CN113603757A - Lilium regale Dirigent similar protein gene LrDI 1 and application - Google Patents

Abstract

The invention discloses a Lilium regale Dirigent analogous protein geneLrDIR1The nucleotide sequence is shown as SEQ ID NO. 1, and the protein with the amino acid sequence shown as SEQ ID NO. 2 is coded, and the invention is proved by related technical research of functional genomicsLrDIR1The gene has the function of improving the antifungal effect of plants, and the invention is antifungalLrDIR1The gene is constructed on a plant expression vector and is transferred into tobacco for over-expression, a transgenic tobacco plant has strong capability of resisting fungal infection, and the experimental result shows that the over-expression is realizedLrDIR1The transgenic tobacco is used for treating fusarium oxysporum and grass stemsInfestation by molds is resistant.

Description

Lilium regale Dirigent analogous protein geneLrDIR1And applications

Technical Field

The invention relates to the technical field related to molecular biology and genetic engineering, in particular to a lilium regale Dirigent similar protein gene with antifungal infection capacityLrDIR1And application thereof.

Background

Plants are more or less stressed by biotic or abiotic factors during their growth, limiting their growth and development to varying degrees, thereby affecting the development of the final economic and yield traits of the plants. Among various adverse stress factors, diseases caused by bacteria, fungi, viruses, etc. are major factors that impair the growth and development of plants. The cultivation of resistant plant species and the use of pesticides are the main methods for solving the problem of plant diseases at present. The traditional breeding mode has the defects of long period, difficulty in obtaining resistance sources, easiness in losing resistance of resistant varieties and the like, so that the problem of plant diseases cannot be fundamentally solved. In recent years, molecular biology and genetic engineering techniques are rapidly developed, a large number of disease-resistant genes are separated and cloned from different plants, the period for cultivating plant disease-resistant varieties by using the genetic engineering technique is short, and a new variety with strong resistance can be obtained by combining different disease-resistant genes, so that the defects of traditional disease-resistant breeding can be well overcome.

During the infection of plants by pathogens, the substances secreted by the pathogens induce the immune system of the plants to respond to the attack of the pathogens. Plant-pathogen interaction has been a research hotspot in phytopathology. In response to the attack by pathogenic bacteria, plants have evolved a variety of structural and resistance proteins against pathogenic bacteria. For example, plants produce lignin to strengthen cell walls, synthesize phytoalexins (e.g., toxic phenolic compounds), and accumulate various disease-related proteins (pathologically related proteins). In recent years, disease-related proteins, lectins, dirigent (dir), and the like have been attracting attention as plant-produced disease-resistant proteins.

The Dirigent protein was first produced by Davin et al in Forsythia suspensa (Forsythia intermedia) In (1) foundIt can capture free radicals of lignin monomers and direct them to form polymeric lignin and oligomeric lignans, which are further involved in plant defense reactions, while lignin can enhance the lignification degree of plant cell walls, increase the mechanical strength of cell walls, and further inhibit the infection of phytopathogens (Davin L B, Wang H B, brown a L, et al. Stereoselective biological chemical ligation by an animal pathogen an active center, Science 1997, 275: 362-. The firmness of the cell wall in plant cells directly affects their resistance to pathogenic bacteria. Lignin is a group of substances consisting of polymerized aromatic alcohols, present in the xylem, and mainly functions to harden the cell walls by forming a cross-woven network, being the primary component of secondary walls. The DIR protein family is also involved in the synthesis of lignans. Lignans are most isolated from magnolia bark, such as magnolol. The DIR protein family genes are divided into six subfamilies, namely DIR-a, DIR-b/d, DIR-c, DIR-e, DIR-f and DIR-G, sequence analysis shows that the sequence similarity among the six subfamilies is very low, wherein only DIR-a can guide lignin to synthesize a correct three-dimensional structure, and the biochemical functions of other subfamilies are not known, so that the subfamilies except DIR-a are also called DIR-like (DIR-like) genes (Ralph S G, Jancsik S, Bohlmann J. variant gene in gene promoter destination II: Extended gene discovery, phylogeny, and constraint and stress-induced gene expression vectorPicea spp.). Phytochemistry, 2007, 68(14): 1975-1991）。

DIR proteins have been found in many plants and studies have shown that DIR proteins affect the disease resistance and ability to resist abiotic stress in plants (Weidenbach D, Esch L, Mller C, et al. Polarized feed against fungal pathogens is mediated by the jacalin-related molecules of the modelPoaceaeMolecular Plant, 2016, 9(4): 514-. Wheat (Triticum aestivum L.)TaDIR13Overexpression in tobacco upregulated P.syringae: (Pseudomonas syringae) And Phytophthora nicotianae (Phytophthora nicotianae) Resistance (Qinghu Ma, Yunchao Liu. TaDIR13, a dirigent protein from wHeat, proteins biosyntheses and industries pathway resistance. Plant Molecular Biology Reporter, 2015, 33(1): 143-. When turnip (A), (B), (C)Brassica rapa) Inoculating Fusarium oxysporum (F.), (Fusarium oxysporum) After that, the air conditioner is started to work,BrDIR-like-2the expression level of (A) was significantly up-regulated, 5 times higher than that of (A) uninoculated (Arasan S T, Park J I, Ahmed N U, et al, Characterization and expression of differential family genes related to strains inBrassicaPlant Physiol Biochem, 2013, 67: 144-. Olive for preventing diseasesOlea europaea) In the variety of the strain,DIRthe transcription level of the gene is in Verticillium wilt bacterium (Verticillium dahliae) The early stages of infection are greatly increased (Leyva-Perez Mar i a de la O, Jimeez-Ruiz Jaime, G Lou mez-Lama Caban s Carmen, et al, Tolerance of olive: (Leyva-P rez Mar i a de la O, Jim nez-Ruiz Jaime, G Lou mez-Lama Caban s Carmen, et alOlea europaea) cv Frantoio to Verticilliumdahliae relies on both basal and pathogen-induced differential transcriptomic responses. The New phytologist, 2018, 217217: 671-686）。

The Bulbus Lilii is Liliaceae (Liliaceae) Lilium (Lilium)Lilium) The plant is a general term of perennial root flower. During the processes of seed ball propagation and fresh cut flower production, lily is vulnerable to various pathogenic bacteria such as fungi, viruses and bacteria. The lily diseases found at present are more than dozens, among which, the lily is from the genus Fusarium (A), (B), (CFusarium spp.) blight caused by fungi (also known as basal rot, stem rot) is the most serious disease in lily production. After the fusarium infects the lily seed balls, the basal disc is necrotic, the scales are rotted and fall off, and the quality of the seed balls is reduced; after the plants are infected by fusarium, the leaves turn yellow and droop wilting, and the plants die in advance, so that the yield and the quality of the cut lily flowers are seriously influenced. Wherein Fusarium oxysporum (F.), (F. oxysporum) The pathogenicity is strongest, the separation frequency is highest, and the lily is the main pathogenic bacterium of lily wilt. Lilium regale (Lilium regale)L. regale Wilson) is a unique species in China, is only distributed in rock cracks from valleys with the altitude of 800-. Dirigent is involved in responding to various biotic stresses and is an important group of plant defense systemsThe gene is a part, so that important research and application values are provided for the discovery and functional analysis of the Dirigent gene in Lilium regale.

Disclosure of Invention

The invention aims to provide a Lilium regale Dirigent analogous protein geneLrDIR1And its application in increasing the resistance of tobacco to Fusarium oxysporum (F.B.)F. oxysporum) Phoma graminearum (A) and (B)Phoma herbarum) Use in resistance.

The dirigent-like protein gene with antifungal activity, which is cloned from Lilium regaleLrDIR1The full-length gene of (a),LrDIR1the nucleotide sequence is shown as SEQ ID NO. 1, the gene cDNA full length sequence is 867bp, comprises an open reading frame of 504bp, a 5 'untranslated region of 146 bp, a 3' untranslated region of 217 bp, and encodes protein of the amino acid sequence shown as SEQ ID NO. 2.

In the inventionLrDIR1The coding region of the gene is a nucleotide sequence shown in the 147-650 th site of the sequence table SEQ ID NO: 1.

The invention separates and clones a complete cDNA segment of an antifungal related gene of Lilium regale, and utilizes agrobacterium tumefaciens (A), (B) and (C)Agrobacterium tumefaciens) The target gene is transferred into a receptor plant and is overexpressed, whether the gene has antifungal activity is verified through further experiments, a foundation is laid for the capability of improving tobacco and other plants to resist fungal diseases by utilizing the gene in the later period, and the inventor names the gene asLrDIR1。

As described aboveLrDIR1The gene can be applied to improving the antifungal property of tobacco, and the specific operation is as follows:

(1) using amplificationLrDIR1The specific primer is used for extracting total RNA from the root of Lilium regale after inoculating fusarium oxysporum and amplifying the total RNA by reverse transcription-polymerase chain reaction (RT-PCR)LrDIR1Then connecting the full-length coding region to a pGEM-T vector, and obtaining a clone with a target gene through sequencing;

(2) using restriction endonucleasesXbaI andEcoenzyme digestion of pGEM-T-LrDIR1Carrier, obtained by glue recoveryThe gene fragment is obtained by digesting the plant expression vector pCAMBIA2300s with the same endonuclease, recovering the gel to obtain the large fragment of the required vector, and obtaining the large fragment of the required vectorLrDIR1Connecting the gene fragment with the pCAMBIA2300s fragment to construct a plant overexpression vector, and then transferring the constructed recombinant vector into tobacco to express through the mediation of agrobacterium tumefaciens;

(3) screening transformants by using a resistance marker on the recombinant vector T-DNA, obtaining a real transgenic plant through PCR and RT-PCR detection, analyzing the capability of total protein of the transgenic plant leaf for inhibiting the growth of pathogenic fungi in vitro, and finally screening the transgenic plant with obviously enhanced resistance to the fungi.

The invention provides a new method for improving the resistance of plants to fungal diseases, overcomes the defects of the traditional breeding by cultivating disease-resistant plants by a genetic engineering means, shortens the breeding period, is simple to operate and is easy to obtain high-resistance materials. The invention is derived from Lilium regaleLrDIR1The gene can enhance the resistance of plants to fungi, and the gene is introduced into tobacco, so that new varieties and new materials with fungal resistance can be generated; the cultivation of resistant plant varieties and materials by utilizing the genetic engineering technology has obvious advantages and irreplaceable importance; the invention not only can provide convenience for large-scale production of crops, medicinal materials, horticultural plants and the like, greatly reduces the use of chemical pesticides, but also can save the cost for agricultural production and reduce the environmental pollution, thereby having wide market application prospect.

Drawings

FIG. 1 is a drawing of the present inventionLrDIR1PCR detection result graph of transgenic tobacco genome DNA, in the graph: the Marker is DL2000 DNA Marker (Dalibao biology); the positive control is plasmid pGEM-T-LrDIR1PCR products as templates; WT is the product of PCR using total DNA of non-transgenic tobacco (wild type) as template;

FIG. 2 shows the positivity of the present inventionLrDIR1In transgenic tobaccoLrDIR1A graph of the results of expression analysis at the transcriptional level; in the figure: marker is DL2000 DNA Marker (Dalibao biology); WT is a PCR product with non-transgenic tobacco total RNA reverse transcription cDNA as a template; the positive control was plasmid pGEM-T-LrDIR1As a template PCR product;

FIG. 3 is a drawing of the present inventionLrDIR1The analysis result graph of the in vitro antifungal activity of the transgenic tobacco; the fungi shown in panels a and b are Fusarium oxysporum and Phoma herbarum, respectively; WT was the wild type tobacco total protein and Buffer was the blank, i.e., no protein control (Buffer used to extract protein).

Detailed Description

The present invention is further illustrated by the following figures and examples, but the scope of the present invention is not limited to the above description, and the examples are conventional methods unless otherwise specified, and reagents used are conventional commercially available reagents or reagents formulated according to conventional methods unless otherwise specified.

Example 1:LrDIR1gene cloning and sequence analysis

Inoculating fusarium oxysporum to Lilium regale, extracting total RNA from roots inoculated for 24 hours, grinding the inoculated Lilium regale roots into powder by using liquid nitrogen, transferring the powder into a centrifuge tube, extracting the total RNA by using a guanidine isothiocyanate method, synthesizing a cDNA first chain by using reverse transcriptase M-MLV (promega) and using the total RNA as a template, wherein a reaction system and an operation process are as follows: taking 5 μ g of Total RNA, adding 50ng oligo (dT), 2 μ L dNTP (2.5 mM each) and DEPC water in sequence to the reaction volume of 14.5 μ L; after uniformly mixing, heating and denaturing at 70 ℃ for 5min, then rapidly cooling on ice for 5min, then sequentially adding 4 mu L of 5 XFirst-stand buffer, 0.5 mu L of RNase (200U) and 1 mu L M-MLV (200U), uniformly mixing and centrifuging for a short time, carrying out warm bath at 42 ℃ for 1.5h, taking out, heating at 70 ℃ for 10min, and stopping reaction; the first strand cDNA is synthesized and stored at-20 deg.C for further use.

Amplifying target gene using synthesized first strand cDNA as templateLrDIR1The sequences of the upstream and downstream primers used were 5 'CGCTAGCTGCAAAAAAGTTGA 3' and 5 'GAAACGATGAATAACCCATGATTTT 3', respectively. Advantage is taken^TM2 PCR Enzyme (Clontech) amplifies the target gene; and (3) PCR reaction conditions: 5min at 94 ℃; 30s at 94 ℃, 30s at 60 ℃, 1min at 72 ℃ and 32 cycles; 10min at 72 ℃; the reaction system (20. mu.L) was 0.5. mu.L of cDNA, 2. mu.L of 10 × Advantage 2 PCR Buffer, 0.4. mu.L of 50 × dNTP Mix (10 mM each), 0.4. mu.L of forward primer (10. mu.M), and 0.4. mu.L of reverse primerPrimers (10. mu.M), 0.4. mu.L of Advantage 2 PCR Polymerase Mix, 15.9. mu.L of PCR-Grade water; after the PCR was completed, 5. mu.L of the resulting mixture was subjected to agarose gel electrophoresis to examine the specificity and size of the amplified product.

The PCR product was TA cloned using pGEM-T Vector System I (Promega, USA) as a kit, and the reaction System and procedure were as follows: mu.L of the PCR product was taken, and 1. mu.L of pGEM-T Vector (50 ng/. mu.L) and 2.5. mu.L of 2 × Ligation solution I were sequentially added thereto, mixed well and then left to react at 16 ℃ overnight. The ligation product was transformed into E.coli DH 5. alpha. using a heat shock transformation method. Screening positive clones with LB solid medium containing ampicillin (Ampicillin, Amp), selecting several single colonies, shaking, and amplifyingLrDIR1Identifying the multiple cloning site insertionLrDIR1The clones identified are sequenced and finally obtainedLrDIR1The full-length cDNA was 867bp and was found to contain a 504bp open reading frame by NCBI ORF finder (http:// www.ncbi.nlm.nih.gov/gorf. html) analysis (see sequence listing),LrDIR1encodes a protein containing 167 amino acids, and has a molecular weight of about 17.69KDa and an isoelectric point of about 9.25. Analysis by means of bioinformatics software SignalP5.0LrDIR1The encoded protein sequence, detecting whether it has an N-terminal signal peptide; the results are shown inLrDIR1The signal peptide is present at the N-terminus of (A), and therefore the protein is presumed to be a secreted protein.

Example 2: construction of plant overexpression vectors

The insertion is extracted by adopting a SanPrep column type plasmid DNA small extraction kit (Shanghai worker)LrDIR1The E.coli plasmid pGEM-T-LrDIR1And the plasmid of the plant expression vector pCAMBIA2300s, taking 1 microliter to be used for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmid; using restriction endonucleasesXbaI (TaKaRa) andEcoRI (TaKaRa) against plasmid pGEM-T-LrDIR1And pCAMBIA2300s (100 mu L system), wherein the reaction system and the operation process are as follows: separately, 20. mu.L of pGEM-T-LrDIR1And pCAMBIA2300s plasmid, 10. mu.L 10 XK buffer, and 4. mu.LXbaI、6μL EcoRI、60μL ddH₂O, mixingAfter being homogenized, the mixture is centrifuged for a short time and is placed at 37 ℃ for overnight reaction; all the products of the digestion are spotted in agarose gel for electrophoresis, and thenLrDIR1The fragments and the pCAMBIA2300s vector large fragment are respectively subjected to gel recovery, and a SanPrep column type DNA gel recovery kit (Shanghai's engineering) is used in the whole process; taking 1 microliter of the recovered product, detecting the size and concentration of the recovered fragment by agarose gel electrophoresis, and storing at-20 ℃ for later use.

The recovered DNA was purified by using T4 DNA Ligase (TaKaRa)LrDIR1 The DNA fragment and the pCAMBIA2300s vector fragment were ligated, and the reaction system (20. mu.L) and the procedure were as follows: taking 10 μ LLrDIR1 The DNA fragment was sequentially added with 2. mu.L of pCAMBIA2300s vector DNA, 2. mu.L of 10 XT 4 DNA Ligase Buffer, 1. mu. L T4 DNA Ligase, and 5. mu.L of ddH₂And O, mixing uniformly, centrifuging for a short time, and then carrying out water bath at 16 ℃ for overnight reaction. The ligation product was then transferred into E.coli DH 5. alpha. by heat shock transformation, and positive clones were selected on a solid medium containing 50mg/L kanamycin (Km). Selecting single colony shake bacteria, taking bacteria liquid as template for amplificationLrDIR1The specific primers of (1) are subjected to PCR, and selectedLrDIR1If the detected strain is positive, the clone successfully connected with pCAMBIA2300s is added with glycerol and stored at-80 ℃ for later use.

Extraction and purification of pCAMBIA2300s-LrDIR1Plasmid, then freezing and thawing the plant expression vector pCAMBIA2300s-LrDIR1Transferred into Agrobacterium tumefaciens LBA4404 competent cells. The operation steps are as follows: taking 2 μ g of pCAMBIA2300s-LrDIR1The plasmid is added into a centrifuge tube containing 200 mu L of competent cells, the mixture is gently mixed and then is subjected to ice bath for 5min, then the mixture is transferred into liquid nitrogen to be frozen for 1min, then the mixture is rapidly placed in a water bath at 37 ℃ for 5min, then is subjected to ice bath for 2min immediately, and is added with 800 mu L of LB liquid culture medium to be subjected to shaking culture at 28 ℃ for 4 h. The activated agrobacterium is spread on LB solid culture medium containing 50mg/L Km and is statically cultured at 28 ℃. Selecting single colony shake bacteria, and amplifyingLrDIR1The specific primer of (2) is used for PCR to detect pCAMBIA2300s-LrDIR1If the positive clone is transferred into agrobacterium, adding glycerol into the positive clone, and storing the positive clone at-80 ℃ for later use.

Example 3: agrobacterium-mediated genetic transformation of plants and transgenic plant screens

The transgenic recipient in this experiment was tobacco, tobacco seeds were soaked in 75% ethanol for 30s, washed with sterile water and then washed with 0.1% HgCl₂Soaking for 8min, washing with sterile water for several times, sowing on 1/2MS culture medium, dark culturing at 28 deg.C for 6d, germinating, transferring to light incubator (25 deg.C, 16 h/d light), and subculturing with 1/2MS culture medium once a month.

The preserved liquid containing pCAMBIA2300s was taken out from the-80 ℃ refrigeratorLrDIR1Agrobacterium LBA4404 strain of plasmid was inoculated into 5mL LB liquid medium containing 50mg/L Km and 20mg/L rifampicin, and cultured at 28 ℃ until the medium became turbid. Sucking 1mL of turbid bacterial liquid to an LB solid culture medium containing 50mg/L Km, and culturing for 48h at 28 ℃; then, appropriate amount of the agrobacteria on LB solid medium was scraped and inoculated into MGL liquid medium supplemented with 20mg/L acetosyringone, and shake-cultured at 28 ℃ for 2-3 h to activate the agrobacteria.

Cutting sterile tobacco seedling leaf into 1cm²And completely soaking the left and right leaf discs in the MGL liquid culture medium containing the activated agrobacterium for 15min, sucking bacterial liquid on the surfaces of the leaves by using sterile filter paper, placing the leaf discs on a co-culture medium for room temperature culture, wherein the co-culture medium for tobacco transformation is MS +0.02 mg/L6-BA +2.1mg/L NAA +30g/L sucrose +6g/L agar, and co-culturing for 2 days at 22 ℃ in the absence of light.

Transferring the co-cultured leaf disc to an MS screening culture medium added with antibiotics to be divided into seedlings, and screening transgenic plants at the same time, wherein the tobacco screening culture medium is MS +0.5 mg/L6-BA +0.1mg/L NAA +30g/L sucrose +6g/L agar +50mg/L Km +200mg/L cephamycin (Cef); during screening culture, the culture bottle is transferred to an illumination culture box for culture (25 ℃, 16 h/d illumination and 8 h/d darkness), after the tobacco grows out of buds, the MS culture medium containing 50mg/L Km and 200mg/L Cef is used for subculture, the regeneration plant needs to be further screened because the callus differentiation rate of the tobacco is higher, the tobacco regeneration seedling is transferred to the MS culture medium containing 50mg/L Km to root the tobacco regeneration seedling, and finally the regeneration seedling with better rooting is selected for further detection.

Extracting by a CTAB methodTaking genome DNA of transgenic tobacco plant leaf, taking 1 mu L of the extracted genome DNA, detecting the integrity and concentration of the extracted genome DNA by agarose gel electrophoresis, and taking the genome DNA of the transgenic plant as a template for amplificationLrDIR1The specific primer of (2) is used for PCR, 8 mu L of product is used for agarose gel electrophoresis after the PCR is finished to detect positive transgenic plants, the amplification result of part of tobacco transgenic plants is shown in figure 1,LrDIR1and (4) screening 40 positive transgenic plants from the transgenic tobacco.

Example 4: in transgenic tobaccoLrDIR1Expression analysis and functional analysis of transgenic plants against fungal infection

Taking positive transgenic single plant and tender leaf of non-transgenic tobacco (wild type) to extract total RNA, reverse transcribing to generate first strand cDNA, and using it as template to make amplificationLrDIR1The specific primers are used for carrying out PCR, and each transgenic individual is analyzed according to the PCR resultLrDIR1The expression of transcription level, total RNA extraction and RT-PCR were performed as in example 1, after PCR was completed, 8. mu.L of the DNA was subjected to agarose gel electrophoresis, and the results of detection of some individuals were shown in FIG. 2, and 35 transgenic individuals were detected in totalLrDIR1The expression was carried out at the transcriptional level in a large amount, and the numbers of these individuals were 1 to 35.

Several kinds of pathogenic fungi stored in a laboratory are inoculated on a PDA solid culture medium (200 g/L of potato, 15g/L of agar and 20g/L of glucose), dark culture is carried out at 28 ℃, plant protein is added when bacterial colonies grow to be about 2-3cm in diameter, and the in-vitro antifungal activity of transgenic plants is analyzed. In order to prevent other bacteria from polluting the extracted protein, the whole process of extracting the vegetable protein is aseptic operation. Firstly, 1 g of single transgenic tobacco plant (numbered L-4, L-7 and L-8 respectively) and wild type leaves are put into a mortar, 1mL of protein extract (1M NaCL, 0.1M sodium acetate and 1% PVP, pH6.0) is added, and the mixture is fully ground. Transferring into a 1.5mL centrifuge tube, mixing uniformly, and standing overnight at 4 ℃. Centrifuge at 4 deg.C for 30min (12,000g/min), take the supernatant in a new 1.5mL centrifuge tube, and take an appropriate amount to determine the total protein concentration with an ultraviolet spectrophotometer. The total protein concentration of the transgenic and wild type plants was adjusted to 0.2. mu.g/. mu.L, and then 20. mu.L of each was dropped onto sterile filter paper of each fungal culture. In each fungusThe plate of (2) was supplemented with total proteins of different transgenic tobacco plants, and simultaneously with total proteins of wild type tobacco and a blank (protein extract) in parallel. The growth of the fungus was observed after several days of cultivation at 28 ℃ and evaluated based on the observationLrDIR1The results of the in vitro antifungal activity of the transgenic tobacco are shown in FIG. 3,LrDIR1the transgenic tobacco protein has obvious inhibition effect on the growth of fusarium oxysporum and phoma graminearum.

Sequence listing

<110> university of Kunming science

<120> Lilium regale Dirigent analogous protein gene LrDI 1 and application

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 867

<212> DNA

<213> Lilium regale Wilson

<400> 1

cgctagctgc aaaaaagttg accaagacag cttcatccta cctgccggtt catacaagag 60

aataatcgtt tgtatcctct atatatatct cacaacataa cgaacctctc tcatctcatc 120

tctcaagctt cccactactt gttccaatgg ccttcaattt ccccagcctc ctcctactct 180

tattagccgc caccacctcc tttgcagtac tagctacagc caagaagacc cagttgcagt 240

tctacgtaca cgtcataaac agcggcccca atgccaccac cgccgtagta gcaggcctca 300

acaagacatc ttccgcattc ggaaacatcg acgtgtacga caacatactg cgagtaggga 360

cagatccaag ctcagcaatc atcggaagga tccagggaat cgatgcccag gcttcactgg 420

gttcgccagc agtgacagcg gtgtacaatt ttgtgttcac aggtggtgcg tacaacggga 480

gcactcttgg catgatgggc taccatatca tgagccagcc gacatgggag cagagcgtga 540

ttgcagggac agggcagttc cgtctcgctc gaggatatgc aatagcgcag ctcgtcagct 600

acacccccgc ctacatagtc atcaacttca acgcttatgt tcttcattag atcttcatta 660

cagtataatg tttctgtttc tgttatgtat gttaaaacat caataaatct gtgtgccctt 720

tcatcaataa aactgttaca gaaaattcac tttgccgggc caaaactatg tacttaacac 780

caactttgat gacattactc gataaactca tttgagagaa tgtaaacaca gattgacaat 840

ataaaatcat gggttattca tcgtttc 867

<210> 2

<211> 167

<212> PRT

<213> Lilium regale Wilson

<400> 2

Met Ala Phe Asn Phe Pro Ser Leu Leu Leu Leu Leu Leu Ala Ala Thr

1 5 10 15

Thr Ser Phe Ala Val Leu Ala Thr Ala Lys Lys Thr Gln Leu Gln Phe

20 25 30

Tyr Val His Val Ile Asn Ser Gly Pro Asn Ala Thr Thr Ala Val Val

35 40 45

Ala Gly Leu Asn Lys Thr Ser Ser Ala Phe Gly Asn Ile Asp Val Tyr

50 55 60

Asp Asn Ile Leu Arg Val Gly Thr Asp Pro Ser Ser Ala Ile Ile Gly

65 70 75 80

Arg Ile Gln Gly Ile Asp Ala Gln Ala Ser Leu Gly Ser Pro Ala Val

85 90 95

Thr Ala Val Tyr Asn Phe Val Phe Thr Gly Gly Ala Tyr Asn Gly Ser

100 105 110

Thr Leu Gly Met Met Gly Tyr His Ile Met Ser Gln Pro Thr Trp Glu

115 120 125

Gln Ser Val Ile Ala Gly Thr Gly Gln Phe Arg Leu Ala Arg Gly Tyr

130 135 140

Ala Ile Ala Gln Leu Val Ser Tyr Thr Pro Ala Tyr Ile Val Ile Asn

145 150 155 160

Phe Asn Ala Tyr Val Leu His

165

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence (Artificial)

<400> 3

cgctagctgc aaaaaagttg a 21

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence (Artificial)

<400> 4

gaaacgatga ataacccatg atttt 25

Claims (2)

1. Lilium regale Dirigent analogous protein geneLrDIR1The nucleotide sequence is shown in SEQ ID NO. 1.

2. Lilium regale Dirigent analogous protein gene as claimed in claim 1LrDIR1In increasing the resistance of tobacco to fusarium oxysporum (F.), (Fusarium oxysporum) Phoma graminearum (A) and (B)Phoma herbarum) Use in resistance.

Images