CN113604477A - Lilium regale defensin antibacterial peptide gene LrDEF1 and application - Google Patents

Abstract

The invention discloses a Lilium regale defensin antibacterial peptide geneLrDef1The nucleotide sequence is shown as SEQ ID NO. 1, and the protein with the amino acid sequence shown as SEQ ID NO. 2 is coded, and the invention is proved by related technical research of functional genomicsLrDef1The gene has the function of improving the antifungal effect of plants, and the invention is antifungalLrDef1The gene is constructed on a plant expression vector and is transferred into tobacco for over-expression, a transgenic tobacco plant has strong capability of resisting fungal infection, and the experimental result shows that the over-expression is realizedLrDef1Transgenic tobacco of the strain can be used for treating fusarium oxysporum and phoma herbarumFusarium equiseti infection is highly resistant.

Description

Lilium regale defensin antibacterial peptide geneLrDef1And applications

Technical Field

The invention relates to the technical field related to molecular biology and genetic engineering, in particular to a Lilium regale defensin antibacterial peptide gene with antifungal infection capacityLrDef1And application thereof.

Background

Pathogenic bacteria are important influencing factors causing loss of plant yield and quality, and plant diseases caused by the pathogenic bacteria can reduce the yield of crops by 20-40%; wherein the fungal diseases are the largest number of plant diseases, and account for about 70-80% of the total number of the diseases. The traditional method for controlling plant diseases mainly uses chemical pesticides, improves cultivation management measures and cultivates new resistant varieties. Although the methods have certain effect, the traditional breeding period is long, the effect of cultivation measures is poor, and pesticides are easy to cause the problems of environmental safety, food safety and the like. With the rapid development of biotechnology, the new disease-resistant variety cultivated by using a genetic engineering method can overcome the defects of the prevention and treatment method, reduce the damage to beneficial microorganisms in soil to the maximum extent and realize the sustainable development of agriculture.

Plant Antimicrobial peptides (AMPs) are small, cysteine-rich, basic cationic peptides that are part of the plant immune system, have inhibitory or killing effects on pathogenic microorganisms such as bacteria, fungi and viruses, and play a crucial role in plant defense reactions (Zasloff Michael, Antimicrobial peptides of multicell organisms. Nature, 2002, 415 (6870): 389) -395). Plant defensins are important AMPs, and when plants are subjected to biotic stress, the plant defensins can be combined with specific characteristic membrane components of fungi to cause the cell membranes of pathogenic bacteria to be sunken, embedded into the cell membranes or transported into the cell membranes, so that a series of biochemical changes are generated.

Various defensin genes have been introduced into plants for enhancing plant resistance. Tobacco (A)Nicotiana megalosiphon) Defensins（NmDef02) Is a common plant defensin with antibacterial activity, and expressesNmDef02The transgenic soybean of (a), (b)Glycine max) Plant rust of soybean: (Phakopsora pachyrhizi) And anthrax bacteria (B)Colletotrichum truncatum) Show a higher resistance (Soto N, Y Hern ndz, Delgado C, et al. Field resistance toPhakopsora pachyrhizi and Colletotrichum truncatumof transgenic soybean expressing the NmDef02Plant defenses gene, Frontiers in Plant Science, 2020, 11: 562). In tobacco (A)N. alata) Separating to obtain a flower budNaD1The content of the defensin is as follows,NaD1can be specifically combined with The fungal Cell wall and enter The fungal cytoplasm, thereby triggering The rapid increase of The intracellular active oxygen concentration and leading The cytoplasmic membrane of The fungus to be permeabilized, and finally leading The fungal Cell to be dead (Baxter AA, Poon IK, Hulett MD. The plant defensen NaD1 indens Cell Death a non-apoptosis, molecular process, Cell Death Discovery, 2017, 3(1): 402-. In addition, NaD1 protein was specific for Fusarium oxysporum (F.), (Fusarium oxysporum) Botrytis cinerea (A), (B), (C), (B), (C), (B), (C), (B), (C), (B), (C), (B), (C)Botrytis cinerea) Candida, andCandida albicans) The various pathogenic fungi also have good antibacterial activity (Rao Yi, Zhao De just, Zhao Yi Gem, Gao Nicotiana tabacum)NaD1Prokaryotic expression and purification of genes molecular plant breeding 2020, 18(11): 3502-3508).

The Bulbus Lilii is Liliaceae (Liliaceae) Lilium (Lilium)Lilium) The plant is a general term of perennial root flower. During the processes of seed ball propagation and fresh cut flower production, lily is vulnerable to various pathogenic bacteria such as fungi, viruses and bacteria. The lily diseases found at present are more than dozens, among which, the lily is from the genus Fusarium (A), (B), (CFusarium spp.) blight caused by fungi (also known as basal rot, stem rot) is the most serious disease in lily production. After the fusarium infects the lily seed balls, the basal disc is necrotic, the scales are rotted and fall off, and the quality of the seed balls is reduced; after the plants are infected with fusarium, the leaves turn yellow and droop wilting, and the plants die in advance, so that the yield and the quality of cut lily flowers are seriously influenced; wherein the fusarium oxysporum has the strongest pathogenicity and separation frequencyMost importantly, the lily is the main pathogenic bacterium of lily wilt. Lilium regale (Lilium regale)L. regale Wilson) is a unique species in China, is only distributed in rock cracks from valleys with the altitude of 800-2700 m in Minjiang river basin to the mountains, has strong blight resistance, and is an important germplasm resource for modern lily breeding. The antibacterial peptide is an important component of a plant defense system, so that the antibacterial peptide has important research and application values on the discovery and functional analysis of the antibacterial peptide gene in Lilium regale.

Disclosure of Invention

The invention aims to provide a Lilium regale defensin antibacterial peptide geneLrDef1And application thereof, namely, the application of the composition in improving the resistance of tobacco to fusarium oxysporum (F)F. oxysporum) Phoma graminearum (A) and (B)Phoma herbarum) Fusarium equiseti (F.) hieron (F.)F. equiseti) Use in resistance.

The defensein antibacterial peptide gene with antifungal activity, which is cloned from Lilium regaleLrDef1，LrDef1The nucleotide sequence is shown as SEQ ID NO. 1, the gene cDNA full length sequence is 501bp, comprises a 225bp open reading frame, a 37 bp 5 'untranslated region and a 239 bp 3' untranslated region, and codes the protein of the amino acid sequence shown as SEQ ID NO. 2.

In the inventionLrDef1The coding region of the gene is a nucleotide sequence shown in 38 th to 262 th sites in a sequence table SEQ ID NO. 1.

The invention separates and clones a complete cDNA segment of an antifungal related gene of Lilium regale, and utilizes agrobacterium tumefaciens (A), (B) and (C)Agrobacterium tumefaciens) The target gene is transferred into a receptor plant and is overexpressed, whether the gene has antifungal activity is verified through further experiments, a foundation is laid for the capability of improving tobacco and other plants to resist fungal diseases by utilizing the gene in the later period, and the inventor names the gene asLrDef1。

As described aboveLrDef1The gene can be applied to improving the antifungal property of tobacco, and the specific operation is as follows:

(1) using amplificationLrDef1The specific primer is used for extracting total RNA from Lilium regale roots inoculated with fusarium oxysporum and performing reverse transcription-polymerase chain reactionShould be (reverse transcription-polymerase chain reaction, RT-PCR) amplifiedLrDef1Then connecting the full-length coding region to a pGEM-T vector, and obtaining a clone with a target gene through sequencing;

(2) using restriction endonucleasesEcoRI andBamh I enzyme digestion pGEM-T-LrDef1Recovering the carrier by glue to obtain target gene segment, using the same endonuclease to enzyme-cut plant expression carrier pCAMBIA2300s, recovering the glue to obtain the required carrier large segment, and recovering the obtained carrier large segmentLrDef1Connecting the gene fragment with the pCAMBIA2300s fragment to construct a plant overexpression vector, and then transferring the constructed recombinant vector into tobacco to express through the mediation of agrobacterium tumefaciens;

(3) screening transformants by using a resistance marker on the recombinant vector T-DNA, obtaining a real transgenic plant through PCR and RT-PCR detection, analyzing the inhibition capability of total protein of a transgenic plant leaf on the growth of pathogenic fungi, and finally screening the transgenic plant with obviously enhanced resistance to the fungi.

The invention provides a new method for improving the resistance of plants to fungal diseases, the defects of traditional breeding can be overcome by cultivating disease-resistant plants by means of genetic engineering, the breeding period is shortened, the operation is simple, and high-resistance materials are easy to obtain. The invention is derived from Lilium regaleLrDef1The gene can enhance the resistance of plants to fungi, and the gene is introduced into tobacco, so that new varieties and new materials with fungal resistance can be generated; the cultivation of resistant plant varieties and materials by utilizing the genetic engineering technology has obvious advantages and irreplaceable importance; the invention not only can provide convenience for large-scale production of crops, medicinal materials, horticultural plants and the like, greatly reduces the use of chemical pesticides, but also can save the cost for agricultural production and reduce the environmental pollution, thereby having wide market application prospect.

Drawings

FIG. 1 is a drawing of the present inventionLrDef1PCR detection result graph of transgenic tobacco genome DNA, in the graph: the Marker is DL2000 DNA Marker (Dalibao biology); the positive control is plasmid pGEM-T-LrDef1A PCR product as a template; WT is the total DNA of non-transgenic tobacco (wild type)The product of plate PCR;

FIG. 2 shows the positivity of the present inventionLrDef1In transgenic tobaccoLrDef1A graph of the results of expression analysis at the transcriptional level; in the figure: marker is DL2000 DNA Marker (Dalibao biology); WT is a PCR product with non-transgenic tobacco total RNA reverse transcription cDNA as a template; the positive control was plasmid pGEM-T-LrDef1A PCR product as a template;

FIG. 3 is a drawing of the present inventionLrDef1A bacteriostatic effect graph of the transgenic tobacco on the growth of pathogenic fungi in vitro; the fungi shown in panels a, b, c are respectively Phoma herbarum (P. herbarum) Fusarium equiseti (F.) hieron (F.)F. equiseti) Fusarium oxysporum (F.), (F. oxysporum) (ii) a WT was the wild type tobacco total protein and Buffer was the blank, i.e., no protein control (Buffer used to extract protein).

Detailed Description

The present invention is further illustrated by the following figures and examples, but the scope of the present invention is not limited to the above description, and the examples are conventional methods unless otherwise specified, and reagents used are conventional commercially available reagents or reagents formulated according to conventional methods unless otherwise specified.

Example 1:LrDef1gene cloning and sequence analysis

Inoculating fusarium oxysporum to Lilium regale, extracting total RNA from roots inoculated for 24 hours, grinding the inoculated Lilium regale roots into powder by using liquid nitrogen, transferring the powder into a centrifuge tube, extracting the total RNA by using a guanidine isothiocyanate method, synthesizing a cDNA first chain by using reverse transcriptase M-MLV (promega) and using the total RNA as a template, wherein a reaction system and an operation process are as follows: mu.g of total RNA was taken and added with 50ng oligo (dT), 2. mu.L dNTP (2.5 mM) and DEPC water in sequence to a reaction volume of 14.5. mu.L; after uniformly mixing, heating and denaturing at 70 ℃ for 5min, then rapidly cooling on ice for 5min, then sequentially adding 4 mu L of 5 XFirst-stand buffer, 0.5 mu L of RNase (200U) and 1 mu L M-MLV (200U), uniformly mixing and centrifuging for a short time, carrying out warm bath at 42 ℃ for 1.5h, taking out, heating at 70 ℃ for 10min, and stopping reaction; the first strand cDNA is synthesized and stored at-20 deg.C for further use.

Amplifying target gene using synthesized first strand cDNA as templateLrDef1Use ofThe upstream and downstream primer sequences were 5 'TCGTCGTCCCCATCTCAG 3' and 5 'AAATACAAGAGAACTTACTCCA 3' respectively. Advantage is taken^TM2 PCR Enzyme (Clontech) amplifies the target gene; and (3) PCR reaction conditions: 5min at 94 ℃; 30s at 94 ℃, 30s at 54 ℃, 30s at 72 ℃ and 32 cycles; 7min at 72 ℃; the reaction system (20. mu.L) was 0.5. mu.L of cDNA, 2. mu.L of 10 × Advantage 2 PCR Buffer, 0.4. mu.L of 50 × dNTP Mix (10 mM each), 0.4. mu.L of forward primer (10. mu.M), 0.4. mu.L of reverse primer (10. mu.M), 0.4. mu.L of Advantage 2 PCR Polymerase Mix, 15.9. mu.L of PCR-Grade water; after the PCR was completed, 5. mu.L of the resulting mixture was subjected to agarose gel electrophoresis to examine the specificity and size of the amplified product.

The PCR product was TA cloned using pGEM-T Vector System I (Promega, USA) as a kit, and the reaction System and procedure were as follows: mu.L of the PCR product was taken, and 1. mu.L of pGEM-T Vector (50 ng/. mu.L) and 2.5. mu.L of 2 × Ligation solution I were sequentially added thereto, mixed well and then left to react at 16 ℃ overnight. The ligation product was transformed into E.coli DH 5. alpha. using a heat shock transformation method. Screening positive clones with LB solid medium containing ampicillin (Ampicillin, Amp), selecting several single colonies, shaking, and amplifyingLrDef1Identifying the multiple cloning site insertionLrDef1The clones identified are sequenced and finally obtainedLrDef1The full-length cDNA was 501bp, which was found to contain a 225bp open reading frame by NCBI ORF finder (http:// www.ncbi.nlm.nih.gov/gorf. html) analysis (see sequence listing),LrDef1encodes a 74 amino acid protein with a molecular weight of about 8.06kDa and an isoelectric point of about 8.22. Analysis by means of bioinformatics software SignalP 5.0LrDef1The encoded protein sequence, and detecting whether the protein sequence has an N-terminal signal peptide. The results showed that a signal peptide was present at the N-terminus of LrDef1, and thus the protein was presumed to be a secreted protein.

Example 2: construction of plant overexpression vectors

The insertion is extracted by adopting a SanPrep column type plasmid DNA small extraction kit (Shanghai worker)LrDef1The E.coli plasmid pGEM-T-LrDef1And the plasmid of the plant expression vector pCAMBIA2300s, taking 1 μ L to be used in agarose gelElectrophoresis is carried out to detect the integrity and concentration of the extracted plasmid; using restriction endonucleasesEcoRI (TaKaRa) andBamHI (TaKaRa) against plasmid pGEM-T-LrDef1And pCAMBIA2300s (100 mu L system), wherein the reaction system and the operation process are as follows: taking 20. mu.L of pGEM-T-LrDef1And pCAMBIA2300s plasmid, 10. mu.L 10 XK buffer, and 4. mu.LEcoRI、6μL BamHI、60μL ddH₂O, mixing uniformly, centrifuging for a short time, and reacting at 37 ℃ overnight; all the products of the digestion are spotted in agarose gel for electrophoresis, and thenLrDef1The fragments and the pCAMBIA2300s vector large fragment are respectively subjected to gel recovery, and a SanPrep column type DNA gel recovery kit (Shanghai's engineering) is used in the whole process; taking 1 microliter of the recovered product, detecting the size and concentration of the recovered fragment by agarose gel electrophoresis, and storing at-20 ℃ for later use.

The recovered DNA was purified by using T4 DNA Ligase (TaKaRa)LrDef1 The DNA fragment and the pCAMBIA2300s vector fragment were ligated, and the reaction system (20. mu.L) and the procedure were as follows: taking 10 μ LLrDef1 The DNA fragment was sequentially added with 2. mu.L of pCAMBIA2300s vector DNA, 2. mu.L of 10 XT 4 DNA Ligase Buffer, 1. mu. L T4 DNA Ligase, and 5. mu.L of ddH₂And O, mixing uniformly, centrifuging for a short time, and then carrying out water bath at 16 ℃ for overnight reaction. Then transferring the ligation product into Escherichia coli DH5 alpha by heat shock transformation, screening positive clones with solid culture medium containing 50mg/L kanamycin (Km), selecting single colony shake bacteria, and amplifying with bacteria liquid as templateLrDef1The specific primers of (1) are subjected to PCR, and selectedLrDef1If the detected strain is positive, the clone successfully connected with pCAMBIA2300s is added with glycerol and stored at-80 ℃ for later use.

Extraction and purification of pCAMBIA2300s-LrDef1Plasmid, then freezing and thawing the plant expression vector pCAMBIA2300s-LrDef1Transferred into Agrobacterium tumefaciens LBA4404 competent cells. The operation steps are as follows: taking 2 μ g of pCAMBIA2300s-LrDef1Adding plasmid into a centrifuge tube containing 200 μ L competent cells, mixing, ice-cooling for 5min, transferring into liquid nitrogen, freezing for 1min, rapidly placing in 37 deg.C water bath for 5min, immediately ice-cooling for 2min, adding 800Mu L LB liquid culture base on 28 ℃ shaking culture for 4 h; coating the activated agrobacterium on LB solid culture medium with 50mg/L Km, and statically culturing at 28 ℃; selecting single colony shake bacteria, and amplifyingLrDef1The specific primer of (2) is used for PCR to detect pCAMBIA2300s-LrDef1If the positive clone is transferred into agrobacterium, adding glycerol into the positive clone, and storing the positive clone at-80 ℃ for later use.

Example 3: agrobacterium-mediated genetic transformation of plants and transgenic plant screens

The transgenic recipient in this experiment was tobacco, tobacco seeds were soaked in 75% ethanol for 30s, washed with sterile water and then washed with 0.1% HgCl₂Soaking for 8min, washing with sterile water for several times, sowing on 1/2 MS culture medium, dark culturing at 28 deg.C for 6d, germinating, transferring to light incubator (25 deg.C, 16 h/d light), and subculturing with 1/2 MS culture medium once a month.

The preserved liquid containing pCAMBIA2300s was taken out from the-80 ℃ refrigeratorLrDef1Agrobacterium LBA4404 strain of plasmid was inoculated into 5mL LB liquid medium containing 50mg/L Km and 20mg/L rifampicin, and cultured at 28 ℃ until the medium became turbid. Sucking 1mL of turbid bacterial liquid to an LB solid culture medium containing 50mg/L Km, and culturing for 48 h at 28 ℃; then, appropriate amount of the agrobacteria on LB solid medium was scraped and inoculated into MGL liquid medium supplemented with 20mg/L acetosyringone, and shake-cultured at 28 ℃ for 2-3h to activate the agrobacteria.

Cutting sterile tobacco seedling leaf into 1 cm²And completely soaking the left and right leaf discs in the MGL liquid culture medium containing the activated agrobacterium for 15min, sucking bacterial liquid on the surfaces of the leaves by using sterile filter paper, placing the leaf discs on a co-culture medium for room temperature culture, wherein the co-culture medium for tobacco transformation is MS +0.02 mg/L6-BA +2.1mg/L NAA +30g/L sucrose +6g/L agar, and co-culturing for 2 days at 22 ℃ in the absence of light.

Transferring the co-cultured leaf discs to an MS screening culture medium added with antibiotics to be divided into seedlings, and screening transgenic plants; the tobacco screening culture medium is MS +0.5 mg/L6-BA +0.1mg/L NAA +30g/L sucrose +6g/L agar +50mg/L Km +200 mg/L cephamycin (cefixime sodium salt, Cef); during screening culture, the culture bottle is transferred to an illumination culture box for culture (25 ℃, 16 h/d illumination and 8 h/d darkness), after the tobacco grows out of buds, the MS culture medium containing 50mg/L Km and 200mg/L Cef is used for subculture, the regeneration plant needs to be further screened because the callus differentiation rate of the tobacco is higher, the tobacco regeneration seedling is transferred to the MS culture medium containing 50mg/L Km to root the tobacco regeneration seedling, and finally the regeneration seedling with better rooting is selected for further detection.

Extracting genome DNA of transgenic tobacco plant leaf by CTAB method, collecting 1 μ L of the extracted genome DNA, detecting its integrity and concentration by agarose gel electrophoresis, and amplifying with the genome DNA of transgenic plant as templateLrDef1After the PCR is finished, 8 mu L of the product is used for agarose gel electrophoresis to detect positive transgenic plants, the amplification result of part of transgenic tobacco is shown in figure 1, and 30 positive transgenic tobacco plants are screened out altogether.

Example 4: in transgenic tobaccoLrDef1Expression analysis and functional analysis of transgenic plants against fungal infection

Taking positive transgenic single plant and tender leaf of non-transgenic tobacco (wild type) to extract total RNA, reverse transcribing to generate first strand cDNA, and using it as template to make amplificationLrDef1The specific primers are used for carrying out PCR, and each transgenic individual is analyzed according to the PCR resultLrDef1The expression of transcription level, total RNA extraction and RT-PCR were performed as in example 1, after PCR was completed, 8. mu.L of the DNA was subjected to agarose gel electrophoresis, and the results of detection of some individuals were shown in FIG. 2, and 20 transgenic individuals were detected in totalLrDef1The expression was carried out at the transcriptional level, and the individuals were numbered L1-L20.

Several kinds of pathogenic fungi stored in a laboratory are inoculated on a PDA solid culture medium (200 g/L of potato, 15g/L of agar and 20g/L of glucose), dark culture is carried out at 28 ℃, plant protein is added when bacterial colonies grow to be about 2-3cm in diameter, and the in-vitro antifungal activity of transgenic plants is analyzed. In order to prevent other bacteria from polluting the extracted protein, the whole process of extracting the vegetable protein is aseptic operation. Firstly, 1g of transgenic tobacco single plant (numbered L-8, L-9 and L-16 respectively) and wild type leaf are put into a mortar, and 1mL of protein extract (1M NaCL and 0)1M sodium acetate, 1% PVP, ph6.0), triturated well. Transferring into a 1.5mL centrifuge tube, mixing uniformly, and standing overnight at 4 ℃. Centrifuge at 4 deg.C for 30min (12,000g/min), take the supernatant in a new 1.5mL centrifuge tube, and take an appropriate amount to determine the total protein concentration with an ultraviolet spectrophotometer. The total protein concentration of the transgenic and wild type plants was adjusted to 0.2. mu.g/. mu.L, and then 20. mu.L of each was dropped onto sterile filter paper of each fungal culture. In addition to the total protein of the different transgenic tobacco plants, the total protein of the wild type tobacco and a blank (protein extract) were added in parallel to each fungal plate. The growth of the fungus was observed after several days of cultivation at 28 ℃ and evaluated based on the observationLrDef1The results of the in vitro antifungal activity of the transgenic tobacco are shown in FIG. 3,LrDef1the transgenic tobacco protein has obvious inhibition effect on the growth of fusarium oxysporum, phoma herbarum and fusarium equiseti.

Sequence listing

<110> university of Kunming science

<120> Lilium regale defensin antibacterial peptide gene LrDEF1 and application

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 501

<212> DNA

<213> Lilium regale Wilson

<400> 1

tcgtcgtccc catctcagtg gccgactatc tcttgcaatg gcgaagcttc ccaccatcct 60

gctgctcttg ttccttgtca tggccactga gatggggacg acgacggtgg aggcgaggac 120

atgcctgtcg cagagccaca agttcaaggg gacctgtttg agggcggcca actgtgctag 180

tgtctgccag acggagggat tcaaaggagg ggtttgcgag ggcatccgcc gccgttgctt 240

ctgcgaagcc gactgtcact gatgcctgag ttcttggctt taataagtaa tgtcggacta 300

tccgagaaga ataagatgga cctggtgttg ttggttttac agtctcttct tcggtgtggg 360

gactcggtac tttcatctag gtttctgata tgtagttgtt catgtctggg ttgagctgta 420

gggctgtgtg ctgtagttgg atttgtagtg gagtaagttc tcttgtattt gatttgtagt 480

ggagtaagtt ctcttgtatt t 501

<210> 2

<211> 74

<212> PRT

<213> Lilium regale Wilson

<400> 2

Met Ala Lys Leu Pro Thr Ile Leu Leu Leu Leu Phe Leu Val Met Ala

1 5 10 15

Thr Glu Met Gly Thr Thr Thr Val Glu Ala Arg Thr Cys Leu Ser Gln

20 25 30

Ser His Lys Phe Lys Gly Thr Cys Leu Arg Ala Ala Asn Cys Ala Ser

35 40 45

Val Cys Gln Thr Glu Gly Phe Lys Gly Gly Val Cys Glu Gly Ile Arg

50 55 60

Arg Arg Cys Phe Cys Glu Ala Asp Cys His

65 70

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence (Artificial)

<400> 3

tcgtcgtccc catctcag 18

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 4

aaatacaaga gaacttactc ca 22

Claims (2)

1. Lilium regale defensin antibacterial peptide groupDue to the fact thatLrDef1The nucleotide sequence is shown in SEQ ID NO. 1.

2. The Lilium regale defensin antibacterial peptide gene as claimed in claim 1LrDef1In increasing the resistance of tobacco to fusarium oxysporum (F.), (Fusarium oxysporum) Phoma graminearum (A) and (B)Phoma herbarum) Fusarium equiseti (F.) hieron (F.)Fusarium equiseti) Use in resistance.

Images