CN109576301B

CN109576301B - Application of ZmCOL3 gene and protein thereof in improving stem rot resistance of target plants

Info

Publication number: CN109576301B
Application number: CN201811521398.8A
Authority: CN
Inventors: 刘相国; 尹悦佳; 柳青; 金敏亮; 贾伟; 张艳; 严建兵; 郝东云
Original assignee: Jilin Academy of Agricultural Sciences
Current assignee: Changzhou Xinmi Biotechnology Co ltd
Priority date: 2018-12-12
Filing date: 2018-12-12
Publication date: 2022-03-15
Anticipated expiration: 2038-12-12
Also published as: CN109576301A

Abstract

The invention discloses an application of ZmCOL3 gene and protein thereof in improving stem rot resistance of a target plant, and relates to the technical field of plant genetic engineering.

Description

Application of ZmCOL3 gene and protein thereof in improving stem rot resistance of target plants

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to ZmCOL3 gene and application of ZmCOL3 gene protein in improvement of stem rot resistance of target plants.

Background

Corn stalk rot, also known as bacterial wilt, is a soil-borne disease that seriously harms corn production. Statistics of 22 states in the united states and the ontario province in canada show that the yield loss of corn due to stalk rot in 2013 is 1.83 hundred million bushels (Mueller and Wise, 2014). In brazil, the maximum grain weight loss between 2007 and 2009 due to stalk rot is 17.2%. In China, the disease incidence area of Shandong province is about 500 square acres each year, the disease incidence rate of spring corn is 10-20%, and can reach more than 50% in serious cases, and the disease incidence rate of summer corn is generally 20-30%, and can reach more than 60% in serious cases. As of 2000, 16 provinces, cities and municipalities occur in the whole country, and according to investigation, the yield reduction caused by the corn stalk rot is up to 25 percent, the general incidence rate is between 10 percent and 20 percent, and the serious incidence rate is over 50 percent.

The wide distribution of pathogens causing corn stalk rot worldwide is complex, and there are more than 20 species of pathogens known to cause corn stalk rot, including 19 fungi and 3 bacteria (chenyujing et al, 2013). Stem rot is mainly classified into the following groups according to the difference of pathogenic bacteria: anthracnose stalk rot, pythium stalk rot, gibberella stalk rot, fusarium stalk rot, charcoal fungus stalk rot, bacterial stalk rot, etc. According to different infection parts, the corn stalk rot is mainly divided into two modes of soil transmission and air transmission.

Pathogenic bacteria of the soil-borne stem rot can live in soil, the infection starting part is the root, and the disease can occur in any growth stage. The development of pathogenic bacteria to the stem needs to be carried out until the carbohydrate content in the stems in the filling period is reduced, and the gibberellic stem rot, the fusarium stem rot and the charcoal fungus stem rot belong to the type.

The site of infection by airborne stem rot pathogens begins in the aerial parts and is often non-viable after the plant residue has been removed, and anthracnose and pythium stem rot are among this category.

The main types of stem rot in different areas are different due to the difference of natural conditions such as temperature, humidity, wind power and the like. Pythium stem rot is mainly distributed in temperate, subtropical, and tropical regions (DeLedn, 1984), and in japan, maize is dominated by pythium stem rot (santong, and von lingoncloud, 1992). The pathogenic bacteria of fusarium stem rot are mainly fusarium moniliforme, which is popular in dry and hot areas, such as most areas in the united states (Mueller and Wise, 2014), Hubei, Hebei, Guangxi, etc. in China (Zhangchao Chong et al, 1983). Charcoal fungus stem rot also occurs mainly in dry and hot areas. Gibberellic stem rot occurs mainly in cold regions, such as Russia, Ukrainian, etc. (Wenry and Comshawland, 2000), and Shaanxi, Jilin, Henan, China (Zhangzhi, et al, 1988). Anthrax stalk rot is mainly distributed in warm and humid areas, such as the brazil (Cota et al, 2012).

In most cases, a certain region of stem rot is not infected by only one type of pathogenic bacteria, but is a result of the mixed action of a plurality of pathogenic bacteria. Such as Shandong, where infestation by Pythium and gibberellic is predominant (slow acting and Zhang Momo, 1985). The main pathogenic bacteria of maize stalk rot in Jilin province are gibberella, fusarium and pythium (von Fenfen et al, 1995).

Research shows that the resistance of corn to the stem rot has quantitative inheritance characteristics and is controlled by a plurality of quantitative trait loci. Both quantitative and quality trait loci have been mapped for stalk rot resistance, as shown by the Khokhar et al study which found maize to be resistant to fusarium stalk rot on chr7 and chrl 10. Abad et al cloned a gene against anthracnose stalk rot (Abad et al, 2006). At present, only QTL-Rfg2 times of Quantitative Trait Loci (QTL) has fine localization and proved to be related to auxin for the stem rot resistance QTL.

Disclosure of Invention

A first object of the present invention is to provide a method for enhancing the stem rot resistance of a target plant, which can effectively enhance the resistance of the target plant to bacterial stem rot.

The second purpose of the invention is to provide the application of the gene and the protein thereof in improving the stem rot resistance of target plants, and the application improves the stem rot resistance of the plants by regulating the ZmCOL3 gene expression.

The invention is realized by the following steps:

the embodiment of the invention provides a method for enhancing stem rot resistance of a target plant, which comprises the step of regulating and controlling the expression level of ZmCOL3 gene in the target plant.

ZmCOL3 is a transcription factor containing a CCT domain. Research shows that there are 4 ways to regulate flowering time in Arabidopsis, namely light regulation, autonomous flowering, vernalization and gibberellin signaling. For monocot rice, there is mainly a photoperiod-regulated flowering pathway. CO (CONSTANS) is the 1 st cloned gene involved in light-regulated flowering of Arabidopsis thaliana, and promotes flowering of Arabidopsis thaliana under long-day conditions.

The C-terminus of the protein encoded by CO has a nuclear localization sequence encoding 43-45 amino acids, which is subsequently found conserved in the CONSTANS-like gene and the C-terminus of the amino acid encoded by TOC1, and is therefore designated as a CCT domain.

Further, the above method increases the expression level of ZmCOL3 gene by:

agrobacterium containing ZmCOL3 overexpression vector was transfected into plants. The amino acid sequence coded by ZmCOL3 gene is shown in SEQ ID No.2, and the base sequence of ZmCOL3 gene is shown in SEQ ID No. 1.

The ZmCOL3 gene may be ZmCOL3 genome sequence, and the base sequence of ZmCOL3 genome sequence is shown in SEQ ID No. 3.

In this method, the plant is a monocotyledonous plant, and specifically may be maize. The stalk rot is fusarium graminearum stalk rot in this example.

Further, the embodiment of the invention also provides an application of the ZmCOL3 gene and the protein thereof in improving the stem rot resistance of target plants.

The application comprises the step of regulating the expression level of ZmCOL3 gene in a target plant so as to improve the resistance of the plant to stem rot. The inventor of the application discovers that the regulation and control of the expression level of the ZmCOL3 gene in a target plant can improve the resistance of the plant to stem rot through creative work.

Further, the above regulation is positive regulation, that is, the application is to increase the resistance of a plant to stem rot by increasing the expression level of ZmCOL3 gene in a target plant.

Specifically, the amino acid sequence coded by the ZmCOL3 gene is shown as SEQ ID No. 2. The base sequence of ZmCOL3 gene is shown in SEQ ID No. 1. Specifically, the ZmCOL3 gene can be ZmCOL3 genome sequence, and the base sequence of ZmCOL3 genome sequence is shown in SEQ ID No. 3.

The target plant is a monocotyledon, preferably corn, and the stem rot is resistant to fusarium graminearum.

The invention has the following beneficial effects:

the method for enhancing the stem rot resistance of the target plant comprises the steps of regulating the expression level of ZmCOL3 gene of the target plant, and obtaining a transgenic plant with ZmCOL3 overexpression, so that the resistance of the plant to the stem rot is enhanced, the morbidity of the plant is prevented or reduced, and the yield reduction of the plant caused by the stem rot is reduced.

In addition, the embodiment of the invention provides an application of the ZmCOL3 gene and the protein thereof in improving the stem rot resistance of a target plant, and the resistance of the plant to the stem rot is improved by regulating the expression level of the ZmCOL3 gene in the target plant.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a schematic diagram of ZmCOL3-A gene overexpression vector provided in Experimental example 1 of the present invention;

FIG. 2 is a graph showing the results of the test of the expression level of ZmCOL3 gene in transgenic maize according to example 2 of the present invention;

FIG. 3 is a graph showing the results of resistance identification provided in example 3 of the present invention;

FIG. 4 is a graph showing the results of resistance identification provided in example 4 of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

This example provides a method for cloning ZmCOL3 gene or ZmCOL3 genome sequence and construction of a vector.

368 parts of inbred lines with genetic diversity and good adaptability in field experiments are respectively planted in places with different latitudes and different sunshine periods, such as Hainan, Yunnan, Sichuan, Guangxi, Chongqing, Henan, Hubei, Beijing, Jilin province and the like; collecting inbred line samples of different planting places from three to six-leaf stage young leaves, extracting Genome DNA, and performing Genome-wide association analysis GWAS (Genome-wide association study). The ZmCOL3 genomic sequence was found to be associated with the flowering stage of maize.

Obtaining ZmCOL3 genome sequence by cloning, wherein the base sequence of ZmCOL3 genome sequence is shown as SEQ ID No. 3; obtaining a coding sequence ZmCOL3 gene of ZmCOL3 genome sequence, wherein the base sequence of ZmCOL3 gene is shown in SEQ ID No. 1; the amino acid sequence of the transcription factor containing CCT structural domain coded by ZmCOL3 gene is shown in SEQ ID No. 2.

Construction of ZmCOL3 Gene overexpression vector

1.1 artificially synthesizing ZmCOL3 genome sequence (named ZmCOL3-A) and introducing SacI and SpeI enzyme cutting sites at two ends of ZmCOL3 genome sequence; cloning the ZmCOL3 genome sequence introduced with the restriction enzyme site to a pUC57 vector to obtain pUC57, wherein the ZmCOL3-A recombinant vector has no mutation in the sequence through colony PCR and sequencing verification;

1.2 double enzyme digestion of pUC57 with SacI and SpeI separately, ZmCOL3-A recombinant vector and pCAMBIA3300-ZmUbi vector; respectively recovering double enzyme digestion fragments;

1.3 connecting the recovered double enzyme digestion fragments by using ligase; obtaining an over-expression recombinant vector pCAMBIA3300-ZmUbi of ZmCOL3 genome sequence, wherein the vector plasmid of ZmCOL 3-A.

The structural schematic diagram of the over-expression recombinant vector pCAMBIA3300-ZmUbi: ZmCOL3-A is shown in figure 1.

Example 2

This example provides the over-expression recombinant vector pCAMBIA3300-ZmUbi of ZmCOL3 genome sequence genetic transformation of ZmCOL 3-A.

Over-expression recombinant vector pCAMBIA3300-ZmUbi ZmCOL3-A transformation agrobacterium tumefaciens and positive clone identification

1.1 taking 200 mu L of agrobacterium-mediated state, adding 2 mu L of plasmid DNA, carrying out ice bath for 30min, quickly freezing for 1min by liquid nitrogen, and carrying out water at 37 ℃; bathing for 5min, and adding 800 μ L YEP culture medium;

1.2 at 28 ℃, the culture is recovered for 3h at 100rpm, centrifugation is carried out for 1min at 5000 g, and the supernatant is discarded;

1.3 Add 100. mu.L YEP Medium; resuspending the thallus, coating on YEP plate containing corresponding antibiotics, and culturing at 28 deg.C for 36-48 h;

1.4 Single colonies were picked in 5mL YEP medium (containing the corresponding antibiotic) and cultured at 28 ℃ for 48h at 200rpm, and plasmid DNA was extracted and verified by PCR and digestion. And (5) verifying that the correct single clone is preserved for subsequent experiments.

Agrobacterium infection of maize immature embryo and plant regeneration

2.1 suspending a proper amount of agrobacterium EHA105 thallus containing a target vector in a YEP liquid culture medium, and carrying out shake culture at 28 ℃ to keep the thallus in a logarithmic phase; centrifuging at 3000rpm for 10min, discarding supernatant, washing thallus with N6 liquid culture medium, centrifuging to collect thallus, suspending thallus with N6 liquid culture medium containing 100mM acetosyringone, and adjusting OD550 to about 0.3;

2.2 stripping HiII young embryos 9-12 days after pollination, wherein the diameter of the young embryos is 1.8mm (1.5-2.0 mm); inducing to form embryonic callus, soaking the embryonic callus in the thallus suspension for 5min, taking out and draining the bacteria liquid;

2.3 transferring the embryogenic callus to a co-culture medium, and culturing in the dark at 28 ℃ for 3 days;

transferring the embryonic callus to a resting culture medium after 2.4 days, and culturing for 8 days (7-10 days) in the dark at 28 ℃;

2.5 after resting culture, transferring the embryonic callus into a screening culture medium containing bialaphos, carrying out dark culture at 28 ℃, and carrying out subculture once every two weeks until resistant callus is screened out;

2.6 transferring the resistant callus to a differentiation culture medium, regenerating plants, and then hardening and transplanting seedlings; 4 successfully transformed transformation events (1-4, 1-39, 26-12 and 29-5) were obtained, and transgenic maize seeds were harvested.

And when the transgenic seedlings of the transgenic corn seeds transplanted into the field grow to 7-8 leaves, taking the leaves to extract DNA, and detecting by adopting a PCR technology.

Gene expression level analysis of transgenic maize plants

The 4 successfully transformed transformation events (1-4, 1-39, 26-12 and 29-5) are respectively 5 plants, and the leaves of 5cm of the sixth leaf apex of the six-leaf first-heart-stage corn are respectively adopted to extract the total RNA, and the detailed operation steps are as follows:

1. quickly grinding a proper amount of plant tissues in liquid nitrogen into powder, putting the powder into a centrifuge tube, adding a corresponding amount of BB6 solution (each 1mL of BB6, 10 mu L of beta-mercaptoethanol is added, the existing preparation is used), vortexing, violently shaking, mixing uniformly, and incubating for 3 minutes at room temperature;

2. then centrifuging at 12000 Xg for 2-5 min, carefully sucking the supernatant from the centrifuge tube into the centrifuge tube of RNase-free, adding 0.5 times volume of anhydrous ethanol into the supernatant, mixing to obtain a mixed solution (at this time, precipitation may occur), vortexing thoroughly, and dispersing the precipitation.

3. The mixed solution obtained in step 2 and the precipitate were put together into a centrifugal column, centrifuged at 12000 Xg for 30 seconds, and the effluent was discarded.

4. 500. mu.L of CB6 solution was added to the centrifugal column obtained in step 3, and centrifuged at 12000 Xg at room temperature for 30 seconds, and the effluent was discarded. If the genome DNA is required to be removed, adding 80 mu L of DNase I working solution into the center of the centrifugal column, and standing for 15 minutes at room temperature; this step was repeated once. (preparation of DNase I working solution: 70. mu.L Reaction Buffer was put into RNase-free tube, 30U DNase I was added and mixed)

5. Adding 500 μ L WB6 into the centrifugal column (before use, whether absolute ethanol is added is checked), centrifuging at 12000 × g for 30s, and discarding the effluent; repeating the steps once;

6. the column was centrifuged at 12000 Xg for 2 minutes to completely remove the residual ethanol.

7. Then, 200. mu.L (30-300. mu.L) of RNase-free water was added to the center of the column and left to stand at room temperature for 1 minute.

8. The RNA was eluted by centrifugation at 12000 Xg for 2 minutes at room temperature.

9. The RNA was stored at-80 ℃ or used in subsequent experiments.

And carrying out reverse transcription on the obtained RNA to form cDNA, carrying out qRT-PCR by taking the receptor material HiII as a control, and analyzing the expression level of the ZmCOL3 gene in different transgenic corn strains. The detection is carried out by using a cDNA reverse transcription kit, wherein a reverse transcription system is shown in Table 1, an qPT-PCR system is shown in Table 2, and a PCR primer sequence is shown in Table 3.

TABLE 1 reverse transcription System

Components	Dosage of
		Total RNA	50ng-5μg
Oligo(dT)₁₈Primer(0.5μg/μL)	1μL
		2×TS Reaction Mix	10μL
TransScript@RT/RI Enzyme Mix	1μL
		gDNA Remover	1μL
RNase-free Water	Make up to 20. mu.L

Reverse transcription program: 30min at 42 ℃; 5s at 85 ℃; storing at 4 ℃.

TABLE 2 reverse transcription System

Components	Dosage of
		Template	Variable
Forward Primer(10μM)	0.2μL
		Reverse Primer(10μM)	0.2μL
2×TransStart@Top/Tip Green qPCR SuperMix	10μL
		Passive Reference Dye(50×)(optional)	0.4μL
ddH₂O	Make up to 20. mu.L

TABLE 3 primer sequences

Primer name	Sequence of	Use of
			Actin-F	TACGAGATGCCTGATGGTCAGGTCA	qRT-PCR
Actin-R	TGGAGTTGTACGTGGCCTCATGGAC	qRT-PCR
			qCol3-F	GGGACGCGAGCTGTGTGTA	qRT-PCR
Qcol3-R	AGGCAGCAGGTGCACTCATTT	qRT-PCR

qRT-PCR procedure: at 95 ℃ for 30 s; 95 ℃ for 5 s; 58 ℃ (fluorescence signal collection) for 30s, 42 cycles; 72 ℃ for 10 s.

The RT-PCR results are shown in FIG. 2. As can be seen from fig. 2, the expression level of ZmCOL3 gene in transgenic maize plants was significantly increased relative to untransformed maize plants.

Example 3

The resistance effect of ZmCOL3 on the fusarium graminearum stem rot resistance of plants is verified.

Specifically, the resistance effect of the transgenic corn provided in example 2 on fusarium graminearum stalk rot was verified.

And (3) pathogenic bacterium spore liquid culture:

fusarium graminearum (pathogenic bacteria) blocks growing on a PDA (Potato Dextrose Agar) culture medium are inoculated on a mung bean culture medium, and every 500mL of the mung bean culture medium is inoculated with 3 blocks of the PDA Fusarium graminearum blocks. Culturing the inoculated semen Phaseoli Radiati culture medium under shaking for 72h (28 deg.C/200 rpm) in dark, filtering spore solution with double-layer gauze, and enriching and diluting pathogenic bacteriaThe spore liquid has a concentration of about 10⁷one/mL.

Inoculation:

inoculating the pathogenic bacteria spore liquid (fusarium graminearum) in the step of culturing the pathogenic bacteria spore liquid to a PDA culture medium for primary amplification, culturing in the dark at the temperature of 25 ℃ for 5-7 days until pathogenic bacteria hyphae are paved on the whole PDA flat plate, and storing the PDA flat plate at the temperature of 4 ℃ for later use.

And cutting fusarium graminearum which is expanded and proliferated for the first time and is longer than the PDA culture medium into small fragments together with the culture medium, inoculating the small fragments onto a corn kernel culture medium, carrying out dark culture for 15-20 days at the temperature of 25 ℃, and carrying out a field inoculation test when pathogenic bacteria hypha is fully paved on the whole kernel culture medium.

And (3) field inoculation:

in the flowering period of the corn, the inoculation is carried out by adopting a soil-buried root-damaging method. Before inoculation, fusarium graminearum of the corn kernel culture medium obtained in the step of inoculating in a bag needs to be stirred and uniformly mixed so as to ensure the consistency of field inoculation.

During inoculation, the capillary heel is vertically cut downwards at a position 5-10 cm away from a plant to ensure the infection of pathogenic bacteria, and the corn kernel culture medium is buried for about 70 hours after soil is thrown away and covered with soil. After inoculation, the inoculation material is irrigated manually to maintain a humid environment so as to ensure rapid propagation and pathogenicity of pathogenic bacteria.

And (3) resistance identification:

the positive transgenic corn provided in example 2 was used for continuous backcross with PH6WC as the backcross parent, and the progeny segregating population in the backcross was selected for genotype and resistance identification. Positive plants and negative plants in the transgenic segregating population are identified through a PCR method, and statistics and comparison of resistance are carried out in groups.

In 2017, field resistance identification is performed on Jilin princess mountains, and specific reference is made to fig. 3 and table 4.

TABLE 4 results of resistance identification

As can be seen from Table 4 and FIG. 3, in the BC4 generation segregating population of the transformation event 1-4, the disease resistance rate of the transgenic positive plants is 72.73%, the disease resistance rate of the transgenic negative plants is 0%, and the resistance is remarkably improved by 72.73%; in BC4 generation segregating population of transformation event 1-39, the disease resistance rate of transgenic positive plants is 40.00%, the disease resistance rate of negative plants is 4.76%, and the resistance is obviously improved by 35.24%; in BC4 generation segregating population of transformation event 26-12, the disease resistance rate of transgenic positive plants is 17.65%, the disease resistance rate of negative plants is 4.17%, and the resistance is remarkably improved by 13.48%; in BC4 generation segregating population of transformation event 32-1, the disease resistance rate of transgenic positive plants is 6.67%, the disease resistance rate of negative plants is 0%, and the resistance is remarkably improved by 6.67%.

Therefore, the over-expression of ZmCOL3 gene can obviously improve the resistance level of the mature corn stalk rot

Example 4

And (3) performing field resistance identification on the Jilin princess ridge in 2018, and adopting the steps of pathogen spore solution culture, inoculation, field inoculation and resistance identification provided in the embodiment 3. Refer specifically to fig. 4 and table 5.

TABLE 5 results of resistance identification

As can be seen from Table 5 and FIG. 4, in the BC4 generation segregating population of the transformation event 1-4, the disease resistance rate of the transgenic positive plants is 88.68%, the disease resistance rate of the negative plants is 28.57%, and the resistance is remarkably improved by 60.11%; in BC4 generation segregation population of transformation events 1-39, the disease resistance rate of transgenic positive plants is 87.72%, the disease resistance rate of negative plants is 30.56%, and the resistance is obviously improved by 57.06%; in BC4 generation segregating population of transformation event 26-12, the disease resistance rate of transgenic positive plants is 75.70%, the disease resistance rate of negative plants is 21.25%, and the resistance is obviously improved by 54.45%; in BC4 generation segregating population of transformation event 32-1, the disease resistance rate of transgenic positive plants is 17.65%, and the disease resistance rate of negative plants is 23.33%.

Therefore, the over-expression of ZmCOL3 gene can obviously improve the resistance level of mature corn stalk rot.

In summary, the embodiments of the present invention provide a method for enhancing stem rot resistance of a target plant, which includes regulating an expression level of ZmCOL3 gene of the target plant to obtain a transgenic plant with ZmCOL3 overexpression, so as to enhance resistance of the plant to stem rot, prevent or reduce a disease rate of the plant, and reduce yield reduction of the plant due to stem rot.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Jilin province academy of agricultural sciences

<120> ZmCOL3 gene and application of protein thereof in improving stem rot resistance of target plants

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 1680

<212> DNA

<213> Zea mays

<400> 1

ctcgtggtac aagcgaacaa aggagcaaac ccgagacagc gacgggacgc cagcccctcc 60

acgtgctgga ggaggacccc tcaaaacgtc cgccacggcg gacacgcacc aacaaacgcc 120

ctgagagcag ccatttctaa cgcttacgca acccagtccg cccgtgtctc tggtgacacc 180

gacacccgtg gcatctctct cgtgactccc ggagcagagg catggacacc gcggcggagc 240

tggagctggg gctggagttg gagcagaagc cggcggcggg gtactggagc gtggtgggcg 300

cgcgcccttg cgacgcgtgc gccgcggagc cggcgcggct gcactgccgc gcggacggcg 360

cgttcctgtg ccccggctgc gacgcccggg cgcacggcgc cgggtcgcgc cacgcgcgcg 420

tctggctgtg cgaggtctgc gagcatgccc ccgccgccgt cacctgccgc gccgacgccg 480

ccgcgctgtg cgccgcctgc gacgccgaca tccactcggc caacccgctc gcgcgccgcc 540

acgagcgcct ccccgtcgcc cctctcttcg gcgcgctcgc ggacgcgccg cagcccttcc 600

cgtccccggc cttcgctgcc gccgcggggg ccgaggcccc agctcagggg gaagcggtgg 660

cggaagacta cgggagcagc gaggccgagg cggcgtcgtg gctgctcccc gagcccgaca 720

acagccacga ggacagcgcc gccgacacgt tcttcgcgga gtcggacgcg tacctcggcg 780

ccgacctcga cttcgcccgg tgcatggacg gcgtcaaggc catcggcgtg ccggtcgcgc 840

cgcccgagct ggacatcggt gccggcagct tttgctaccc cgaacactcc atgaaccaca 900

ttttgtcgtc atcctcggag gtggcggtgg taccggacgc gcaggcggcc ggcctgccgg 960

tggtggtggt ggtgagcaga ggggaggagc gggaggcgcg gctgatgcgg taccgtgaga 1020

agcgcaagaa ccgccggttc gacaagacca tccgctacgc gtcccgcaag gcgtacgccg 1080

agacgcggcc gcgcatcaag ggccgcttcg ccaagcgccg ctccgcggag ggcgaggacg 1140

aggcgctgga gcacgaggaa ggggcgtgct tctcgcccac ggggtcggcg cccgccgcgt 1200

cggacggcgt cgtcccgtcc ttctgttgag gggagaagac gacgacgacc ccggcagacg 1260

gctccttaac tttgccagct ctgtcgaccc tgaacccttt ttttccctcc cctcttctct 1320

cttttgatcg aggggttgcc agctctggat ctgaaattct gaacgcatgg gacgcgagct 1380

gtgtgtagca tgaataactg cgtagtttgt tggatggacg aactcaatcg cgctcgcatg 1440

gaatggaact cttgtaatcc accctttgta cattaccatc tagagttgct ccttttttcc 1500

atgagccata aatgagtgca cctgctgcct attagttgtt gcccttttgc tgctcatatg 1560

catcactgca gcatttggtt ctcagaaagg atcgttcatt cagccagcat ccagctatcc 1620

aactctcttg cttgcagttg ttccggacaa agtgattggt tggtagagca tcgattcgag 1680

<210> 2

<211> 335

<212> PRT

<213> Zea mays

<400> 2

Met Asp Thr Ala Ala Glu Leu Glu Leu Gly Leu Glu Leu Glu Gln Lys

1 5 10 15

Pro Ala Ala Gly Tyr Trp Ser Val Val Gly Ala Arg Pro Cys Asp Ala

20 25 30

Cys Ala Ala Glu Pro Ala Arg Leu His Cys Arg Ala Asp Gly Ala Phe

35 40 45

Leu Cys Pro Gly Cys Asp Ala Arg Ala His Gly Ala Gly Ser Arg His

50 55 60

Ala Arg Val Trp Leu Cys Glu Val Cys Glu His Ala Pro Ala Ala Val

65 70 75 80

Thr Cys Arg Ala Asp Ala Ala Ala Leu Cys Ala Ala Cys Asp Ala Asp

85 90 95

Ile His Ser Ala Asn Pro Leu Ala Arg Arg His Glu Arg Leu Pro Val

100 105 110

Ala Pro Leu Phe Gly Ala Leu Ala Asp Ala Pro Gln Pro Phe Pro Ser

115 120 125

Pro Ala Phe Ala Ala Ala Ala Gly Ala Glu Ala Pro Ala Gln Gly Glu

130 135 140

Ala Val Ala Glu Asp Tyr Gly Ser Ser Glu Ala Glu Ala Ala Ser Trp

145 150 155 160

Leu Leu Pro Glu Pro Asp Asn Ser His Glu Asp Ser Ala Ala Asp Thr

165 170 175

Phe Phe Ala Glu Ser Asp Ala Tyr Leu Gly Ala Asp Leu Asp Phe Ala

180 185 190

Arg Cys Met Asp Gly Val Lys Ala Ile Gly Val Pro Val Ala Pro Pro

195 200 205

Glu Leu Asp Ile Gly Ala Gly Ser Phe Cys Tyr Pro Glu His Ser Met

210 215 220

Asn His Ile Leu Ser Ser Ser Ser Glu Val Ala Val Val Pro Asp Ala

225 230 235 240

Gln Ala Ala Gly Leu Pro Val Val Val Val Val Ser Arg Gly Glu Glu

245 250 255

Arg Glu Ala Arg Leu Met Arg Tyr Arg Glu Lys Arg Lys Asn Arg Arg

260 265 270

Phe Asp Lys Thr Ile Arg Tyr Ala Ser Arg Lys Ala Tyr Ala Glu Thr

275 280 285

Arg Pro Arg Ile Lys Gly Arg Phe Ala Lys Arg Arg Ser Ala Glu Gly

290 295 300

Glu Asp Glu Ala Leu Glu His Glu Glu Gly Ala Cys Phe Ser Pro Thr

305 310 315 320

Gly Ser Ala Pro Ala Ala Ser Asp Gly Val Val Pro Ser Phe Cys

325 330 335

<210> 3

<211> 1786

<212> DNA

<213> Zea mays

<400> 3

ctcgtggtac aagcgaacaa aggagcaaac ccgagacagc gacgggacgc cagcccctcc 60

acgtgctgga ggaggacccc tcaaaacgtc cgccacggcg gacacgcacc aacaaacgcc 120

ctgagagcag ccatttctaa cgcttacgca acccagtccg cccgtgtctc tggtgacacc 180

gacacccgtg gcatctctct cgtgactccc ggagcagagg catggacacc gcggcggagc 240

tggagctggg gctggagttg gagcagaagc cggcggcggg gtactggagc gtggtgggcg 300

cgcgcccttg cgacgcgtgc gccgcggagc cggcgcggct gcactgccgc gcggacggcg 360

cgttcctgtg ccccggctgc gacgcccggg cgcacggcgc cgggtcgcgc cacgcgcgcg 420

tctggctgtg cgaggtctgc gagcatgccc ccgccgccgt cacctgccgc gccgacgccg 480

ccgcgctgtg cgccgcctgc gacgccgaca tccactcggc caacccgctc gcgcgccgcc 540

acgagcgcct ccccgtcgcc cctctcttcg gcgcgctcgc ggacgcgccg cagcccttcc 600

cgtccccggc cttcgctgcc gccgcggggg ccgaggcccc agctcagggg gaagcggtgg 660

cggaagacta cgggagcagc gaggccgagg cggcgtcgtg gctgctcccc gagcccgaca 720

acagccacga ggacagcgcc gccgacacgt tcttcgcgga gtcggacgcg tacctcggcg 780

ccgacctcga cttcgcccgg tgcatggacg gcgtcaaggc catcggcgtg ccggtcgcgc 840

cgcccgagct ggacatcggt gccggcagct tttgctaccc cgaacactcc atgaaccaca 900

ttgtaagccg tacttttaat agtatatccg ggatcctcct cacggacaga tcacagaggt 960

tggatgatgg tgataacgta gacgcctttc aatccctcct tattgcagtt gtcgtcatcc 1020

tcggaggtgg cggtggtacc ggacgcgcag gcggccggcc tgccggtggt ggtggtggtg 1080

agcagagggg aggagcggga ggcgcggctg atgcggtacc gtgagaagcg caagaaccgc 1140

cggttcgaca agaccatccg ctacgcgtcc cgcaaggcgt acgccgagac gcggccgcgc 1200

atcaagggcc gcttcgccaa gcgccgctcc gcggagggcg aggacgaggc gctggagcac 1260

gaggaagggg cgtgcttctc gcccacgggg tcggcgcccg ccgcgtcgga cggcgtcgtc 1320

ccgtccttct gttgagggga gaagacgacg acgaccccgg cagacggctc cttaactttg 1380

ccagctctgt cgaccctgaa cccttttttt ccctcccctc ttctctcttt tgatcgaggg 1440

gttgccagct ctggatctga aattctgaac gcatgggacg cgagctgtgt gtagcatgaa 1500

taactgcgta gtttgttgga tggacgaact caatcgcgct cgcatggaat ggaactcttg 1560

taatccaccc tttgtacatt accatctaga gttgctcctt ttttccatga gccataaatg 1620

agtgcacctg ctgcctatta gttgttgccc ttttgctgct catatgcatc actgcagcat 1680

ttggttctca gaaaggatcg ttcattcagc cagcatccag ctatccaact ctcttgcttg 1740

cagttgttcc ggacaaagtg attggttggt agagcatcga ttcgag 1786

Claims

1.ZmCOL3The application of the gene and the protein thereof in improving the stem rot resistance of target plants is characterized in that the application comprises the regulation and control of the target plants in vivoZmCOL3The expression level of the gene improves the resistance of the target plant to the stem rot;

the above-mentionedZmCOL3The base sequence of the gene is shown as SEQ ID No. 1;

the regulation is positive regulation;

the target plant is a monocotyledon;

the stem rot is fusarium graminearum stem rot.