CN110818782B - Lilium regale WRKY transcription factor gene LrWRKY3 and application thereof - Google Patents

Abstract

The invention discloses a Lilium regale WRKY transcription factor geneLrWRKY3The nucleotide sequence is shown as SEQ ID NO:1, encoding the polypeptide shown as SEQ ID NO:2, the invention is proved by related technical research of functional genomicsLrWRKY3The gene has the function of improving the plant antifungal property, and the invention is used for resisting the fungiLrWRKY3The gene is constructed on a plant expression vector and is transferred into tobacco for over-expression, a transgenic tobacco plant has strong capability of resisting fungal infection, and the experimental result shows that the over-expression is realizedLrWRKY3The transgenic tobacco leaf has strong resistance to infection of five pathogenic fungi such as fusarium graminearum, botrytis cinerea, fusarium verticillioides, fusarium solani and the like.

Description

Lilium regale WRKY transcription factor gene LrWRKY3 and application thereof

Technical Field

The invention relates to the field of research of related technologies of molecular biology and genetic engineering, in particular to a Lilium regale WRKY transcription factor gene with antifungal infection capacityLrWRKY3And application thereof.

Background

Plant diseases are a very troublesome problem in agricultural production, especially fungal diseases, accounting for about 80% of the total plant diseases, and seriously affecting the yield and quality of crops. Plants have an innate immune system to avoid pathogenic invasion, including a complex network that tightly regulates defense responses, transcription factors play an important role in plant disease resistance as signal pathway regulatory genes, particularly WRKYThe transcription factor family, which is involved in the regulation of biological and abiotic defenses (Agarwal P, Patel K, Agarwal PK. Ectopic expression ofJcWRKY confers enhanced resistance in transgenic tobacco against Macrophomina phaseolina. DNA Cell Biol, 2018, 37(4): 298-307.)。

The WRKY transcription factor is one of the largest transcription factors in plants, and has a WRKY structural domain at the N-terminal of the protein. The WRKY domain has a conserved WRKYGQK amino acid sequence, usually associated with a cis-acting element known as the W box (W box, C/TTGACT/C). The core structure of the cis-acting element of the WRKY protein and the promoter region of the target gene is the W-box specific binding of TTGAC (C/T), i.e. all the genes containing W-box in the promoter can be the target gene of WRKY, including WRKY itself (Dong J, Chen C, Chen ZArabidopsisWRKY gene superfamily reducing Plant feedback response. Plant Mol Biol, 2003, 51(1): 21-37.). The WRKY domain is composed of four-stranded β sheets, with conserved WRKYGQK residues corresponding to the N-terminal β sheet (strand β -1) and capable of entering the major groove of the DNA duplex and interacting with the W-box on the DNA (Ciolkowski I, Wanke D, Birkenbihl RP, et al. students on DNA-binding selection of WRKY transcription factors into the WRKY-domain function. Plant Mol Biol, 2008, 68(1-2): 81-92.).

WRKY transcription factors are reprogrammed to cope with the invasion of different pathogens by regulating the plant transcriptome. The expression of downstream target genes is positively or negatively regulated by participating in different regulation pathways, including participating in hormone signal pathways, interacting with other members of the WRKY transcription factor family and the like. Grape WRKY transcription factor geneVqWRKY52Ectopic expression in Arabidopsis enhances the control of powdery mildew and Pseudomonas syringae ((R))Pseudomonas syringae pv. tomato DC 3000) (Wang X, Guo R, Tu M, et al, Ectopic expression of the wire vane WRKY transformation factor VqWRKY52 inArabidopsis thaliana enhances resistance to the biotrophic pathogen powdery mildew But Not to the necrotrophic pathogen Botrytis cinereaFront Plant Sci, 2017, 8: 97.). Withania somnifera (Withania somnifera）WsWRKY1Overexpression in tobacco improves tolerance to biotic stress (Singh AK, Kumar SR, Dwivedi V, et al. A WRKY transcription factor from)Withania somniferaA regulated tertiary polysaccharide with polysaccharide accumulation and biological strain passage through modulation of phytosterol and feed pathways, New Phytol, 2017, 215(3): 1115 and 1131.). In addition, chickpeasCaWRKY40Up-regulating the expression of defense-related genes to enhance resistance to Fusarium oxysporum (F.) (Fusarium oxysporum) Resistance (Chakraborty J, Ghosh P, Sen S, et al, CamPK9 secretion of the stability of CaWRKY40 secretion factor which trigger sensitivity in chickpea uponFusariumoxysporum f. sp. ciceri Race1 infection. Plant Mol Biol, 2019, 100(4-5): 411-431.）。

Flax (2)Linum usitatissimum) The transcription factor LuWRKY36 plays a key regulation role in the defense reaction of resisting fusarium oxysporum through the mediation of hormone and calcium signal pathways, and LuWRKY36 is used for up-regulation and control under the condition of biological stressLuPLR1Biosynthesis of genes and Lignin (Markulin L, Corbin C, Renouard S, et al, Characterization of LuWRKY36, a Flax transformation factor promoting Secoisolariciresinol biosyntheses in response toFusarium oxysporum elicitors in Linum usitatissimum L, hairpin roots, Planta, 2019, 250(1): 347-. Strawberry (A)Fragaria vesca) WRKY transcription factor FvWRKY42 interacting with various stress-related proteins and over-expressing in Arabidopsis thalianaFvWRKY42Resulting in cell death, sporulation and slow hyphal growth to enhance resistance to powdery mildew and up-regulation in ArabidopsisPR1Expression of the Gene (Wei W, Cui MY, Hu Y, et al, Ectopic expression ofFvWRKY42, a WRKY transcription factor from the diploid woodland strawberry (Fragaria vesca), enhances resistance to powdery mildew, improves osmotic stress resistance, and increases abscisic acid sensitivity in ArabidopsisPlant Sci, 2018, 275: 60-74.). Arabidopsis thaliana (Arabidopsis) Transcription factor AtWRKY50 andPR1the co-expression of the two promoter elements TGA2 or TGA5 enhances salicylic acid(SA) inducible marker GenePR1Expression level of (Hussain RMF, Sheikh AH, Haider I, et al. Arabidopsis WRKY50 and TGA Transcription Factors synergy Expression ofPR1Front Plant Sci, 2018, 9: 930). In addition, WRKY transcription factors including pepper CaWRKY22, CaWRKY6, CaWRKY27, CaWRKY40 and CaWRKY58 are integrated to form a sub-regulation network, and the signal pathway mediated by salicylic acid, jasmonic acid and ethylene is used for positively regulating pseudomonas solanacearum (B)Ralstonia Solanacearum) Resistance of (Hussain A, Li X, Weng Y, et al, CaWRKY22 actas as a reactive Regulator in Pepper Response toRalstonia Solanacearumby stabilizing Networks with CaWRKY6, CaWRKY27, CaWRKY40, and CaWRKY58. Int J Mol Sci, 2018, 19(5): E1426.). WhileCaWRKY40bThe immune related gene is regulated to play a negative regulation role in resisting ralstonia solanacearum of the hot pepper (Ifnan Khan M, Zhang Y, Liu Z, et al).CaWRKY40b in pepper acts as a negative regulator in response to Ralstonia solanacearum by directly modulating defense genes including CaWRKY40. Int J Mol Sci, 2018, 19(5): E1403.)。

The Bulbus Lilii is of Liliaceae (Liliaceae) genus Lilium (Liliaceae)Lilium) The plant is a general term of perennial root flower. During the processes of seed ball propagation and fresh cut flower production, lily is vulnerable to various pathogenic bacteria such as fungi, viruses and bacteria. The lily diseases found at present are more than dozens, among which, the lily is from the genus Fusarium (A), (B), (CFusarium) Blight (also called basal rot and stem rot) caused by fungi is the most serious disease in lily production. After the fusarium infects the lily seed balls, the basal disc is necrotic, the scales are rotted and fall off, and the quality of the seed balls is reduced; after the plants are infected by fusarium, the leaves turn yellow and droop wilting, and the plants die in advance, so that the yield and the quality of the cut lily flowers are seriously influenced. The pathogen of the lily wilt is mainly fusarium oxysporum, China is an important origin of lily and has rich lily germplasm resources, such as wild grown Lilium regale (R) ((R))L. regale) High resistance to Fusarium oxysporum. Lilium regale is a unique species in China, is only distributed in rock cracks from valleys with the altitude of 800-2700 m in the Lilium regale watershed to the waists, and hasHas extremely strong antifungal and antiviral properties, and is an important germplasm resource for modern lily breeding. Due to the influence of factors such as frequent geological disasters, artificial mining, wasteland exploitation, tree planting and afforestation, the distribution area and the number of the Lilium regale wild resources are obviously reduced, the Lilium regale wild resources are listed as endangered species by the world natural protection alliance, and the protection of the rare Lilium regale wild resources is urgent. Therefore, the full development and utilization of the disease-resistant gene of the Lilium regale is imperative. The WRKY transcription factor is a key regulating factor for plant disease-resistant defense reaction, and the WRKY transcription factor gene related to disease resistance is discovered from the Lilium regale, so that the disease-resistant regulation mechanism of the Lilium regale can be deeply known, and a candidate disease-resistant gene can be provided for disease-resistant genetic engineering.

Disclosure of Invention

The invention aims to provide a Lilium regale WRKY transcription factor geneLrWRKY3And application thereof, namely improving the effect of tobacco on the black sporotrichum oryzae (B)Nigrospora oryzae) Staphylococus viticola (A. vinifera)Botryosphaeria dothidea) Fusarium graminearum (F.graminearum)F. graminearum) Fusarium verticillatum (A)F. verticillioides) Fusarium solani (F.solani) (II)F. solani) Use in resistance.

The invention relates to a full-length gene of a WRKY transcription factor with antifungal activity, which is cloned from Lilium regaleLrWRKY3The nucleotide sequence is shown as SEQ ID NO. 1, the gene cDNA full-length sequence is 722 bp, comprises an open reading frame of 537 bp, a5 'untranslated region of 19 bp and a 3' untranslated region of 166 bp, and encodes the protein of the amino acid sequence shown as SEQ ID NO. 2.

In the inventionLrWRKY3The coding region of the gene is a nucleotide sequence shown in 20 th to 556 th positions in a sequence table SEQ ID NO. 1.

The invention separates and clones a complete cDNA segment of an antifungal related gene of Lilium regale, and utilizes agrobacterium tumefaciens (A), (B) and (C)Agrobacterium tumefaciens) The target gene is transferred into a receptor plant and is overexpressed, whether the gene has antifungal activity is verified through further experiments, and a foundation is laid for improving the capability of tobacco and other plants for resisting fungal diseases by utilizing the gene in the later periodThis gene was namedLrWRKY3。

As described aboveLrWRKY3The gene can be applied to improving the antifungal property of tobacco, and the specific operation is as follows:

(1) using amplificationLrWRKY3The specific primer is used for extracting total RNA from the root of Lilium regale after inoculating fusarium oxysporum and amplifying the total RNA by reverse transcription-polymerase chain reaction (RT-PCR)LrWRKY3Then connecting the full-length coding region to a pGEM-T vector, and obtaining a clone with a target gene through sequencing;

(2) using restriction endonucleasesXbaI andEcoRi enzyme digestion pGEM-T-LrWRKY3Recovering the carrier by glue to obtain target gene segment, using the same endonuclease to enzyme-cut plant expression carrier pCAMBIA2300s, recovering the glue to obtain the required carrier large segment, and recovering the obtained carrier large segmentLrWRKY3Connecting the gene fragment with the pCAMBIA2300s fragment to construct a plant overexpression vector, and then transferring the constructed recombinant vector into tobacco to express through the mediation of agrobacterium tumefaciens;

(3) screening transformants by using the resistance marker on the recombinant vector T-DNA, obtaining a real transgenic plant through PCR and RT-PCR detection, analyzing the resistance level of the transgenic plant to different pathogenic fungi, and finally screening the transgenic plant with obviously enhanced fungal resistance.

The invention provides a new method for improving the resistance of plants to fungal diseases, the defects of traditional breeding can be overcome by cultivating disease-resistant plants by means of genetic engineering, the breeding period is shortened, the operation is simple, and high-resistance materials are easy to obtain. The invention is derived from Lilium regaleLrWRKY3The gene can enhance the resistance of plants to fungi, and can be introduced into tobacco to produce new varieties and new materials with fungal resistance. The cultivation of resistant plant varieties and materials by using genetic engineering technology has obvious advantages and irreplaceable importance. It not only can provide convenience for large-scale production of crops, medicinal materials, flowers, nursery stocks and the like, greatly reduces the use of chemical pesticides, but also can save the cost for agricultural production and reduce the environmental pollution, so that the invention has wide marketAnd (4) field application prospect.

Drawings

FIG. 1 is a drawing of the present inventionLrWRKY3PCR detection result graph of transgenic tobacco genome DNA, in the graph: the Marker is DL2000 DNA Marker (Dalibao biology); the positive control is plasmid pGEM-T-LrWRKY3PCR products as templates; WT is the product of PCR using total DNA of non-transgenic tobacco (wild type) as template;

FIG. 2 shows the positivity of the present inventionLrWRKY3In transgenic tobaccoLrWRKY3A graph of the results of expression analysis at the transcriptional level; in the figure: marker is DL2000 DNA Marker (Dalibao biology); WT is a PCR product with non-transgenic tobacco total RNA reverse transcription cDNA as a template; the positive control was plasmid pGEM-T-LrWRKY3A PCR product as a template;

FIG. 3 is a drawing of the present inventionLrWRKY3A result graph of the disease resistance identification of the transgenic tobacco; in the figure, a, b, c, d and e are tobacco leaves inoculated with fusarium graminearum, fusarium verticillium, botrytis cinerea and fusarium solani respectively; WT is leaf of wild type tobacco, 19, 20, 27, 34 areLrWRKY3Leaves of transgenic tobacco.

Detailed Description

The present invention is further illustrated by the following figures and examples, but the scope of the present invention is not limited to the above description, and the examples are conventional methods unless otherwise specified, and reagents used are conventional commercially available reagents or reagents formulated according to conventional methods unless otherwise specified.

Example 1:LrWRKY3full-Length Gene cloning and sequence analysis

Inoculating fusarium oxysporum to Lilium regale, extracting total RNA from roots inoculated for 24 hours, grinding the inoculated Lilium regale roots into powder by liquid nitrogen, transferring the powder into a centrifuge tube, extracting the total RNA by adopting a guanidine isothiocyanate method, synthesizing a cDNA first chain by adopting reverse transcriptase M-MLV (promega) and taking the total RNA as a template, wherein a reaction system and an operation process are as follows: taking 5 μ g of Total RNA, adding 50 ng oligo (dT), 2 μ L dNTP (2.5 mM each) and DEPC water in sequence to the reaction volume of 14.5 μ L; after uniformly mixing, heating and denaturing at 70 ℃ for 5 min, then rapidly cooling on ice for 5 min, then sequentially adding 4 mu L of 5 XFirst-stand buffer, 0.5 mu L of RNase (200U) and 1 mu L M-MLV (200U), uniformly mixing and centrifuging for a short time, carrying out warm bath at 42 ℃ for 1.5 h, taking out, heating at 70 ℃ for 10 min, and stopping reaction; the first strand cDNA is synthesized and stored at-20 deg.C for further use.

Amplifying target gene using synthesized first strand cDNA as templateLrWRKY3The sequences of the upstream and downstream primers used were 5 'ATTCATGGAGAGCTTCCCCCTAC 3' and 5 'TGGTGCATTGGCTTATTATACTCAT 3', respectively. Advantage is taken^TM2 PCR Enzyme (Clontech) amplifies the target gene; and (3) PCR reaction conditions: 5 min at 94 ℃; 30s at 94 ℃, 30s at 58 ℃, 40 s at 72 ℃ and 32 cycles; 7 min at 72 ℃; the reaction system (20. mu.L) was 0.5. mu.L of cDNA, 2. mu.L of 10 × Advantage 2 PCR Buffer, 0.4. mu.L of 50 × dNTP Mix (10 mM each), 0.4. mu.L of forward primer (10. mu.M), 0.4. mu.L of reverse primer (10. mu.M), 0.4. mu.L of Advantage 2 PCR Polymerase Mix, 15.9. mu.L of PCR-Grade water; after the PCR was completed, 5. mu.L of the resulting mixture was subjected to agarose gel electrophoresis to examine the specificity and size of the amplified product.

The electrophoresis detection result shows that the PCR product has only one DNA band, the TA cloning is directly carried out on the PCR product, the used kit is pGEM-T easy Vector System I (Promega, USA), and the reaction System and the operation process are as follows: mu.L of the PCR product was taken, and 1. mu.L of pGEM-T vector (50 ng/. mu.L) and 2.5. mu.L of 2 × Ligation solution I were sequentially added thereto, mixed well and then allowed to react overnight at 16 ℃. The ligation product was transformed into E.coli DH 5. alpha. using a heat shock transformation method. Screening positive clones with LB solid medium containing ampicillin (Ampicillin, Amp), selecting several single colonies, shaking, and amplifyingLrWRKY3Identifying the multiple cloning site insertionLrWRKY3The clones identified are sequenced and finally obtainedLrWRKY3The full-length cDNA was 722 bp and was found to contain a 537 bp open reading frame by NCBI ORF finder (http:// www.ncbi.nlm.nih.gov/gorf. html) analysis (see sequence listing),LrWRKY3encodes a protein LrWRKY3 containing 178 amino acids, has a molecular weight of about 20.32 KDa, an isoelectric point of about 9.49, and contains 2 cysteine residues. Analysis by means of bioinformatics software SignalP 4.1LrWRKY3The encoded protein sequence, and detecting whether the protein sequence has an N-terminal signal peptide. The results are shown inLrWRKY3No signal peptide was detected, indicating thatLrWRKY3Is a non-secreted protein. LrWRKY3 has 1 WRKYGQK conserved domain followed by a C2H2 (C-X4-C-X22/23-H-X1-H) type zinc finger motif. It is clear that,LrWRKY3the encoded protein belongs to class II WRKY transcription factors.

Example 2: construction of plant overexpression vectors

The insertion is extracted by adopting a SanPrep column type plasmid DNA small extraction kit (Shanghai worker)LrWRKY3The E.coli plasmid pGEM-T-LrWRKY3And the plasmid of the plant expression vector pCAMBIA2300s, taking 1 microliter to be used for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmid; using restriction endonucleasesXbaI (TaKaRa) andEcoRi (TaKaRa) and plasmid pGEM-T-LrWRKY3And pCAMBIA2300s (100 mu L system), wherein the reaction system and the operation process are as follows: 20 μ L of pGEM-T-LrWRKY3And pCAMBIA2300s plasmid, 10. mu.L 10 XM buffer, 4. mu.LXbaI、6 μL EcoRI、60 μL ddH₂O, mixing uniformly, centrifuging for a short time, and reacting at 37 ℃ overnight; all the products of the digestion are spotted in agarose gel for electrophoresis, and thenLrWRKY3The fragments and the pCAMBIA2300s vector large fragment are respectively subjected to gel recovery, and a SanPrep column type DNA gel recovery kit (Shanghai's engineering) is used in the whole process; taking 1 microliter of the recovered product, detecting the size and concentration of the recovered fragment by agarose gel electrophoresis, and storing at-20 ℃ for later use.

The recovered DNA was purified by using T4 DNA Ligase (TaKaRa)LrWRKY3 The DNA fragment and the pCAMBIA2300s vector fragment were ligated, and the reaction system (20. mu.L) and the procedure were as follows: taking 10 μ LLrWRKY3 The DNA fragment was sequentially added with 2. mu.L of pCAMBIA2300s vector DNA, 2. mu.L of 10 XT 4 DNA Ligase Buffer, 1. mu. L T4 DNA Ligase, and 5. mu.L of ddH₂And O, mixing uniformly, centrifuging for a short time, and then carrying out water bath at 16 ℃ for overnight reaction. The ligation products were then transferred into E.coli DH 5. alpha. by heat shock transformation, and screened for positivity using a solid medium containing 50 mg/L kanamycin (Km)And (4) cloning. Selecting single colony shake bacteria, taking bacteria liquid as template for amplificationLrWRKY3The specific primers of (1) are subjected to PCR, and selectedLrWRKY3If the detected strain is positive, the clone successfully connected with pCAMBIA2300s is added with glycerol and stored at-80 ℃ for later use.

Extracting and purifying pCAMBIA2300s-LrWRKY3A plasmid. Then the plant expression vector pCAMBIA2300s constructed above is frozen and thawed by liquid nitrogenLrWRKY3Transferred into Agrobacterium tumefaciens LBA4404 competent cells. The operation steps are as follows: taking 2 μ g of pCAMBIA2300s-LrWRKY3The plasmid is added into a centrifuge tube containing 200 mu L of competent cells, the mixture is gently mixed and then is subjected to ice bath for 5 min, then the mixture is transferred into liquid nitrogen to be frozen for 1 min, then the mixture is rapidly placed in a water bath at 37 ℃ for 5 min, then is subjected to ice bath for 2 min immediately, and is added with 800 mu L of LB liquid culture medium to be subjected to shaking culture at 28 ℃ for 4 h. The activated agrobacterium is smeared on LB solid culture medium containing 50 mg/L Km and is statically cultured at 28 ℃. Selecting single colony shake bacteria, and amplifyingLrWRKY3The specific primer of (2) is used for PCR to detect pCAMBIA2300s-LrWRKY3If the positive clone is transferred into agrobacterium, adding glycerol into the positive clone, and storing the positive clone at-80 ℃ for later use.

Example 3: agrobacterium-mediated genetic transformation of plants and transgenic plant screens

The transgenic recipient in this experiment was tobacco, tobacco seeds were soaked in 75% ethanol for 30s, washed with sterile water and then washed with 0.1% HgCl₂Soaking for 8min, washing with sterile water for several times, sowing on 1/2MS culture medium, dark culturing at 28 deg.C for 6d, germinating, transferring to light incubator (25 deg.C, 16 h/d light), and subculturing with 1/2MS culture medium once a month.

The preserved liquid containing pCAMBIA2300s was taken out from the-80 ℃ refrigeratorLrWRKY3Agrobacterium LBA4404 strain of plasmid was inoculated into 5 mL LB liquid medium containing 50 mg/L Km and 20 mg/L rifampicin, and cultured at 28 ℃ until the medium became turbid. Sucking 1 mL of turbid bacterial liquid to an LB solid culture medium containing 50 mg/L Km, and culturing for 48 h at 28 ℃; then, the agrobacterium on the LB solid medium is scraped to be inoculated to MGL liquid added with 20 mg/L acetosyringoneIn the culture medium, the Agrobacterium is activated by shaking culture at 28 ℃ for 2-3 h.

Cutting sterile tobacco seedling leaf into 1 cm²And completely soaking the left and right leaf discs in the MGL liquid culture medium containing the activated agrobacterium for 15 min, sucking bacterial liquid on the surfaces of the leaves by using sterile filter paper, placing the leaf discs on a co-culture medium for room temperature culture, wherein the co-culture medium for tobacco transformation is MS +0.02 mg/L6-BA +2.1 mg/L NAA +30 g/L sucrose +6 g/L agar, and co-culturing for 2 days at 22 ℃ in the absence of light.

Transferring the co-cultured leaf discs to an MS screening culture medium added with antibiotics to be divided into seedlings, and screening transgenic plants. The tobacco screening culture medium is MS +0.5 mg/L6-BA +0.1 mg/L NAA +30 g/L sucrose +6 g/L agar +50 mg/L Km +200 mg/L cephamycin (cefixime sodium salt, Cef); during screening culture, the culture bottle is transferred to an illumination culture box for culture (25 ℃, 16 h/d illumination and 8 h/d darkness), after the tobacco grows out of buds, the MS culture medium containing 50 mg/L Km and 200 mg/L Cef is used for subculture, the regeneration plant needs to be further screened because the callus differentiation rate of the tobacco is higher, the tobacco regeneration seedling is transferred to the MS culture medium containing 50 mg/L Km to root the tobacco regeneration seedling, and finally the regeneration seedling with better rooting is selected for further detection.

Extracting genome DNA of transgenic tobacco plant leaf by CTAB method, collecting 1 μ L of the extracted genome DNA, detecting its integrity and concentration by agarose gel electrophoresis, and amplifying with the genome DNA of transgenic plant as templateLrWRKY3After the PCR is finished, 8 mu L of the product is used for agarose gel electrophoresis to detect positive transgenic plants, the amplification result of part of tobacco transgenic plants is shown in figure 1,LrWRKY350 positive transgenic plants are screened out from the transgenic tobacco.

Example 4: in transgenic tobaccoLrWRKY3Expression analysis and functional analysis of transgenic plants against fungal infection

Taking positive transgenic single plant and tender leaf of non-transgenic tobacco (wild type) to extract total RNA, reverse transcribing to generate first strand cDNA, and using it as template to make amplificationLrWRKY3The specific primers of (a) are subjected to PCR, and the results of the PCR are determined based on the results of the PCRAnalysis in individual transgenic plantsLrWRKY3The expression of transcription level, total RNA extraction and RT-PCR were performed in the same manner as in example 1, after PCR was completed, 5. mu.L of the DNA was subjected to agarose gel electrophoresis, and the results of detection of some individuals were shown in FIG. 2, and 45 transgenic individuals were detected in totalLrWRKY3The expression is carried out in a large amount at the transcription level, and the numbers of the individual strains are 1-45.

Several fungi stored in the laboratory were inoculated on PDA solid medium (200 g/L potato, 15 g/L agar, 20 g/L glucose) and cultured in the dark at 28 ℃ for 7 d. Tobacco leaves of good growth, uniform size and full extension in the greenhouse were selected and cut from the petioles with surgical scissors. And pricking wounds with the same size at the same positions of the blades by using a sterile plastic gun head, and respectively inoculating pathogenic fungus blocks with the same size. Placing the inoculated leaves in a flat plate paved with sterile water-soaked filter paper, culturing in a light incubator at 28 ℃, and adding water every day for moisturizing. After 7d of culture, the leaves were collected and observed for the onset of disease in each line. As shown in FIG. 3, after inoculation of five pathogenic fungi, i.e., Fusarium graminearum, Fusarium verticillium, Staphylomyces viticola, and Fusarium solani, the leaves of the wild type tobacco formed large lesions, and yellowing and rotting of the leaves occurred. However, the onset of symptoms in transgenic tobacco is slight, and the lesion area formed is much smaller than that in wild tobacco, which is seen in the followingLrWRKY3The transgenic tobacco has strong infection resistance to fusarium graminearum, fusarium verticillium, botrytis cinerea and fusarium solani.

Sequence listing

<110> university of Kunming science

<120> Lilium regale WRKY transcription factor gene LrWRKY3 and application

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 722

<212> DNA

<213> Lilium regale Wilson

<400> 1

ctctctctct ctctcattca tggagagctt ccccctactc ctgaacaatc aaccatcttc 60

atcttatcac ttgccatcca attttgtgag caccagccag ctcttttcca acccacagaa 120

caccatttca aatgggttct tggggttgaa ggaggagacc gtggcttcat ccagctcaaa 180

tgttcaatca gcgattcaaa tggaagcctt ccggggatcc tccgagacca atgccaaaca 240

aggcaaaaag aagggagaca agaaggcgaa gaggccgcgg ttcgccttcc agacccggag 300

caaggtcgat attcttgacg acggctatcg ctggaggaag tatggccaga aggcagtgaa 360

gaacaacaac ttcccaagga gctattatcg gtgcacgcat caaggttgtg atgtgaagaa 420

gcaagttcag cgcctatcaa aagatgagga ggttgtggtc accacttacg agggagtaca 480

tactcacccc atcgagaaat caaacgacaa ctttgagcac atcttaaacc aaatgcaagt 540

ctattcgagc ttttgatcta tgaatgatca tagtaagatt gtttgtaaaa gaaaattcct 600

accacgttaa tgcatgagta taataagcca atgcaccagt gttgttgggt atacctgtac 660

agaggaagta ttatgggcag agtatgtata tctatttaca ttttttttta tcttatctcc 720

ag 722

<210> 2

<211> 178

<212> PRT

<213> Lilium regale Wilson

<400> 2

Met Glu Ser Phe Pro Leu Leu Leu Asn Asn Gln Pro Ser Ser Ser Tyr

1 5 10 15

His Leu Pro Ser Asn Phe Val Ser Thr Ser Gln Leu Phe Ser Asn Pro

20 25 30

Gln Asn Thr Ile Ser Asn Gly Phe Leu Gly Leu Lys Glu Glu Thr Val

35 40 45

Ala Ser Ser Ser Ser Asn Val Gln Ser Ala Ile Gln Met Glu Ala Phe

50 55 60

Arg Gly Ser Ser Glu Thr Asn Ala Lys Gln Gly Lys Lys Lys Gly Asp

65 70 75 80

Lys Lys Ala Lys Arg Pro Arg Phe Ala Phe Gln Thr Arg Ser Lys Val

85 90 95

Asp Ile Leu Asp Asp Gly Tyr Arg Trp Arg Lys Tyr Gly Gln Lys Ala

100 105 110

Val Lys Asn Asn Asn Phe Pro Arg Ser Tyr Tyr Arg Cys Thr His Gln

115 120 125

Gly Cys Asp Val Lys Lys Gln Val Gln Arg Leu Ser Lys Asp Glu Glu

130 135 140

Val Val Val Thr Thr Tyr Glu Gly Val His Thr His Pro Ile Glu Lys

145 150 155 160

Ser Asn Asp Asn Phe Glu His Ile Leu Asn Gln Met Gln Val Tyr Ser

165 170 175

Ser Phe

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 3

attcatggag agcttccccc tac 23

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence (Artificial)

<400> 4

tggtgcattg gcttattata ctcat 25

Claims (1)

1. Lilium regale WRKY transcription factor geneLrWRKY3In improving tobacco to Nicotiana oryzae (Nigrospora oryzae) Staphylococus viticola (A. vinifera)Botryosphaeria dothidea) Fusarium graminearum (F.graminearum)Fusarium graminearum) Fusarium verticillatum (A)Fusarium verticillioides) Fusarium solani (F.solani) (II)Fusarium solani) Application of Lilium regale WRKY transcription factor gene in resistanceLrWRKY3The nucleotide sequence of (A) is shown as SEQ ID NO. 1.

Images