CN108085318B - Tomato long-chain non-coding RNA-lncRNA23468 and cloning method and application method thereof - Google Patents
Tomato long-chain non-coding RNA-lncRNA23468 and cloning method and application method thereof Download PDFInfo
- Publication number
- CN108085318B CN108085318B CN201810057162.7A CN201810057162A CN108085318B CN 108085318 B CN108085318 B CN 108085318B CN 201810057162 A CN201810057162 A CN 201810057162A CN 108085318 B CN108085318 B CN 108085318B
- Authority
- CN
- China
- Prior art keywords
- tomato
- coding rna
- long
- chain non
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
Abstract
The invention provides a long-chain non-coding RNA-lncRNA23468 for improving tomato late blight resistance by silencing miRNA482b, wherein the DNA molecular sequence of the long-chain non-coding RNA-lncRNA23468 is shown in SEQ ID NO. 1; provides a cloning method of the long non-coding RNA: carrying out PCR amplification by taking cDNA of a wild type late blight resistant tomato L3708 as a template, connecting an obtained PCR product with a pMD-19T cloning vector, transforming escherichia coli DH5 alpha, and selecting a single colony for sequencing; also provides an application method of the long non-coding RNA. After the long-chain non-coding RNA obtained by the method is transiently overexpressed in tomatoes, the expression level of tomato miR482b is remarkably reduced, and the resistance to late blight is remarkably improved; the method is used for silencing miR482b, and has important significance for culturing tomato varieties resisting late blight.
Description
Technical Field
The invention belongs to the technical field of plant genetic engineering, and particularly relates to cloning and application of tomato long-chain non-coding RNA-lncRNA 23468.
Background
Long non-coding RNAs (lncRNAs) are RNAs with a length of more than 200nt and without a coding sequence (CDS), which exist in plants in large quantities and have multiple biological functions. In recent years, with the rapid development of omics technology, lncRNAs are identified in plants such as arabidopsis, corn, rice, wheat, cotton, tomato, cucumber, poplar and the like. Researches find that the lncRNAs of the plants play an important role in the growth processes such as flowering phase regulation and photomorphogenesis and the like and in response of biotic and abiotic stress. In the interaction process of plants and pathogens, 4 mcrnas respond to the infection of puccinia striiformis; some lncRNAs of arabidopsis are induced by fusarium; part of the tomato lncRNAs play an important role in the interaction of tomato and Tomato Yellow Leaf Curl Virus (TYLCV).
microRNA (miRNA) is endogenous and non-coding RNA with the length of about 22nt, and can inhibit the expression of genes at the post-transcriptional level through complementary pairing with mRNA of target genes, thereby regulating the growth and development of plants and the response to biotic and abiotic stresses. In recent years, research shows that cross regulation exists between lncRNAs and miRNAs. On the one hand, interaction with miRNA decreases stability of lncRNA; on the other hand, lncRNAs can trap miRNA, and improve the expression of target mRNA inhibited by miRNA. In the interaction process of tomato and TYLCV, lncRNA-Slylnc0195 can be used as an endogenous mimic target to be combined with miR166 to protect the target of class III HD-Zip transcription factor mRNA.
MiR482 is widely found in various plants such as tomato, grape and wheat, and plays an important regulatory role in defense response of these plants. After the potato spindle tuber viruses, the cucumber mosaic viruses, the soybean cyst nematodes, the verticillium wilt and other pathogens are infected, the expression level of miR482 in plants such as tomatoes, soybeans, potatoes, cotton and the like is obviously reduced. Previous studies show that miR482 can target NBS-LRR resistance genes and regulate the expression of the NBS-LRR resistance genes by cracking transcripts thereof, so that the NBS-LRR resistance genes participate in defense response of plants. miR482-NBS-LRR plays an important role in the interaction process of plants and pathogens. Researches in potatoes show that the expression quantity of a target gene NBS-LRR of a plant over-expressing miR482e is remarkably reduced, the susceptibility to verticillium wilt is increased, and the important function of miR482-NBS-LRR in plant disease resistance is further verified.
Tomatoes are an economic, horticultural crop that is widely grown worldwide. During the growth process, diseases caused by various pathogens seriously affect the yield of the tomatoes, and cause huge economic loss. In recent years, late blight has become one of the most serious tomato diseases, and is extremely harmful to agricultural production and economic development. Although chemical pesticides have a certain control effect on the occurrence and spread of late blight, the problems of environmental pollution, pathogenic bacteria drug resistance and the like caused by the control effect still bring great troubles to agricultural production. Therefore, the research on the molecular mechanism of tomato disease resistance and the biological method for improving the tomato resistance to late blight are imminent.
Disclosure of Invention
The invention aims to develop a method for cloning tomato long-chain non-coding RNA-lncRNA 23468; and provides the application of the gene in silencing miRNA482b and enhancing tomato resistance to late blight.
In order to achieve the aim, the invention provides tomato long-chain non-coding RNA-lncRNA23468, the sequence of which is shown in SEQ ID NO. 1.
The invention also provides a cloning method of the tomato long-chain non-coding RNA-lncRNA23468, which comprises the steps of carrying out PCR amplification by using cDNA of wild type late blight resistant tomato L3708 as a template and lncRNA23468-FP and lncRNA23468-RP as specific primers;
the sequences of the specific primers lncRNA23468-FP and lncRNA23468-RP are respectively shown as SEQ ID NO.2 and SEQ ID NO. 3;
the specific primers used for cloning are specifically as follows:
lncRNA23468-FP：CGGGATCCAAAAATAAAAGAAAGCTTGCACG，
lncRNA23468-RP：CGAGCTCGGACCGGATAATGAAGATGGT；
and connecting the obtained PCR product with a pMD-19T cloning vector, transforming the obtained connection product into Escherichia coli DH5 alpha, coating the Escherichia coli DH5 alpha on an LB solid culture medium containing ampicillin, selecting a single colony for sequencing, and obtaining a result shown in SEQ ID NO. 1.
The invention also provides an application method of the tomato long-chain non-coding RNA-lncRNA23468, which is used for silencing tomato miR482 b.
Preferably, the tomato long non-coding RNA-lncRNA23468 improves tomato resistance to late blight.
The method is realized by the following technical scheme:
transforming agrobacterium GV3101 by a recombinant expression vector containing tomato long-chain non-coding RNA-lncRNA23468, coating the recombinant expression vector on a YEB solid culture medium containing kanamycin, streptomycin and rifampicin, and selecting a single colony for carrying out bacterial liquid PCR verification; selecting positive engineering bacteria to transiently infect tomato leaves, and detecting the expression quantity of miR482b in the leaves and the resistance of the leaves to the late blight.
The target plant of the invention is dicotyledonous plant tomato.
Preferably, the recombinant vector is obtained by inserting tomato long-chain non-coding RNA-lncRNA23468 into an expression vector.
Further optimizing, the specific preparation method of the recombinant vector comprises the following steps:
cloning tomato long-chain non-coding RNA-lncRNA 23468: carrying out PCR amplification by taking cDNA of wild type late blight resistant tomato L3708 as a template and taking lncRNA23468-FP and lncRNA23468-RP as specific primers; the sequences of the specific primers are respectively shown as SEQ ID NO.2 and SEQ ID NO. 3; the obtained product is connected with a pMD-19T cloning vector, the connection product is transformed into Escherichia coli DH5 alpha and is spread on an LB solid culture medium containing ampicillin, and a single colony is picked for sequencing.
Secondly, constructing a recombinant expression vector containing tomato long-chain non-coding RNA-lncRNA 23468: extracting the plasmid containing the tomato long-chain non-coding RNA-lncRNA23468 thallus, carrying out double enzyme digestion by using restriction enzymes BamHI and SacI, recovering the obtained target fragment, connecting the target fragment with a pBI121 expression vector from which the GUS gene is removed, and obtaining a connection product, namely the recombinant expression vector.
Verifying an expression vector: the ligation product was transformed into E.coli DH 5. alpha. and spread on LB solid medium containing kanamycin, and single colonies were picked for PCR and double restriction enzyme verification.
The technical innovation of the invention is as follows:
1. the invention clones a tomato long-chain non-coding RNA-lncRNA 23468; constructing an expression vector containing tomato long-chain non-coding RNA-lncRNA 23468; the silencing effect of long-chain non-coding RNA-lncRNA23468 on miR482b is proved.
2. The invention confirms that long-chain non-coding RNA-lncRNA23468 can enhance the resistance of tomato to late blight by silencing pathogenic non-coding RNA miR482 b. After the lncRNA23468 obtained by the invention is over-expressed, the expression level of tomato miR482b is obviously reduced, the late blight resistance effect of the plant is better, and the method has important significance for cultivating the late blight resistance tomato variety.
Drawings
FIG. 1 shows the expression level of lncRNA23468 in transiently overexpressed leaves of a control group and lncRNA23468 in transiently expressed leaves;
FIG. 2 shows the expression level of miR482b in the transient overexpression lncRNA23468 and the control group leaves;
FIG. 3 shows the phenotype of leaves of the control group transiently overexpressing IncRNA 23468 5 days after late blight treatment.
Detailed Description
The invention is further illustrated below with reference to specific examples. The experimental conditions and methods not shown in the examples are conventional methods.
The first embodiment is as follows: cloning of tomato long non-coding RNA-lncRNA23468
1. Extraction of tomato Total RNA
(1) The sample was placed in a mortar, and liquid nitrogen was added and ground thoroughly to a powder.
(2) Taking a proper amount of powder, placing the powder in a 1.5mL RNase/DNase Free centrifuge tube, simultaneously quickly adding 1mL precooled Trizol, shaking up, and standing for 5min at room temperature.
(3) Adding 200 μ L chloroform into the centrifuge tube, shaking, standing at room temperature for 5min, and centrifuging at 4 deg.C 12000r/min for 15 min.
(4) Transferring the supernatant into a new centrifuge tube, adding isopropanol with the same volume, slightly reversing and uniformly mixing, standing at-20 ℃ for 20min, and centrifuging at 4 ℃ at 12000r/min for 10 min.
(5) The supernatant was discarded, 1mL of pre-cooled 75% ethanol was added, the precipitate was washed, and centrifuged at 12000r/min at 4 ℃ for 5 min.
(6) Carefully discard the supernatant, leave the flask open at room temperature, add 20. mu.L of RNase Free dH after ethanol has completely evaporated2And dissolving the precipitate by using O.
(7) mu.L of RNA was collected and detected by electrophoresis on 1% agarose gel.
2. Synthesis of tomato cDNA
Reverse transcription was performed using total RNA as a template, and the procedure was performed using Reverse Transcriptase M-MLV (RNase H-) (purchased from Takara) according to the instruction manual.
3. PCR amplification of Long non-coding RNA-lncRNA23468
The cDNA of tomato L3708 is used as a template, and a specific primer is applied to carry out PCR amplification.
The specific primers used for cloning were as follows:
lncRNA23468-FP：CGGGATCCAAAAATAAAAGAAAGCTTGCACG
lncRNA23468-RP：CGAGCTCGGACCGGATAATGAAGATGGT
the reaction conditions were as follows:
recovery and purification of PCR product
After detecting the PCR product by 1% agarose gel electrophoresis, the fragment corresponding to the object was recovered by using a gel cutting recovery kit (purchased from Takara).
5. The target fragment is ligated to a cloning vector
The fragment recovered above was ligated with the cloning vector pMD-19T (purchased from Takara) in the following reaction system:
ligation was performed at 16 ℃ for 8h to give the ligation product pMD-19T-lncRNA 23468.
6. Transformation of E.coli by ligation products
(1) Adding 10 mu L of the ligation product into 200 mu L of competent cells, fully and uniformly mixing, and carrying out ice-water bath for 30 min;
(2) transferring to 42 ℃ water bath for 90s, and then, carrying out ice water bath again for 2 min;
(3) adding 1mL of fresh LB medium, and performing constant temperature shaking culture (180rpm) at 37 ℃ for 1.5 h;
(4) centrifuging at 4000r/min for 10min, sucking 1mL of supernatant to leave 200 μ L of bacterial liquid, mixing well, suspending, uniformly coating on LB plate (containing 100mg/L ampicillin, 24mg/L IPTG and 20mg/L X-Gal), and culturing at 37 deg.C overnight;
(5) white single colonies were picked, inoculated into LB liquid medium (containing 100mg/L ampicillin), and cultured with shaking at 37 ℃ overnight (180 rpm).
Extraction of pMD-19T-lncRNA23468 plasmid
The plasmid pMD-19T-lncRNA23468 contained in the above-mentioned bacterial suspension was extracted according to the instructions of a plasmid Mini kit (purchased from TIANGEN). A5. mu.L sample was taken and detected by electrophoresis on a 1% agarose gel.
8. Sequencing
The obtained plasmid was sent to Huada Gene (Beijing) for sequencing, and the sequencing result was analyzed.
Example two: construction of tomato long-chain non-coding RNA-lncRNA23468 expression vector
Digestion of pMD-19T-lncRNA23468 plasmid
The pMD-19T-lncRNA23468 plasmid was digested with BamHI and SacI (purchased from Takara) in two steps, and the target fragment, i.e., a small fragment, was recovered. The enzyme digestion reaction system and the method are as follows:
the enzyme is cut for 6h at 37 ℃, and the cut products are detected by 1 percent agarose gel electrophoresis.
Plasmid double digestion of pBI121
The pBI121 plasmid was digested with BamHI and SacI, the GUS gene was excised, and the pBI121 fragment, i.e., the large fragment, was recovered. The reaction system is as follows:
the enzyme is cut for 6h at 37 ℃, and the cut products are detected by 1 percent agarose gel electrophoresis.
3. The target fragment is connected with a pBI121 vector
The target fragment recovered from the above-mentioned excised gel was ligated with a pBI121 vector having the GUS gene excised, using T4DNA ligase (purchased from Takara). The reaction system is as follows:
the ligation was carried out at 16 ℃ for 14h to obtain the expression vector pBI121-lncRNA 23468.
Example three: application of tomato long-chain non-coding RNA-lncRNA23468
Preparation of pBI121-lncRNA23468 Agrobacterium engineering bacteria
(1) Adding 2 mu L of pBI121-lncRNA23468 plasmid into 100 mu L of agrobacterium-infected cells, fully and uniformly mixing, carrying out ice-water bath for 10min, and quickly transferring into liquid nitrogen for freezing for 5 min;
(2) putting the frozen mixed solution into a water bath at 37 ℃ for 5min, adding 1mL of fresh YEB culture medium, and culturing for 3h at constant temperature of 28 ℃ under shaking (180 rpm);
(3) after centrifugation, 1mL of supernatant was aspirated, the remaining 200. mu.L of suspension was mixed well and spread on YEB solid medium (containing 100mg/L streptomycin, 100mg/L rifampicin, and 50mg/L kanamycin) and cultured at 28 ℃ for 36 h;
(4) PCR detection of agrobacterium engineering bacteria
Colonies obtained by antibiotic screening in the above plates were picked and placed in 5mL YEB, and shake-cultured at 28 ℃ and 180rpm for 16-17 h.
2. mu.L of the above-mentioned bacterial suspension was aspirated, and 18. mu.L of ddH was added2Diluting with O, freezing at-20 deg.C for 30-40min, and heating at 99 deg.C for 10min to fully crack thallus to release DNA;
PCR was carried out using the above DNA as a template and a primer specific to lncRNA23468 under the same reaction conditions and reaction system as "3" in example I ".
2. Agrobacterium-mediated transient transformation of tomato early powder No.2
(1) Germination of tomato seeds
Soaking tomato seeds in water for 12h, uniformly placing on wet filter paper, covering a layer of wet filter paper on the surface, keeping the humidity above 90%, and culturing in dark at 28 deg.C until germination.
(2) Cultivation of tomato plants
Sowing the newly germinated seeds in soil, and culturing at 25-28 deg.C under 16h illumination for 7-leaf stage.
(3) Preparation of Agrobacterium liquid
Selecting Agrobacterium GV3101 containing empty vector pBI121 and positive clone verified by bacterial liquid PCR, respectively inoculating to 5mL YEB liquid culture medium containing 50mg/L kanamycin and 100mg/L rifampicin, and performing shake culture at 28 deg.C and 180rpm for 18 h;
sucking the above bacterial liquid at a ratio of 1:50, adding to a mixture containing 100mg/L rifampicin, 50mg/L kanamycin, 10mmol/L MES, 20. mu. mol/L AS and 2mmol/L MgSO4Culturing in YEB liquid culture medium at 28 deg.C and 180rpm for 18 h;
centrifuging at 4 deg.C and 4000r/min for 10min, collecting Agrobacterium thallus, resuspending thallus in MES containing 10mmol/L and MgCl containing 10mmol/L2OD was adjusted in 20. mu. mol/L AS MMA solution6001.0, culturing at 28 deg.C and 180rpm for more than 3 hr to activate Agrobacterium.
(4) Transiently infecting tomato leaves
Before transformation, placing the tomato plant in the 7-leaf stage under weak light for 1-2h, and watering enough water;
200 μ L of the activated pBI121-lncRNA 23468-containing bacterial solution and the unloaded bacterial solution were injected to the backs of the tomato leaves of the experimental group and the control group, respectively, using a 1mL sterile syringe with a needle removed;
after injection, tomato plants were cultured at 25 ℃ under light/dark cycle of 16h/8 h.
3. Expression characteristics and disease resistance analysis of transiently transformed tomato
(1) Analysis of expression characteristics of transiently expressing tomato
Extracting total RNA from tomato leaf infected with 3d transiently, and applying Reverse Transcriptase M-MLV (RNase H-) (obtained from Takara)
miRNA First-Strand cDNA Synthesis SuperMix (available from TransGen Biotech) reverse transcription was performed according to the instructions. The obtained cDNA is used as a template, and specific primers of lncRNA23468 and miR482b are used for real-time quantitative PCR detection, and the results are shown in fig. 1 and fig. 2, wherein the expression level of lncRNA23468 in the leaves of the experimental group is obviously higher than that of the control group, and the expression level of miR482b is obviously lower than that of the control group. RNA extraction was as in "example one, 1". The kit for real-time quantification is
Premix Ex TaqTMII (Tli RNaseH plus) (from Takara) and
green miRNA Two-Step qRT-PCR SuperMix (purchased from TransGen Biotech), and the reaction system and conditions refer to the instruction book.
The specific primers used for real-time quantification were as follows:
qlncRNA23468-FP：GGTGCAATTAGCCAAAGGAGG
qlncRNA23468-RP：GAGGATGAGAGCTGGAAGCT
qmiR482b：TCTTGCCAATACCGCCCAT
(2) disease resistance analysis of transiently expressed tomatoes
Selecting intact tomato plant leaf blade with transient expression of 3d, inoculating 10 μ l of 1 × 10 concentration at leaf blade injection position6spore/mL of late blight germ spore suspension;
the treated leaves are placed in an illumination incubator at 18 ℃, the photoperiod is 16/8h, the relative humidity is kept above 90%, and the disease incidence condition is recorded by photographing after the leaves are cultured for 5 d. As shown in FIG. 3, the disease degree of the leaves of the experimental group is obviously weaker than that of the control group, which indicates that the overexpression of lncRNA23468 can reduce the expression level of miR482b in tomato so as to improve the resistance of tomato to late blight.
The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be able to cover the technical solutions and the inventive concepts of the present invention within the technical scope of the present invention.
Sequence listing
<110> university of Large Community
<120> tomato long-chain non-coding RNA-lncRNA23468 and cloning method and application method thereof
<130> 2018
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1100
<212> DNA
<213> tomato (Lycopersicon esculentum)
<400> 1
aaaaataaaa gaaagcttgc acgagaaaga aaccaagaga tactagaaac accaaagctc 60
catttgcatt aacacaacta ctagttaata cacattcttt tgattatatt ttaataaagt 120
taagatctta atattaatcc caaggactat agaggtagct ctctacttca agtaccacat 180
ttacattatg acagattggg cggaataggt aagaaagaaa ctgcatttct tcattaacat 240
atacttgctt attattttgc ctttactttc ttcttttttt tgatcaagta cagattgttt 300
aatttctttt acatcatcac aaactaaccc caaatattag gtgaaatcct attctttgaa 360
aacaaatagt aatgtcttat ccacaaagca tcatatacaa gtgttagtaa aattttataa 420
cttcgcttgg gatttaaaag ttgcttcctg atataattta atggtgcaat tagccaaagg 480
aggaatttat tcagaatcac aagaatcatg caagtgcaca aacttttagg acatagttat 540
aacttttttg aggagaagca tgtcggcatg aatacaggtc aatttccaat agcttccagc 600
tctcatcctc tgagaaacat gaatcctcaa gaaattggga actaaaaata acgaccaact 660
taataggata aaatagaaaa gttaaacaaa gaacatttca taaaatgata caaccttcag 720
tggaatatcc aatagccctg atgaaaacat catcccaagc tactagttag caatcttggc 780
cctgattata tctgtcaagg tcctaatata taaaattaaa tccaaaataa tctatttcaa 840
gccgtacctc aatggcgaat tccagagatg ataaaagtac ttgaagcatc atgaaaccac 900
cttcatcata gaactccaat gacttgattc tcctcctata atctctactt ccactgtaca 960
ctacaacatc aatacttggt gccagtcgtg taaattcagc ttcccactgg ggaagtgaac 1020
ttgaagttgt gacaataaga aaaggacagc agacatcgga caaagataga ataaacaaaa 1080
ccatcttcat tatccggtcc 1100
<210> 2
<211> 31
<212> DNA
<213> Artificial primer (unknown)
<400> 2
cgggatccaa aaataaaaga aagcttgcac g 31
<210> 4
<211> 28
<212> DNA
<213> Artificial primer (unknown)
<400> 4
cgagctcgga ccggataatg aagatggt 28
Claims (7)
1. A tomato long-chain non-coding RNA-lncRNA23468 is characterized in that the DNA molecular sequence is shown in SEQ ID NO. 1.
2. The method for cloning tomato long non-coding RNA-lncRNA23468 as claimed in claim 1, wherein the method comprises the following steps: carrying out PCR amplification by taking cDNA of wild type late blight resistant tomato L3708 as a template and taking lncRNA23468-FP and lncRNA23468-RP as specific primers;
the sequences of the specific primers are respectively shown as SEQ ID NO.2 and SEQ ID NO. 3;
and connecting the obtained PCR product with a pMD-19T cloning vector, transforming the obtained connecting product into escherichia coli DH5 alpha, coating the escherichia coli DH5 alpha on an LB solid culture medium containing ampicillin, and selecting a single colony for sequencing to obtain a product, namely the tomato long-chain non-coding RNA-lncRNA 23468.
3. The method for using the tomato long non-coding RNA-lncRNA23468 as claimed in claim 1, which is used for silencing tomato miR482 b.
4. The method for using tomato long non-coding RNA-lncRNA23468 as claimed in claim 3, wherein the method is used for improving tomato resistance to late blight.
5. The method for applying the tomato long-chain non-coding RNA-lncRNA23468 disclosed by claim 3 or 4 is realized by the following technical scheme:
transforming agrobacterium GV3101 by a recombinant expression vector containing tomato long-chain non-coding RNA-lncRNA23468, coating the recombinant expression vector on a YEB solid culture medium containing kanamycin, streptomycin and rifampicin, and selecting a single colony for carrying out bacterial liquid PCR verification;
selecting positive engineering bacteria to transiently infect tomato leaves, and detecting the expression quantity of miR482b in the leaves and the resistance of the leaves to the late blight.
6. The method for using tomato long non-coding RNA-lncRNA23468 as claimed in claim 5, wherein the recombinant expression vector is obtained by inserting tomato long non-coding RNA-lncRNA23468 into an expression vector.
7. The method for applying the tomato long-chain non-coding RNA-lncRNA23468 disclosed in claim 6, wherein the recombinant expression vector is prepared by the following specific steps:
cloning tomato long-chain non-coding RNA-lncRNA 23468: carrying out PCR amplification by taking cDNA of wild type late blight resistant tomato L3708 as a template and taking lncRNA23468-FP and lncRNA23468-RP as specific primers; the sequences of the specific primers are respectively shown as SEQ ID NO.2 and SEQ ID NO. 3; connecting the obtained product with a pMD-19T cloning vector, converting the connecting product into escherichia coli DH5 alpha, coating the escherichia coli DH5 alpha on an LB solid culture medium containing ampicillin, and selecting a single colony for sequencing;
secondly, constructing a recombinant expression vector containing tomato long-chain non-coding RNA-lncRNA 23468: extracting the plasmid containing the tomato long-chain non-coding RNA-lncRNA23468 thallus, carrying out double enzyme digestion by using restriction enzymes BamHI and SacI, recovering the obtained target fragment, connecting the target fragment with a pBI121 expression vector from which GUS genes are removed, wherein the connection product is a recombinant expression vector;
verifying an expression vector: the ligation product was transformed into E.coli DH 5. alpha. and spread on LB solid medium containing kanamycin, and single colonies were picked for PCR and double restriction enzyme verification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810057162.7A CN108085318B (en) | 2018-01-22 | 2018-01-22 | Tomato long-chain non-coding RNA-lncRNA23468 and cloning method and application method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810057162.7A CN108085318B (en) | 2018-01-22 | 2018-01-22 | Tomato long-chain non-coding RNA-lncRNA23468 and cloning method and application method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108085318A CN108085318A (en) | 2018-05-29 |
| CN108085318B true CN108085318B (en) | 2021-05-18 |
Family
ID=62183267
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810057162.7A Active CN108085318B (en) | 2018-01-22 | 2018-01-22 | Tomato long-chain non-coding RNA-lncRNA23468 and cloning method and application method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108085318B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110964731B (en) * | 2019-12-25 | 2021-07-16 | 华中农业大学 | Cloning and application of tomato downy regulatory gene |
| CN112195178B (en) * | 2020-09-18 | 2023-11-24 | 大连理工大学 | Tomato late blight-resistant long-chain non-coding RNA-lncRNA40787, cloning method and application method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106916825A (en) * | 2017-03-22 | 2017-07-04 | 大连理工大学 | The anti-late blight ospc gene SpNBS LRR of tomato and its cloning process and application process |
-
2018
- 2018-01-22 CN CN201810057162.7A patent/CN108085318B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106916825A (en) * | 2017-03-22 | 2017-07-04 | 大连理工大学 | The anti-late blight ospc gene SpNBS LRR of tomato and its cloning process and application process |
Non-Patent Citations (3)
| Title |
|---|
| A MicroRNA Superfamily Regulates Nucleotide Binding Site–Leucine-Rich Repeats and Other mRNAs;Padubidri V. Shivaprasad等;《The Plant Cell》;20120331;第24卷(第3期);第859-874页 * |
| Evolution of NBS-LRR Gene Copies among Dicot Plants and its Regulation by Members of the miR482/2118 Superfamily of miRNAs;Gonzalez Victor M等;《Molecular Plant》;20141212;第8卷(第2期);第329-331页 * |
| High-throughput sequencing reveals differential expression of miRNAs in tomato inoculated with Phytophthora infestans;Yushi Luan 等;《Planta》;20150220;第241卷(第6期);第1405-1416页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108085318A (en) | 2018-05-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105441460B (en) | A kind of Ming River lily WRKY transcription factor genes LrWRKY1 and application | |
| CN110818782B (en) | Lilium regale WRKY transcription factor gene LrWRKY3 and application thereof | |
| CN110747202B (en) | Lilium regale WRKY transcription factor gene LrWRKY11 and application thereof | |
| CN110818783B (en) | Lilium regale WRKY transcription factor gene LrWRKY2 and application thereof | |
| CN110734482B (en) | Lilium regale WRKY transcription factor gene LrWRKY4 and application thereof | |
| CN112831505B (en) | Pseudo-ginseng WRKY transcription factor gene PnWRKY15 and application thereof | |
| CN112831504B (en) | Pseudo-ginseng WRKY transcription factor gene PnWRKY9 and application thereof | |
| CN107267526B (en) | Radix Notoginseng myb transcription factor gene PnMYB2 and its application | |
| CN106916825B (en) | Tomato late blight resistant gene SpNBS-LRR and cloning method and application method thereof | |
| CN108085318B (en) | Tomato long-chain non-coding RNA-lncRNA23468 and cloning method and application method thereof | |
| CN112359049B (en) | Lilium regale chitinase gene LrCHI2 and application thereof | |
| CN111072762B (en) | Mao bamboo senescence-associated NAP transcription factor, and coding gene and application thereof | |
| CN109628475B (en) | Application of brassinolide synthetic gene PaCYP724B1 in regulation and control of plant branches | |
| US20200216855A1 (en) | Disease Resistant Plants Containing HIR3 Gene and Method for making the plants thereof | |
| CN107267525B (en) | Application of panax notoginseng polygalacturonase inhibitor protein gene PnPGIP | |
| CN103320448B (en) | Lilium regle bZIP transcription factor LrbZIP1 and application | |
| CN113603757B (en) | Lily regale Dirigent similar protein gene LrDIR1 and application thereof | |
| CN115927403A (en) | King ZxPDS gene VIGS silencing system and construction method and application thereof | |
| CN112195178B (en) | Tomato late blight-resistant long-chain non-coding RNA-lncRNA40787, cloning method and application method thereof | |
| CN108707610B (en) | Notoginseng defensein antibacterial peptide genePnDEFL1And applications | |
| CN108588069B (en) | Precursor gene of mulberry miR171a and application thereof in enhancing salt tolerance of plants | |
| CN110106172B (en) | Long-chain non-coding RNA and application thereof in regulating and controlling low temperature resistance of plants | |
| CN113980986B (en) | Application of CRK22 gene and encoding protein thereof in potato stress-resistant breeding | |
| CN111500624B (en) | Use of CrSMT genes to increase resistance of plants to biotic and abiotic stress | |
| CN110295192B (en) | Bivalent RNAi expression vector for constructing TYLCV and ToCV by Gateway technology and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |