental pollution, long time and easy generation of drug resistance of the sclerotinia, thereby reducing the prevention effect of bactericides (Qin Hujiang, chen Fangying, ancient cooking path, sensitivity of sclerotinia sclerotiorum to 10 bactericides and field prevention effect of different medicaments [ J ]. National science and science version of the university of northwest agriculture and forestry science and technology, 2011,39 (7): 117-122). Therefore, the conventional method for preventing and controlling sclerotinia sclerotiorum is insufficient to meet the requirement of rape yield, and the cultivation of sclerotinia sclerotiorum-resistant variety rape by using a molecular breeding technology becomes an important strategy for improving the rape yield.

Sclerotinia is a typical dead-body vegetative phytopathogenic fungus (Hegedus D.D, rimmer S.R.Sclerotinia sclerotiorum: when "to be or not to be" a pathen [ J ]. Ferns Microbiology Letters,2005,251 (2): 177-184). The pathogenesis of sclerotinia is complex, and current research mainly considers that sclerotinia degrades the cell wall of a host by secreting plant cell wall degrading enzymes (Plant cell wall degrading enzymes, PCWDEs), oxalic Acid (OA) is secreted to assist the sclerotinia to infect plants, and other Effector factors (effect) are also involved in the interaction between the sclerotinia and the host. Oxaloacetate hydrolase (OAH) is a key enzyme for the production of oxalic acid (Jarosz Wil kolaz ka A., gadd GM. Oxalate production by wood-rotting fungi growing in toxic metal-amed medium [ J ]. Chemosphere,2003,52 (3): 541-547). In the last step of oxalic acid synthesis, the enzyme is capable of hydrolyzing oxaloacetate to form oxalic acid directly (Dutton MV, evans C.S. Oxalate production by fungi: its role in pathogenicity and ecology in the soil environment [ J ]. Canadian Journal of Microbiology,1996,42 (9): 881-895), and is a characteristic enzyme in fungi. Oxaloacetate hydrolase is also an essential enzyme for research in fungal oxalate metabolism studies.

Godoy et al used ultraviolet mutagenesis of sclerotinia sclerotiorum sporozoites to obtain oxalate deficient mutants with reduced pathogenicity, confirming that oxalic acid plays an important role in sclerotinia sclerotiorum infection (Godoy G., steadman J.R., dickman M.B, dam R.use of mutants to demonstrate the role of oxalic acid in pathogenicity of Sclerotinia sclerotiorum on Phaseolus vulgaris [ J ]]Physiological and Molecular Plant Pathology,1990,37 (3): 179-191). Xu et al used two independent mutagenesis techniques to create oxalate deletion mutants of sclerotinia that accumulate fumaric acid but have reduced acidification capacity to the environment, but whose virulence varies with changes in the pH and buffer capacity of the host tissue. This result demonstrates that sclerotinia secretes oxalic acid in order to create a suitable pH environment. Oxalic acid can sequester free Ca in host cells ²⁺ Blocking plant Ca ²⁺ Signal pathway, inhibiting Ca released during cell wall rupture ²⁺ To protect the growing mycelium from the virulent Ca in the infected area ²⁺ Effect of concentration (Heller A, witt-Geiges T, oxalic acid has an additional, detoxifying function in Sclerotinia sclerotiorum pathogenesis [ J)]PLoS ONE,2013,8 (8): e 72292). Oxalic acid inhibits cellular self-expression of the host plant (Kabbage m., williams b., dickman m.b. cell de ath control: the interplay of apoptosis and autophagy in the pathogenicity of Sclerotinia sclerotiorum PloS [ J.) ]Pathogenens, 2013,9 (4): el 003287), inhibiting the outbreak of Reactive Oxygen Species (ROS) in plants at the beginning of infection (Williams B., kabbage M., kim H.J., britt R., dickman M.B. tipping the balance: sclerotinia sclerotiorum secreted oxalic acid suppresses host defenses by manipulating the host redox environment [ J ]]PloS Pathogens,2011,7 (6): el 002107). In addition, oxalic acid can also affect the opening and closing of stomata of host plants, causing leaf wilting (Rejane L.G., henrik U.S. Oxalate production by Sclerotinia sclerotiorum) deregulates guard cells during infectionl[J].Plant Physiology,2004,136(3):3703-3711)。

Host-induced gene silencing (Host-induced gene silencing, HIGS) is a technique developed by RNA interference, a phenomenon commonly found in nature, found in a variety of organisms such as plants, fungi, insects, zebra fish (Aravin A.A, klenov M.S, vagin V.V, rozovskii, ya M, gvozdev V.A. rotor of double-stranded RNA in eukaryotic gene silencing [ J)]Molecular Biology,2002,36 (2): 180-182). Exogenous or endogenous double-stranded RNA (dsRNA) can trigger specific degradation of homologous mRNA (Fire A.Z., xu S.Q., montgomery M.K., kostas S.A., driver S.E.potential and specific genetic interference by double-stranded RNA in Caenorhabditis elegans [ J.) ]Nature,1998,391 (6669):806-811), the phenomenon of silencing the expression of this gene is called RNA interference (RNAi). Since this phenomenon does not affect the expression of the gene, it is also known as post-transcriptional gene silencing (post transcriptional gene silencing, PTGS) (Aravin A.A., klenov M.S., vagin V.V., rozovskii, ya M., gvozdev V.A.rotor of double-stranded RNA in eukaryotic gene silencing [ J.)]Molecular Biology,2002,36 (2): 180-182). Studies have shown that plant pathogenic fungi target the transport of sRNA of plant immune related genes into plants, interfering with the immune response of the plants. After infection of arabidopsis with botrytis cinerea, botrytis cinerea Bc-sir3.2 can be loaded onto AG01 and target MPK2 and MPK1 of plants, interfere with expression of these genes, inhibit immune responses of plants in which MPK2 and MPK1 are involved to fungal pathogens (Weiberg A.s Wang m, lin f.m., zhao h., zhang, et al, fungal small RNAs suppress plant immxjnity by hijacking host RNA interference pathways J]Science,2013, 342:118-123). Expression of sRNA targeting Bc-DCL and Be_DCL2 in Arabidopsis and tomato by Wang et al silences the Bc-DCL gene and attenuated fungal pathogenicity while inhibiting fungal growth (Zhang T., zhao Y.L., zhao J-H., wang S.jin Y., et al cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen [ J. ]Nature Plants,2016,2 (10): 16-53). Cai et al found that host Arabidopsis cells secrete extracellular vesicles to introduce sRNA into mycosesProtogray staphylococci, where vesicles containing sRNA accumulate at the site of infection and are taken up by fungal cells, the transferred host sRNA induces pathogenically critical fungal gene silencing (Cai Q., qiao L.L., wang M., he B.Y., mao F.L.plants smd small RNAs in extracellular vesicles to fungal pathogen to silence virulence genes [ J.)]Science,2018,360 (6393):1126-1129). Recently, researchers have used HIGS technology to express RNAi constructs of sclerotinia Sschs in tobacco, and found that the sclerotinia resistance of transgenic T1-generation tobacco is significantly enhanced (Andradecm, tinoco m.l.p., riethaf, mia Fco,FJL.Host-induced gene silencing in the necrotrophic fungal pathogen Sclerotinia sclerotiorum[J]plant Pathology,2016,65 (4): 626-632.). Transgenic wheat lines expressing RNAi constructs against the MAP kinase gene (PsFUZ 7) were produced by researchers and demonstrated to be significantly resistant to the rust gene Pst (Zhu X., qi T., yang Q., et al host-Induced Gene Silencing of the MAPKK Gene PsFUZ7 Confers Stable Resistance to Wheat Stripe Rust [ J.)]Plant Physiol,2017,175 (4): 1853-1863.) 2018, siRNA against the protein kinase A (PsCPK 1) catalytic subunit gene was also produced in transgenic wheat, and resistance to fungal Pst was observed in fourth generation wheat, and indicated that the cAMP signaling pathway gene was down-regulated (QIT., zhu X., tan C., et al host-induced gene silencing of animportant pathogenicity factor PsCPK1 in Puccinia striiformis f.sp.tritici enhances resistance of wheat to stripe rust [ J. ].Plant Biotechnol J,2018,16(3):797-807.)。

In conclusion, RNAi interferes with the accumulation of sclerotinia oxalate by using the sclerotinia pathogenic key gene OAH, so that the toxicity of the sclerotinia to brassica napus is reduced. However, studies on the utilization of RNAi to interfere with the pathogenic key gene OAH of sclerotinia are not in depth at present, and the OAH gene function report of other fungi is few, so that the effect on other crops is not clear.

Disclosure of Invention

In view of the above, the application provides a recombinant vector based on RNAi interference sclerotinia sclerotiorum OAH gene, a construction method and application thereof, and the resistance of brassica napus to sclerotinia is improved.

In order to achieve the technical purpose, the application adopts the following technical scheme:

in a first aspect, the application provides a recombinant vector which is pCAMBIA1301-D35s-SsOAH-NOS, the recombinant vector comprising the amino acid sequence of SEQ ID NO:1, and the interference nucleotide sequence of the sclerotinia sclerotiorum OAH gene.

Preferably, the construction process is as follows: double enzyme digestion is carried out at KpnI and SpeI enzyme digestion sites of a vector pCAMBIA1301, pathogenic genes OAH of sclerotinia sclerotiorum are connected with Link fragments, and the obtained forward interference fragments and reverse interference fragments are connected with a recovered pCAMBIA1301 linear vector plasmid to obtain a recombinant vector.

In a second aspect, the application provides the use of a recombinant vector for combating sclerotinia rot of colza.

Preferably, the recombinant vector is used to construct a transgenic strain of ss.oah.rnai.

Preferably, the recombinant vector is used to interfere with accumulation of sclerotinia oxalate.

Preferably, the application method comprises the following steps:

according to SEQ ID NO:1, constructing a recombinant vector pCAMBIA1301-D35s-SsOAH-NOS;

transferring the obtained recombinant vector into microorganism for culturing and expressing, and transforming target plants by an infection method to obtain a resistance transgenic strain.

Preferably, the application method comprises the following steps:

according to SEQ ID NO:1, constructing a recombinant vector pCAMBIA1301-D35s-SsOAH-NOS;

transferring the obtained recombinant vector into agrobacterium GV3101, transforming cabbage type rape by using agrobacterium infection method, and identifying transgenic strain by using PCR;

identifying ss.oah expression levels by qPCR;

transgenic lines of ss.oah.rnai were grown.

In a third aspect, the application provides a method of increasing resistance of canola to sclerotinia, the method comprising introducing into the canola an interfering fragment of a sclerotinia pathogenic gene OAH, wherein the nucleotide sequence of the gene OAH is shown in SEQ ID No. 1.

The beneficial effects of the application are as follows:

1. although a plurality of sclerotinia sclerotiorum pathogenic secretion proteins are cloned in rape, researches on disease resistance function are carried out on the sclerotinia sclerotiorum pathogenic secretion proteins by researchers, but few reports are still available in the field of sclerotiorum resistance of cabbage type rape by utilizing RNAi technology, and the research on sclerotinia resistance of cabbage type rape by adopting RNAi technology is enriched by utilizing RNAi interference sclerotinia sclerotiorum OAH genes;

2. The OAH interference vector cloned in the invention provides new genetic resources for disease-resistant breeding of other crops, and has guiding and reference functions for improving the resistance of other crops to sclerotinia rot;

3. the SS.OAH.RNAi transgenic strain obtained after the transformation of rape by the interference vector pCAMBIA1301-D35s-SsOAH-NOS constructed by the invention is researched from the aspect of the functional acquisition of OAH, provides a raw material for researching the disease resistance function of cabbage type rape by interfering the accumulation of sclerotinia oxalate, and has important significance;

4. through a series of researches on the SS.OAH.RNAi transgenic strain in the aspect of resisting the sclerotinia, the invention fully proves that the sclerotinia sclerotiorum OAH participates in the infection of the sclerotinia to the plant and plays an important role. By interfering the expression of the sclerotinia sclerotiorum OAH gene, the accumulation of oxalic acid in a plant body can be reduced, and the resistance of the plant to sclerotinia sclerotiorum can be improved. Has important significance for elucidating the biological functions of the sclerotinia sclerotiorum OAH gene;

5. the discovery of the sclerotinia sclerotiorum OAH gene after transcription has important theoretical guiding significance for exploring and identifying crop sclerotinia sclerotiorum resistance genes and deeply discussing molecular action mechanisms of the sclerotinia sclerotiorum resistance genes;

6. the breeding of sclerotinia-resistant rape materials is always valued by rape breeders, and RNAi interferes with the development and utilization of sclerotinia sclerotiorum OAH, so that the sclerotinia-resistant rape materials can be helpful to solve the sclerotinia-resistant rape problems in production. The great loss of rape yield and quality caused by sclerotinia in current production makes the breeding of disease-resistant varieties particularly important, and the RNAi interference sclerotinia OAH technology is beneficial to cultivating high-resistance rape varieties, and provides theoretical and practical basis for the application of the RNAi interference sclerotinia OAH gene in the aspect of sclerotinia resistance of main oil crops (rape); provides a new breeding material for further cultivating rape varieties with sclerotinia resistance; has important practical guiding value in the breeding practice, variety improvement and variety popularization of crop sclerotinia resistance.

Drawings

FIG. 1 is a schematic diagram of the construction process of the transformation vector pCAMBIA1301-D35s-SsOAH-NOS of the present invention;

FIG. 2 is an Agrobacterium-mediated genetic transformation system for the hypocotyl of Brassica napus;

FIG. 3 is a positive seedling identification of RNAi interfering with the Sclerotinia sclerotiorum virulence gene OAH transgene strain;

FIG. 4 is an identification of in vitro leaf inoculation resistance to sclerotinia by ss.OAH.RNAi transgenic lines;

FIG. 5 is an identification of the in vivo stalk grafting resistance of ss.OAH.RNAi transgenic lines to sclerotinia;

FIG. 6 shows analysis of OAH gene expression levels at various stages after inoculation of the Sclerotinia sclerotiorum with in vitro leaf blades of wild-type and SS.OAH.RNAi transgenic lines;

FIG. 7 is a verification experiment of leaf blade extract culture of wild type canola and ss.OAH.RNAi transgenic lines.

Detailed Description

The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.

The invention constructs an interference vector with RNAi interference function and affecting the resistance of cabbage type rape to sclerotinia. The method for improving the sclerotinia sclerotiorum resistance of the brassica napus by utilizing the sclerotinia sclerotiorum oxalate to interfere the synthesis of the sclerotinia sclerotiorum oxalate, for example, the method for improving the sclerotinia sclerotiorum resistance of the brassica napus by utilizing transgenes, and the method provides new genetic resources for sclerotinia sclerotiorum-resistant breeding of the brassica napus.

In the application, the applicant finds that after stress treatment is carried out on sclerotinia cabbage type rape, the expression level of an OAH gene in pathogenic secretion proteins secreted by the sclerotinia is obviously up-regulated, and the resistance of an SS.OAH.RNAi transgenic material obtained by genetic transformation to the sclerotinia is obviously enhanced, so that the result has important application prospect in the aspects of enhancing the sclerotinia resistance and improving the yield of rapes.

The nucleotide sequence of the sclerotinia sclerotiorum OAH gene is shown in SEQ ID NO.1 (sequence 1), and the protein sequence coded by the sclerotinia sclerotiorum OAH gene is shown in SEQ ID NO:2 (sequence 2), the sequence numbers of the present application are numbered from below in the order of appearance, the starting number is 3, and the description thereof will be omitted.

The specific scheme is as follows:

the application finds that the gene plays a key role in the process of infecting plants by analyzing the reported functional infectivity of the OAH gene in sclerotinia sclerotiorum (Wu J, zhao Q, yang Q, liu H, li Q, yi X, cheng Y, guo L, fan C, zhou Y.Corrimgenum: comparative transcriptomic analysis uncovers the complex genetic network for resistance to Sclerotinia sclerotiorum in Brassica napus [ J ]. Sci Rep, 7 (2) 21;7:42829.Lyu X, shen C, fu Y, xie J, jiang D, li G, et al A Small Secreted Virulence-Related Protein Is Essential for the Necrotrophic Interactions of Sclerotinia sclerotiorum with Its Host Plants [ J ], PLoS Pathog,2016,12 (2): e 1005435), but has not been studied intensively in the RNAi interference field. Obtaining a nucleotide sequence of an OAH gene of the sclerotinia sclerotiorum through NCBI, analyzing a CDS region sequence of the OAH gene, and designing a Primer by using biological software Primer Premier5, wherein the nucleotide sequence of the OAH gene of the sclerotinia sclerotiorum is shown as SEQ ID NO:1.

The construction method of the interference vector pCAMBIA1301-D35s-SsOAH-NOS is as follows: extracting RNA (using) from sclerotinia sclerotiorum dark-cultured on PDA medium at 20-22deg.C for 36 hrSuper Total RNA extraction kit, from Promega, USA), using reverse transcriptase [ about ]>II Q RT SuperMix for qRNA (+gDNA wind) kit, available from VazymeThe cDNA is synthesized by reverse transcription, and the reaction conditions are as follows: 42 ℃ 2min,50 ℃ 15min,85 ℃ 5sec. The cDNA is used as a template, a proper target gene interference sequence is selected, and the OAH interference fragment and the intermediate link sequence fragment are subjected to PCR amplification by using primers OAH-sF (5'-CGGGGTACCGGATACGGTGGACCTCTCATTG-3') and OAH-ovlapsR (5'-GTGCACGCGTACGTAAGGTTGTGGTGATGATAGGAGTAGCGC-3'). The PCR amplification reaction procedure was: pre-denaturation at 94℃for 5min;94℃30sec,56℃30sec,68℃40sec,32 cycles; extending at 68℃for 5min and at 25℃for 1min. The forward interference fragment was ligated together with the intermediate link sequence using primers OAH-asF (5'-ACGCGTCGACGTGGTGATGATAGGAGTAGCGC-3') and OAH-asR (5'-CGGACTAGTGGATACGGTGGACCTCTCATTG-3') by PCR overlap extension techniques, followed by 45sec extension in accordance with the previous procedure. The desired fragment is then recovered by agarose gel electrophoresis. Cloning the interference fragment to a pEasy-Blunt vector and converting the interference fragment to escherichia coli DH5 alpha, selecting a clone, performing bacterial liquid PCR detection, wherein the PCR procedure is as follows: pre-denaturation at 98℃for 3min;94℃for 30sec,58℃for 30sec,72℃for 30sec,30 cycles; extending at 72℃for 4min and at 25℃for 1min, positive forward interference cloning vector (OAH-s-l) and reverse interference cloning vector (OAH-as) were obtained.

Further, the applicant selected a KpnI and SpeI cleavage site double-digested pCAMBIA1301 vector plasmid and recovered the linear vector plasmid. After the Ri02s-W vector is digested by KpnI and SalI, the corresponding exogenous fragment is recovered through TA after the Ri02as vector is digested by SalI and SpeI, and the exogenous fragment is connected with the recovered linear vector plasmid by using T4DNA ligase. The ligation product was used to transform E.coli competent cells. And selecting the cloned seeds, and performing PCR detection on the bacterial liquid to determine positive cloned seeds. The length of the obtained PCR product is about 700bp, and bacterial liquid positive detection primer DsF (5 ' -TAGCCACCCAAGAAACTGCT-3) and DsR (5'-ATTGATCA GCCTAACCAAAC-3') are used for obtaining interference vector pCAMBIA1301-D35s-SsOAH-NOS.

The constructed interference vector pCAMBIA1301-D35s-SsOAH-NOS was transformed into the hypocotyl of Brassica napus Westar by infection of the hypocotyl of Brassica napus by means of Agrobacterium-mediated genetic transformation until a material differentiated into seedlings was obtained (FIG. 2). Wild type brassica napus is extracted by a 2 XCTAB method as a control and transgenic brassica napus strain leaf genome DNA, link sequence primers Link-ovlapF (5'-AACCTTACGTACGCGTGCAC-3') and Link-salR (5'-ACGCGTCGACCACTGAATTGAATTGTTTAAGG-3') on a carrier are used for PCR amplification, 37 positive plants are screened, and the line numbers are 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 25, 26, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 and 47 positive plants respectively (partial PCR results are shown in FIG. 3).

The wild cabbage type rape control (WT) and ss.OAH.RNAi transgenic lines (R18, R25, R36) were respectively identified for the seedling stage in vitro leaves and the live sclerotinia stalk pieces, with the onset usually being most pronounced 36 hours (36 hpi) after inoculation. The sclerotinia sclerotiorum disease index is counted when the onset is remarkable, and specific methods refer to methods for identifying the sclerotinia sclerotiorum resistance of Brassica napus of Wu Jian et al (Wu J., zhao Q., yang Q., et al, comparative transcriptomic analysis uncovers the complex genetic network for resistance to Sclerotinia sclerotiorum in Brassica napus [ J ]. Scientific reports,2016, 6:19007). The disease finger statistical result shows that the disease spot area is obviously lower than that of wild type, namely non-transgenic rape (WT for short) in the period of most obvious disease of the SS.OAH.RNAi transgenic strain in 36h inoculation, the identification result of the in vitro leaf inoculation resistance of the SS.OAH.RNAi transgenic strain to sclerotinia is shown in FIG. 4, and the A graph in FIG. 4 shows the disease phenotype of the WT and the in vitro leaf inoculation of the SS.OAH.RNAi transgenic strain in 36h in seedling stage; panel B in FIG. 4 corresponds to the lesion size of the leaves of the WT and SS.OAH.RNAi transgenic lines of FIG. 4A after 36h of infection by sclerotinia. WT and R25, R18, R36 represent the inoculation of sclerotinia with wild-type and SS.OAH.RNAi transgenic lines, respectively. The results show that: the hypha extension area of the leaves of the ss.oah.rnai transgenic strain is obviously smaller than that of the wild-type control material, which indicates that after RNAi interferes with the sclerotinia sclerotiorum OAH gene, the resistance of the leaves of the transgenic plant to sclerotinia sclerotiorum is enhanced. After 4d of live stalk inoculation of the SS.OAH.RNAi transgenic resistant strain, the diameter of the lesion is obviously lower than that of a wild type, and the lesion diameter is shown in FIG. 5, which is the identification of the resistance of the SS.OAH.RNAi transgenic strain to the live stalk inoculation of sclerotinia, and the A graph in FIG. 5 is the onset phenotype of the WT and the live stalk inoculation of the SS.OAH.RNAi transgenic strain in the mature period after 4 d; panel B in FIG. 5 corresponds to the diameter of lesions of panel A in FIG. 5 after 4d infection of the stems of the WT and SS.OAH.RNAi transgenic lines by Sclerotinia. WT and R18, R25, R36 represent the inoculation of sclerotinia with wild-type and SS.OAH.RNAi transgenic lines, respectively. The results show that: the diameter of the lesion after 4d of the live stalk inoculation of the SS.OAH.RNAi transgenic strain is obviously smaller than that of a wild control material, which shows that after RNAi interferes with the sclerotinia OAH gene, the resistance of the transgenic plant stalk to sclerotinia is enhanced. The above demonstrates that ss.oah.rnai transgenic canola plants are capable of increasing the level of resistance of canola to sclerotinia.

And (3) inoculating sclerotinia sclerotiorum blocks for 24h, 36h, 48h, 60h and 72h, taking lesion tissue hyphae of WT and SS.OAH.RNAi transgenic plants, extracting sclerotinia sclerotiorum hyphae RNA of the WT and the SS.OAH.RNAi transgenic plants, reversely transcribing the RNA into cDNA, and analyzing the expression quantity of SsOAH genes. The results show that the expression level of OAH genes in the SS.OAH.RNAi transgenic strain is lower than that of WT, as shown in the wild type and the SS.OAH.RNAi transgenic strain in FIG. 6, and the OAH gene expression level analysis is carried out at each period after the isolated leaves of the SS.OAH.RNAi transgenic strain are inoculated with sclerotinia, wherein the OAH genes in the mycelium at the lesion site are detected by taking lesion tissues of the WT and the SS.OAH.RNAi transgenic strain when the isolated leaves of the SS.OAH.RNAi transgenic strain are inoculated with sclerotinia for 24h, 36h, 48h, 60h and 72h, and the result shows that after RNAi interferes with the OAH genes of the sclerotinia, the OAH genes in the mycelium at the lesion site of transgenic rape are influenced, so that the transgenic material possibly resists invasion of external pathogenic bacteria by reducing the OAH expression in the mycelium of the sclerotinia. Further detecting whether the resistance to sclerotinia disease is caused by interference of RNAi with OAH, preparing a PDA culture medium after extracting wild type and transgenic rape tissues, observing the expansion condition and the expansion area of hyphae after inoculating sclerotinia for 40h, and the result shows that the expansion area of the PDA hyphae prepared from the transgenic material is obviously smaller than that of the wild type, and obviously inhibiting the expansion of sclerotinia; further observing the expansion condition of sclerotinia mycelium under a split microscope, finding that the mycelium growth state on a PDA culture medium made of a transgenic material is shorter than that of a wild type, and the mycelium has fewer branches and abnormal growth, wherein the diagram A in fig. 7; for the PDA culture medium prepared after extracting the wild type and transgenic rape tissue extract, the PDA blank control culture medium, the wild type prepared culture medium and the transgenic strain prepared culture medium are observed, and the sclerotinia sclerotiorum mycelium 40h mycelium expansion and growth conditions and expansion area statistics are inoculated. Reference numerals illustrate: mock is PDA medium without plant extract added, and is blank control; 36h: hypha expansion size after 36h inoculation of sclerotinia hypha blocks; 48h, inoculating sclerotinia mycelium block for 48h, and expanding mycelium. As a result, the expansion area of the sclerotinia sclerotiorum mycelium cultured by a PDA culture medium prepared from the extracting solution of the transgenic materials (R18, R25 and R36) is obviously smaller than that of a wild type, and the expansion area is respectively reduced by 35.29%, 21.98% and 31.53%; compared with the wild type, the hypha growth state is shorter in expansion length, fine in hypha, less in branches and abnormal in hypha growth, wherein the hypha cultured by the R18 and R36 strains breaks in the growth process, and the hypha growth state is abnormal. The method is characterized in that the growth-hindered mycelium on the PDA culture medium added with the transgenic plant leaf extract is inoculated to wild rape for further detection of pathogenicity, compared with mycelium cultured by the wild rape, after the mycelium inoculated with the transgenic material infects wild rape 36H and 48H, the area of lesion is smaller than that of the wild rape, the result shows that the growth and the expansion of sclerotinia mycelium are influenced by the interference of oxalic acid synthesis, the further shows that the mycelium growth possibly is due to the interference of RNAi in the transgenic material in vivo and the synthesis of OA in pathogenic bacteria, and the pathogenicity is further observed by inoculating the sclerotinia mycelium blocks cultured by the PDA culture medium added with the WT and the transgenic plant extract to the wild rape leaf, as shown in a diagram B in fig. 7. As a result, compared with the sclerotinia sclerotiorum inoculated with the wild-type rape extract, the sclerotinia sclerotiorum inoculated with the transgenic material extract is obviously reduced in lesion area compared with the wild-type rape after 36h and 48h infection, and the results show that: ss.oah.rnai transgenic canola is capable of limiting the growth and expansion of sclerotinia hyphae, affecting the pathogenic ability of sclerotinia. Further shows that RNA interference oxalic acid synthesis can influence the growth and expansion of sclerotinia hyphae and limit the pathogenicity of sclerotinia. The achievement has important significance for cultivating rape disease-resistant strains.

According to the application, the OAH gene with stronger pathogenicity is screened out by analyzing the expression quantity of the pathogenicity effector protein secreted when the sclerotinia sclerotiorum infects rape, the OAH interference fragment is amplified from the sclerotinia sclerotiorum cDNA, the gene interference sequence is connected to the sequence screened out from the brassica napus Westar, and the sclerotinia sclerotiorum (Sclerotinia sclerotiorum) is inoculated, so that the function of the sclerotinia sclerotiorum in the sclerotinia sclerotiorum resistance is rapidly identified.

The application separates and clones the key pathogenic protein OAH nucleotide sequence of the sclerotinia sclerotiorum from the sclerotinia sclerotiorum, takes the nucleotide sequence as an interference fragment, and targets and silences the gene expression of the sclerotinia sclerotiorum OAH, and the sequence is shown as SEQ ID NO: 1. The application verifies the function of RNAi interference sclerotinia sclerotiorum OAH gene. The gene engineering technology is used for silencing the sclerotinia sclerotiorum OAH gene expression, influencing oxalic acid synthesis and accumulation, reducing the area of lesions after the sclerotinia inoculation of transgenic rape leaves and stems, improving the resistance of the transgenic rape to the sclerotinia sclerotiorum, and having important application prospect for enhancing the resistance of the brassica napus to the sclerotinia sclerotiorum.

The present embodiment will be described below by way of specific examples.

Example 1

Construction of RNAi interference vector: sclerotinia sclerotiorum mycelia RNA was extracted from the lesion site using a Fungal Total RNA Isolation Kit fungus total RNA extraction kit (available from Biotechnology (Shanghai) Co., ltd.) which was dark-cultured on PDA medium at 20-22℃for 36 hours, and after the completion of the RNA extraction, the RNA was treated with DNaseI (available from Promega Co., ltd.) and the RNA integrity was detected by electrophoresis on 1.2% (w/V) agarose gel (EtBr) (5V/cm). The determination of the nucleic acid concentration was carried out on an IMPLENANONO Photometer-N50 series ultra-micro ultraviolet spectrophotometer (Germany). RNA260/280 ratio between 1.9 and 2.1, 260/230 ratio greater than 2.0, concentration greater than 500 ng/. Mu.L RNA for the next step of analysis.

cDNA is synthesized byII Q RT Super Mix for qRNA (+gDNA wind) kit (available from Vazyme Corp., china) was prepared by mixing 1. Mu.g of total RNA as a template with 4. Mu.L of 4 XgDNA wind Mix, DEPC-water, and quenching on ice for 2-3min at 42℃in a total volume of 16. Mu.L; then addMix 5X Hiscript II qRT Super Mix II. Mu.L and total volume 20. Mu.L; then, the cDNA was diluted to 200. Mu.L at 50℃for 15min at 85℃for 5sec and stored at-20℃for use.

According to the sclerotinia sclerotiorum OAH sequence information published on NCBI, the appropriate interference fragments were selected as follows: GGATACGGTGGACCTCTCATTGTTGACAAAGCCGTCAAGGCCTACATCAGAGCCGGTGTTGCTGGATTCCATATCGAAGATCAAATTCAAAACAAGCGTTGTGGCCATCTTGCAGGCAAGAAGGTTGTCCCTGAAGAAGAGTACTACATGAGAATTCGTGCCGCCAAGGGTGCCAAAGATGCCATGAAATCCGATATTGTGTTGATTGCACGCACAGATGCGCTCCAACAACTTGGTTATGATGAGTGCGTCAAACGTTTGAAGGTTGCTCGTGAGCTTGGTGCAGATGTTGGCTTGCTCGAGGGTTACACTTCAAAGGAGATGGCTGCAAAGACTGTTAAGGAGTTCGCCCCATGGCCAATACTTTTGAACATGGTCGAGAACGGCGCTACTCCTATCATCACCAC.

The Primer Premier 5.0 software was used to design the interference fragment primers as follows: designing interference fragment primers OAH-sF (5'-CGGGGTACCGGATACGGTGGACCTCTCATTG-3') and OAH-ovpepsR (5'-GTGCACGCGTACGTAAGGTTGTGGTGATGATAGGAGTAGCGC-3'), amplifying by using TransTaq HiFi DNA Polymerase (full gold (Beijing) biological company), and amplifying an intermediate link sequence fragment, wherein the PCR amplification program is 94 ℃ for 5min;94℃30sec,56℃30sec,68℃40sec,32 cycles; extending at 68℃for 5min and at 25℃for 1min. The forward interference fragment was then ligated together with the intermediate link sequence using primers OAH-asF (5'-ACGCGTCGACGTGGTGATGATAGGAGTAGCGC-3') and OAH-asR (5'-CGGACTAGTGGATACGGTGGACCTCTCATTG-3') by PCR overlap extension techniques, which were identical to those described previously, with 45sec extension. The target fragment was then recovered by agarose gel electrophoresis, and the ligation and transformation were performed with reference to the UNIQ-10 column DNA gel recovery kit (division of bioengineering (Shanghai)). The connection system of the target fragment and the T vector is as follows: 4.5. Mu.L of the fragment of interest, 0.5. Mu.L of pMD-18T vector, 5. Mu.L of Solution I (Takara Bio Inc.) were ligated overnight at 16 ℃.

Converting the connection product by thermal excitation, cloning the interference fragment into a pEasy-Blunt vector and converting the interference fragment into escherichia coli DH5 alpha, coating bacterial liquid on an LB solid flat plate containing 100mg/L Amp antibiotics, selecting a monoclonal after about 10-12 hours of growth, and performing bacterial liquid PCR detection, wherein the PCR program is as follows: pre-denaturation at 98℃for 3min;94℃for 30sec,58℃for 30sec,72℃for 30sec,30 cycles; extending at 72℃for 4min and at 25℃for 1min, positive forward interference cloning vector (OAH-s-l) and reverse interference cloning vector (OAH-as) were obtained. The plasmid pCAMBIA1301 vector was double digested with KpnI and SpeI cleavage sites, and the linear vector plasmid was recovered by gel. The Ri02s-W vector is digested by KpnI and SalI, the corresponding exogenous fragments are recovered through TA after the Ri02as vector is digested by SalI and SpeI, and the products are connected with the recovered linear vector plasmid by using T4 DNA ligase to be electrically transformed into competent cells of the escherichia coli. And selecting the cloned seeds, and performing PCR detection on the bacterial liquid to determine positive cloned seeds. The length of the obtained PCR product is about 700bp, and bacterial liquid positive detection primer DsF (5 ' -TAGCCACCCAAGAAACTGCT-3) and DsR (5'-ATTGATCAGCCTAACCA AAC-3') are used for obtaining interference vector pCAMBIA1301-D35s-SsOAH-NOS. The interfering carrier bacteria resistance was kanamycin and the plant resistance was hygromycin.

Example 2

Ss.oah.rnai transgenic canola plant acquisition:

(1) Genetic transformation of rape

As shown in FIG. 2, the agrobacterium-mediated genetic transformation system of the hypocotyl of the brassica napus, wherein the graph A in FIG. 2 shows that the brassica napus westar seeds sterilized by 0.1% mercuric chloride are sown on a 1/2MS culture medium for germination; panel B in FIG. 2 shows a yellowish hypocotyl which grows by dark culture at 24℃for about 5 days; panel C of FIG. 2 shows that the yellowing hypocotyl is cut into small pieces of about 0.8cm under aseptic conditions and placed in Agrobacterium GV3101 containing the transformation vector for infection; panel D in FIG. 2 shows dark culture of hypocotyl into M1 medium for 48h after infection; FIG. 2E shows that the explants after co-cultivation are placed in M2 medium and selectively cultivated for 15-20d by 16h illumination/8 h dark cultivation period; FIG. 2F shows that the explants after selective culture are placed in an M3 culture medium and subjected to selective culture for more than 15 days through 16h illumination/8 h dark culture period until budding; FIG. 2 is a graph showing that explants after budding by differentiation are placed in fresh M3 medium and subjected to selective differentiation culture for more than 15 days through 16h illumination/8 h dark culture period until differentiation into seedlings; panel H in FIG. 2 shows seedlings rooting on M4 medium.

Recombinant plasmids (i.e.interfering vectors) were obtained by conventional Agrobacterium hypocotyl infection

pCAMBIA1301-D35s-SsOAH-NOS is transferred into agrobacterium GV3101, and is screened and differentiated into seedlings, and the specific steps are as follows:

a. sowing: washing wild cabbage type rape seeds with 75% alcohol for 1min, washing the seeds with 0.1% mercuric chloride solution for 5min, and washing the seeds with sterile water for 5 times; the seeds were placed in M0 solid medium (MS inorganic salt and trace elements 4.404g/L in 1962 formulation, pH was adjusted to 5.8-5.9, agar 7g/L was added and sterilization was performed according to conventional high pressure steam sterilization method) with sterilized forceps, and the inoculated seeds were dark-cultured at 24℃for 5 days.

b. Activation of agrobacterium: 3 days after sowing, agrobacterium strain GV3101 stored at-80℃was streaked on LB solid medium containing rifampicin (50 mg/mL), gentamicin (50 mg/mL) and kanamycin (50 mg/mL), and cultured at 28℃for 16 hours. Single colonies were picked and grown to log phase in 5mL LB liquid medium containing rifampicin (50 mg/mL), gentamicin (50 mg/mL) and kanamycin (50 mg/mL), at 28℃with shaking at 200rpm for 20-24 h. 500uL of the cultured bacterial liquid is taken and cultured in 50mL of LB liquid medium (containing three antibiotics) for about 12 hours in an enlarged mode.

c. Preparation of an infectious microbe liquid: pouring the activated agrobacterium liquid into 2 sterile centrifuge tubes of 50mL, centrifuging at 3500rpm for 15min, removing the supernatant, placing on ice, sterilizing with 1mL of DM liquid culture medium (Murashige and Skoog, MS inorganic salt and trace element of 1962 formula of 4.404g/L, sucrose of 30g/L, adjusting pH of the culture medium to 5.8-5.9,121 ℃ C. For 20min, adding 2, 4-D1 mg/L, AS100mmol/L and KT 0.3mg/L into a sterile operation table after sterilization, cleaning the bacterial liquid, centrifuging, removing the supernatant, and adding 2-3mL of DM liquid culture medium to resuspend the bacterial body to make the OD600 of the infected bacterial liquid about 0.6.

d. Infection of explants: placing the infectious microbe liquid in the step c on ice, cutting hypocotyls (the length of each hypocotyl is preferably 0.8-1.0 cm) of the dark-cultured brassica napus seedlings in the step a by using a dissecting knife, transferring the cut hypocotyls into a plate filled with the infectious microbe liquid by using sterile forceps, and infecting for 15-30min (shaking every 3 min) according to the concentration of the bacterial microbe liquid.

e. Co-cultivation: transferring the infected explant to a plate (to be sterilized in advance) with filter paper, sucking up the infection liquid visible on the surface of the explant, transferring to M1 solid co-culture medium (Murashige and Skoog, MS inorganic salt and trace element 4.404g/L in 1962 formula, mannitol 18g/L, sucrose 30g/L,2, 4-D2 mg/L, KT 0.3mg/L, adjusting pH of the culture medium to 5.8-5.9, adding agar 7g/L, sterilizing, adding into 100mmoL/L AS), and culturing at 24deg.C for 40-48h.

f. Screening: transferring the co-cultured explant to M2 solid selection medium (Murashige and Skoog, MS inorganic salt and trace element 4.404g/L with 962 year formula, mannitol 18g/L, sucrose 30g/L,2, 4-D2 mg/L, KT 0.3mg/L, adjusting pH of the medium to 5.8-5.9, adding agar 7 g/L), and performing screening culture for 20 days, wherein the conditions are as follows: culturing at 24deg.C for 16 hr under light/8 hr.

g. And (3) differentiation culture: transferring the selected explant to M3 solid differentiation medium (Murashige and Skoog, MS inorganic salt and trace element 4.404g/L in 1962 formula, glucose 10g/L, xylose 0.25g/L, yeast extract (MES) 0.6g/L, regulating pH of the medium to 5.8-5.9, adding agar 7g/L, sterilizing, adding Zeatin (ZT) 2mg/L, IAA 0.1mg/L, (Chinese name) TMT 250mg/L, kan25 mg/L), starting differentiation culture, and repeating every 15-20 days until differentiation bud (culture condition is consistent with the selection condition in step f).

h. Rooting culture: after obvious growth points can be found on the differentiated bud seedlings, the seedlings are carefully cut off by a scalpel at the position where the callus and the buds are connected (the growth points must not be damaged in the operation process), then the seedlings are transferred to an M4 solid medium (Murashige and Skoog, MS inorganic salt and trace elements 2.202g,sucrose 10g/L in 1962 formula, IBA 0.5mg/L, pH of the medium is adjusted to 5.8-5.9, agar 7g/L is added, TMT 250mg/L and Kan25mg/L are added for rooting after sterilization).

(2) Identification of transgenic plants

a. Extraction of cabbage type rape leaf genome DNA

DNA extraction was performed using the conventional CTAB method. The method comprises the following specific steps: taking tender cabbage type rape leaves with the length of 1-2 cm, placing the tender cabbage type rape leaves into a mortar pre-cooled in advance, adding 2-3 times of liquid nitrogen in the middle, grinding the tender cabbage type rape leaves into fine slurry, and turning the tender cabbage type rape leaves Transfer to a 1.5mL centrifuge tube, add 700. Mu.L of 2 XCTAB solution, incubate for 30min at 70℃and gently shake for one time at 6min intervals, incubate for 30min at 70℃and gently shake for 10min intervals. Cooling to room temperature, adding 700 mu L of Tris saturated phenol, chloroform and isoamyl alcohol with the volume ratio of 25:24:1, repeatedly reversing and uniformly mixing, and gently shaking for about 40 times. Centrifuge at 3100rpm at room temperature for 15min. The supernatant was pipetted approximately 500. Mu.L and an equal volume of 24:1 chloroform to isoamyl alcohol was added. After shaking up, the mixture was centrifuged at 3100rpm at room temperature for 15min. The supernatant was discarded, and 1mL of frozen absolute ethanol at-20℃was added to the solution, and the solution was subjected to ice bath at-20℃for 30 minutes, and then centrifuged at 12000rpm at room temperature for 10 minutes. Soaking and washing with 75% alcohol, and repeatedly blowing and beating the precipitate for 3min to remove salt. Pouring out alcohol, and adding 30-50 mu L ddH to each sample after air drying ₂ O is dissolved. The extracted cabbage type rape genome DNA is detected by a Nanodrop micro nucleic acid detector.

b. Positive transgenic plant detection

The young leaves of the transformed plants are taken, DNA extraction is carried out by adopting a CTAB method, and the Link fragments on the vector are amplified by PCR, wherein the primers used are Link-ovlapF (5'-AACCTTACGTACGCGTGC AC-3') and Link-salR (5'-ACGCGTCGACCACTGAATTGAATTGTTTAAGG-3') which are compared with non-transgenic wild plants (WT).

The detection results show that 7 transformed plants of 6, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 19, 20 and 21 can amplify electrophoresis bands (750 bp) with expected sizes, and the wild type control does not have electrophoresis bands, so that the transgenic rape genome already contains exogenous interference gene DNA fragments.

Example 3

Evaluation of ss.oah.rnai transgenic canola bacterial sclerotinia resistance:

(1) Immune response of ss.oah.rnai transgenic lines to sclerotinia

The preparation method comprises the steps of inoculating sclerotinia sclerotiorum (Sclerotinia sclerotiorum) to rape seedlings (four leaves and one heart period), preserving sclerotinia sclerotiorum strains by laboratory of national institute of agricultural university, performing in vitro inoculation treatment through laboratory activation, taking the two inverted leaves of a wild transgenic positive strain, cutting the leaves, placing the leaves in a transparent square box, placing each transgenic plant leaf in a box side by side with a non-transgenic contrast, laying several layers of filter paper sheets and wet gauze under the leaves, taking freshly prepared 4-6mm mycelium blocks, inoculating the mycelium blocks with the mycelium face downwards, inoculating the mycelium blocks at positions slightly deviated from a main vein in the middle of the leaves, and inoculating two mycelium blocks per leaf. The cover is covered for moisture preservation, and then the culture is carried out in dark at 22 ℃. Leaves were continuously observed from 0h to 72h of inoculation, and the growth area of sclerotinia sclerotiorum plaques in the ss.oah.rnai transgenic lines was found to be much smaller than that of the non-transgenic lines, and the area of damaged tissues was also small, so that the difference of 36h resistance after inoculation was most remarkable (panel a in fig. 4); compared to the wild type, the transgenic rape leaf spot is significantly reduced (panel B in fig. 4). Thus, interference with OAH gene expression is effective in enhancing resistance of rape leaves to sclerotinia.

(2) Extraction of sclerotinia mycelium RNA at spot part of rape leaf after inoculation

Extracting total RNA of leaves after 36h treatment of sclerotinia in the step (1) by using Fungal Total RNA Isolation Kit fungus total RNA extraction kit (purchased from biological engineering (Shanghai) Co., ltd.). And utilizeII Q RT SuperMix for qRNA (+gDNA wind) kit (available from Vazyme Corp., china) reverse transcription of RNA into cDNA

(3) qPCR detection of target gene expression

qPCR useGreen Realtime PCR Master Mix-Plus-kit specific primers were designed for the coding region of the gene using Primer Premier 5.0 software and Primer-BLAST (NCBI) was used to perform Primer specificity alignment analysis in the gene database to verify the specificity of the primers.

qPCR primers of the SS.OAH gene are:

Q-SsOAH-F：GCACAAGAGATGGGATTCCG

Q-SsOAH-R：TAAACACCATCGGCGAAAGC

the qPCR reaction system was 20. Mu.L: contains SYBR Mix 10. Mu.L, forward and reverse primers (10. Mu. Mol/L) each 0.8. Mu.L, template 2. Mu.L and DEPC treated sterile water. The amplification conditions were: 95 ℃ for 30sec;95℃for 5sec,60℃for 30sec,72℃for 27sec,40 cycles; the renaturated ends were subjected to fluorescence detection at 72℃per cycle. After the reaction is finished, heating to 95 ℃, then cooling to 72 ℃, then slowly heating to 95 ℃, and recording the change of fluorescent signals to obtain the melting curve of the amplified product. Three biological replicates were performed for each set of experiments, each with at least three technical replicates. Specific PCR amplification was performed with the primer pair Q-SsOAH-F, Q-SsOAH-R gene. Meanwhile, the primer pair SSActin-F2/R2 is used as an internal reference for carrying out relative quantitative analysis on the specific amplification of the sclerotinia sclerotiorum SSActin gene. Detecting the expression change of the disease-resistant related gene in rape leaves after the induction of sclerotinia for 36 hours.

The results showed that the expression level of OAH gene in mycelium of leaf spot of transgenic rape strain was reduced compared with WT. The OAH gene expression level in mycelium on the strain R25 is obviously reduced in 60 hours of inoculation; the expression level of the target gene is obviously reduced when the strain R18 is inoculated for 36 hours, the expression level starts to be up-regulated when the strain is inoculated for 48 hours, and the peak value is reached when the strain 72 hours; the expression level of OAH in the sclerotinia sclerotiorum mycelium reached a peak value at 24h of inoculation, and then began to gradually decrease, and the expression level of OAH was significantly reduced at 60h of inoculation (see FIG. 5). The above results indicate that: ss.oah.rnai transgenic lines reduced expression of OAH genes in sclerotinia hyphae.

(4) In vitro antifungal assays

In the same way as the in-vitro inoculation method of the sclerotinia sclerotiorum in the step (1), 5g of fresh leaves are ground into powder by liquid nitrogen, 30mL of extraction Buffer is added for uniform mixing, and the mixture is centrifuged for 10min at room temperature of 10,000Xg. The supernatant was then aspirated into a clean 50mL centrifuge tube and stored at 4 ℃ for later use. 50% (v/v) of the total amount of the cells was added to the PDA medium. The sclerotinia sclerotiorum blocks are inoculated on PDA culture medium extracted with WT and transgenic material liquid, dark culture is carried out for 40 hours at 23 ℃, the hypha expansion area is calculated, and the growth state and expansion condition of hypha of a blank control culture medium and a culture medium added with Wild Type (WT) and transgenic material extract liquid are observed under a split microscope. And further inoculating the cultured sclerotinia mycelium blocks on wild cabbage type rape, and observing and counting the disease spots after 36h and 48h of inoculation. The results show that: PDA hypha expansion area made of the transgenic material is obviously smaller than that of a wild type, and compared with the wild type, the expansion length is shorter, the hypha branches are fewer, and the hypha grows abnormally.

Compared with mycelia inoculated with wild rape extract, sclerotinia sclerotiorum mycelia inoculated with transgenic material extract is smaller than wild rape after 36h and 48h infection. The following is indicated: interference with oxalic acid synthesis affects the growth and expansion of sclerotinia hyphae, further indicating that hyphae growth is due to interference of RNAi in transgenic material bodies, which affects the synthesis of OA in pathogenic bacteria.

The present invention is not limited to the above-mentioned embodiments, and any changes or substitutions that can be easily understood by those skilled in the art within the technical scope of the present invention are intended to be included in the scope of the present invention.

The sequence listing involved is as follows:

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

/>

sequence listing

<110> university of Hubei

<120> recombinant vector based on RNAi interference sclerotinia sclerotiorum OAH gene, construction method and application thereof

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1017

<212> DNA

<213> sclerotinia (Sclerotinia sclerotiorum)

<400> 1

atggctccca tcatggatgc actcccaatc gtcgaggaca agccaacggc tgctgtcact 60

gacttctcgg tctccagtcc tcaagatgga gctgttgttg cgccacctac cacagtctac 120

cagaccggtg ccaccaagtt gaagaacatg ctcagagact cgaatgagtt gattgtttgt 180

cccggtgtct atgatggaat ctcaacccga gttgcccttc aagttggctt cccagctctt 240

tacatgaccg gagcaggcac tactgcttcc cgccttggaa tggcagatct cggcattgct 300

catctttccg acatgaagga ccacgctgag atgattgcaa acctcgaccc ttttggacca 360

cccttgattg ctgatatgga caccggatac ggtggacctc tcattgttga caaagccgtc 420

aaggcctaca tcagagccgg tgttgctgga ttccatatcg aagatcaaat tcaaaacaag 480

cgttgtggcc atcttgcagg caagaaggtt gtccctgaag aagagtacta catgagaatt 540

cgtgccgcca agggtgccaa agatgccatg aaatccgata ttgtgttgat tgcacgcaca 600

gatgcgctcc aacaacttgg ttatgatgag tgcgtcaaac gtttgaaggt tgctcgtgag 660

cttggtgcag atgttggctt gctcgagggt tacacttcaa aggagatggc tgcaaagact 720

gttaaggagt tcgccccatg gccaatactt ttgaacatgg tcgagaacgg cgctactcct 780

atcatcacca ccaaggaggc acaagagatg ggattccgta tcatgatctt ctccttcgct 840

gctctcgccc cagccatgtt ggctatccaa gagactttcg tgcgtttgaa gaacgagggt 900

gtcgtaggaa ctccaaagaa cgttacacca agggccttgt ttgaggtatg cggtctgcaa 960

gagagtattg ttattgatac tgcggctggt ggtggggctt tcgccgatgg tgtttaa 1017

<210> 21

<211> 338

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 21

Met Ala Pro Ile Met Asp Ala Leu Pro Ile Val Glu Asp Lys Pro Thr

1 5 10 15

Ala Ala Val Thr Asp Phe Ser Val Ser Ser Pro Gln Asp Gly Ala Val

20 25 30

Val Ala Pro Pro Thr Thr Val Tyr Gln Thr Gly Ala Thr Lys Leu Lys

35 40 45

Asn Met Leu Arg Asp Ser Asn Glu Leu Ile Val Cys Pro Gly Val Tyr

50 55 60

Asp Gly Ile Ser Thr Arg Val Ala Leu Gln Val Gly Phe Pro Ala Leu

65 70 75 80

Tyr Met Thr Gly Ala Gly Thr Thr Ala Ser Arg Leu Gly Met Ala Asp

85 90 95

Leu Gly Ile Ala His Leu Ser Asp Met Lys Asp His Ala Glu Met Ile

100 105 110

Ala Asn Leu Asp Pro Phe Gly Pro Pro Leu Ile Ala Asp Met Asp Thr

115 120 125

Gly Tyr Gly Gly Pro Leu Ile Val Asp Lys Ala Val Lys Ala Tyr Ile

130 135 140

Arg Ala Gly Val Ala Gly Phe His Ile Glu Asp Gln Ile Gln Asn Lys

145 150 155 160

Arg Cys Gly His Leu Ala Gly Lys Lys Val Val Pro Glu Glu Glu Tyr

165 170 175

Tyr Met Arg Ile Arg Ala Ala Lys Gly Ala Lys Asp Ala Met Lys Ser

180 185 190

Asp Ile Val Leu Ile Ala Arg Thr Asp Ala Leu Gln Gln Leu Gly Tyr

195 200 205

Asp Glu Cys Val Lys Arg Leu Lys Val Ala Arg Glu Leu Gly Ala Asp

210 215 220

Val Gly Leu Leu Glu Gly Tyr Thr Ser Lys Glu Met Ala Ala Lys Thr

225 230 235 240

Val Lys Glu Phe Ala Pro Trp Pro Ile Leu Leu Asn Met Val Glu Asn

245 250 255

Gly Ala Thr Pro Ile Ile Thr Thr Lys Glu Ala Gln Glu Met Gly Phe

260 265 270

Arg Ile Met Ile Phe Ser Phe Ala Ala Leu Ala Pro Ala Met Leu Ala

275 280 285

Ile Gln Glu Thr Phe Val Arg Leu Lys Asn Glu Gly Val Val Gly Thr

290 295 300

Pro Lys Asn Val Thr Pro Arg Ala Leu Phe Glu Val Cys Gly Leu Gln

305 310 315 320

Glu Ser Ile Val Ile Asp Thr Ala Ala Gly Gly Gly Ala Phe Ala Asp

325 330 335

Gly Val

<210> 3

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

cggggtaccg gatacggtgg acctctcatt g 31

<210> 4

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gtgcacgcgt acgtaaggtt gtggtgatga taggagtagc gc 42

<210> 5

<211> 32

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

acgcgtcgac gtggtgatga taggagtagc gc 32

<210> 6

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

cggactagtg gatacggtgg acctctcatt g 31

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

tagccaccca agaaactgct 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

attgatcagc ctaaccaaac 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

aaccttacgt acgcgtgcac 20

<210> 10

<211> 32

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

acgcgtcgac cactgaattg aattgtttaa gg 32

<210> 11

<211> 407

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

ggatacggtg gacctctcat tgttgacaaa gccgtcaagg cctacatcag agccggtgtt 60

gctggattcc atatcgaaga tcaaattcaa aacaagcgtt gtggccatct tgcaggcaag 120

aaggttgtcc ctgaagaaga gtactacatg agaattcgtg ccgccaaggg tgccaaagat 180

gccatgaaat ccgatattgt gttgattgca cgcacagatg cgctccaaca acttggttat 240

gatgagtgcg tcaaacgttt gaaggttgct cgtgagcttg gtgcagatgt tggcttgctc 300

gagggttaca cttcaaagga gatggctgca aagactgtta aggagttcgc cccatggcca 360

atacttttga acatggtcga gaacggcgct actcctatca tcaccac 407

<210> 12

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

cggggtaccg gatacggtgg acctctcatt g 31

<210> 13

<211> 42

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

gtgcacgcgt acgtaaggtt gtggtgatga taggagtagc gc 42

<210> 14

<211> 32

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

acgcgtcgac gtggtgatga taggagtagc gc 32

<210> 15

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

cggactagtg gatacggtgg acctctcatt g 31

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

tagccaccca agaaactgct 20

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

attgatcagc ctaaccaaac 20

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

aaccttacgt acgcgtgcac 20

<210> 19

<211> 32

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

acgcgtcgac cactgaattg aattgtttaa gg 32

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

gcacaagaga tgggattccg 20

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

taaacaccat cggcgaaagc 20

Claims (4)

1. The application of a recombinant vector pCAMBIA1301-D35s-SsOAH-NOS in preparing an anti-sclerotinia rape material is characterized in that the recombinant vector comprises a nucleotide sequence interfering with an sclerotinia OAH gene, and the sequence of the sclerotinia OAH gene is shown as SEQ ID NO. 1; the recombinant vector is prepared by the following method:

according to the sequence information of the sclerotinia sclerotiorum OAH, selecting a sequence with a nucleotide sequence shown as SEQ ID NO.11 as an interference fragment;

designing interference fragment primers OAH-sF and OAH-ovalpsR with sequences shown as SEQ ID NO. 3-4, amplifying by using DNA polymerase, and amplifying by using an intermediate link sequence fragment, wherein the PCR amplification program is 94 ℃ for 5min;94℃30sec,56℃30sec,68℃40sec,32 cycles; extending at 68 ℃ for 5min and at 25 ℃ for 1min;

Connecting the forward interference fragment with a primer OAH-asF and an OAH-asR with intermediate link sequences shown in SEQ ID NO. 5-6 through a PCR overlapping extension technology, and carrying out PCR overlapping extension, wherein the reaction procedure is the same as above, but the extension is 45sec;

then, the target fragment is recovered by agarose gel electrophoresis, the target fragment is connected with a T carrier, and the connecting system is as follows: 4.5. Mu.L of fragment of interest, 0.5. Mu.L of pMD-18T vector, 5. Mu.L of LSolution I;

converting the connection product through thermal excitation, cloning the interference fragment into a pEasy-Blunt vector and converting the interference fragment into escherichia coli DH5 alpha, coating bacterial liquid on an LB solid plate containing Amp antibiotics, after growing for 10-12 hours, selecting monoclonal, and performing bacterial liquid PCR detection to obtain positive forward interference cloning vectors and reverse interference cloning vectors;

selecting a KpnI and SpeI restriction enzyme site double-restriction enzyme digestion pCAMBIA1301 vector plasmid, and recovering a linear vector plasmid by glue; the KpnI and SalI cleave Ri02s-W vector, salI and SpeI cleave Ri02as, corresponding exogenous fragments are recovered through TA, and the products are connected with the recovered linear vector plasmid by using T4DNA ligase, so that the linear vector plasmid is electrically transformed into competent cells of escherichia coli; and selecting the cloned seeds, and determining positive cloned seeds by using primers shown in SEQ ID NO. 7-8 as bacterial liquid PCR detection, wherein the length of the obtained PCR product is about 700bp, so that the interference vector pCAMBIA1301-D35s-SsOAH-NOS is obtained.

2. The use according to claim 1, wherein the recombinant vector is used to interfere with accumulation of sclerotinia oxalate.

3. The application according to claim 1, wherein the application method comprises:

transferring the obtained recombinant vector into agrobacterium GV3101, transforming cabbage type rape by using agrobacterium infection method, and identifying transgenic strain by using PCR;

identifying ss.oah expression levels by qPCR;

transgenic lines of ss.oah.rnai were grown.

4. A method for improving resistance of rape to sclerotinia, which is characterized in that the method comprises introducing a recombinant vector containing an interference fragment of sclerotinia pathogenic gene OAH into rape, wherein the nucleotide sequence of the gene OAH is shown as SEQ ID NO:1, and the recombinant vector is pCAMBIA1301-D35s-SsOAH-NOS as claimed in claim 1.