CN109234284B - Pseudo-ginseng sweet protein gene PnTLP5 and application - Google Patents

Abstract

The invention discloses a disease course related protein 5 family sweet protein gene of panax notoginsengPnTLP5The nucleotide sequence is shown in SEQ ID NO. 1, and the code is shown in SEQ ID NO:2, the pseudo-ginseng sweet protein of the amino acid sequence shown in the specification; the invention is proved by the research of related technologies of molecular biology and genetic engineeringPnTLP5The gene has the function of improving the plant antifungal property, and the invention is used for resisting the fungiPnTLP5The gene is constructed on a plant expression vector and is transferred into tobacco for over-expression, and the transgenic tobacco plant has strong in-vitro antifungal activity and over-expressionPnTLP5The transgenic tobacco has obvious inhibiting effect on the growth of five fungi such as sclerotinia sclerotiorum, fusarium solani, fusarium verticillioides, alternaria ginseng, aschersonia viticola and the like.

Description

Pseudo-ginseng sweet protein gene PnTLP5 and application

Technical Field

The invention relates to the field of molecular biology and genetic engineering related technical research, in particular to a panax notoginseng sweet protein gene with antifungal activityPnTLP5And application thereof.

Background

Notoginseng (radix Notoginseng)Panax notoginseng) Is a Chinese herbal medicine with a long history in China. Pseudo-ginseng is mainly produced in inkstone county, marshall, western domain, guannan, mahonia kunmi slope, funing, qibei and the like in Yunnan wenshan mountain, and is also planted in Guangxi Tianyang, Jingxi, Tiandong, Debao and the like. Panax notoginseng (Burk.) F.H. Chen has long history, high yield and good quality, and is known as "Wen Notoginseng" and "Tianqi" as famous genuine herbs. The diseases and insect pests of the pseudo-ginseng are serious when the pseudo-ginseng grows in a shady and shaded environment all the year round, and according to statistics, the diseases and insect pests of the pseudo-ginseng are about more than 20. Wherein, the main diseases are root rot, black spot, round spot, epidemic disease, powdery mildew, slug, cutworm, aphid, scale insect, inchworm and the like, and the panax notoginseng causes serious loss due to the harm of diseases and insects every year. Therefore, the enhancement of the disease and insect pest control of the panax notoginseng is a main measure for ensuring the yield and the quality of the panax notoginseng.

The disease problem in the cultivation of the panax notoginseng is prominent, wherein the black spot of the panax notoginseng is one of the main diseases in the seven gardens. The stem, leaf and flower of notoginseng can be damaged, the damaged part is in the form of elliptic light brown disease spot at the initial stage, then becomes black brown, the disease spot expands and caves up and down, and finally the stem or flower disc is twisted and dies. The yield and quality of the victims of panax notoginseng are reduced by over 90 percent. At present, the fungus diseases of the panax notoginseng are controlled in the following modes: the use of chemical fungicides; rotation is adopted, and the propagation of bacteria-bearing soil and pathogenic plant materials is avoided. But the problem of pseudo-ginseng disease cannot be fundamentally solved no matter chemical sterilization or crop rotation. However, with the continuous development of molecular biology theory and technology, people can not only deeply understand the interaction mechanism of plants and pathogens from the molecular level, but also can quickly and efficiently culture new varieties of disease-resistant crops through genetic engineering, and the method is a novel method for improving the disease resistance of plants.

The earliest disease-related Proteins (PRs) were derived from tobacco (Nicotiana tabacum: (Nicotiana tabacum L.) (Nicotiana tabacum) Mosaic Virus (TMV) infected Tobacco leaves are found, depending on amino acid composition, biochemical and serological properties,PRs are divided into 17 distinct protein families, namely PR-1 to PR-17. Because of the amino acid sequence of some proteins in PR-5 family and the Chinese yam of West FeddeiThaumatococcus daniellii ) The amino acid sequence of Thaumatin (Thaumatin) is highly homologous and is therefore also known as Thaumatin-like proteins (TLPs) (Lewen, Liu Di Qiu, et al. structural features and functional studies of Thaumatin-like proteins have advanced, J.Bioengineering, 2010, 30 (3): 100-104.). TLPs are widely distributed in higher plants, including pollen tube walls, spermatid walls, sieve tube end walls, etc., and play an important role in the normal growth and development of plants. More importantly, TLPs also play an important role in the disease resistance of plants. TLPs are related to the stress resistance of plants, and when the plants are stressed by pathogens, chemical factors, physical factors and the like,TLPsthe gene is rapidly expressed and accumulated at a specific part of a plant body (Xiaolingling, Huangqiong Mao, etc. progress in the research of the sweet protein gene family of plants, Xue Jiang university of agriculture and forestry, 2012, 29(2): 279-287.). Many studies have found that plant TLPs have significant antifungal activity, some of which are transTLPsThe resistance of the transgenic plants to fungal diseases has also been significantly enhanced, and thus in recent years, the antifungal function of TLPs has received increasing attention in the study of plant pathology.

Known TLPs belong to the seventeenth family of glycosyl hydrolases, and the most important structural features of TLPs are 8 disulfide bonds formed by pairing of 16 cysteine residues in the molecule, and due to the existence of these disulfide bonds, TLPs have a relatively stable chemical structure and are resistant to heat, enzymolysis and acid and alkali. Such as carrotsTLPsAll contain 16 cysteine residues, and most have a sweet protein family label G-X- [ GF]-X-C-X-T-[GA]-D-C-X- (1, 2) -G-X- (2, 3) -C and 5 conserved REDDD amino acid residues (Liu D, He X, et al. Molecular cloning of a thaumatin-like protein gene from pyrus pyrifoliaand expression of this gene in nanobioc created resistance to genetic fungi Plant Cell, Tissue and Organ Culture (PCTOC), 2012, 111 (1): 29-39.). Some TLPs contain an N-terminal signal peptide for directing the mature protein to the secretory pathway. Such as sweet protein base of Malus hupehensisDue to the fact thatMhPR5The N-terminal also contains 1 signal peptide consisting of 25 amino acid residues (Zhangzhen, clone of Hubei crabapple disease-resistant related gene and functional analysis thereof, Nanjing agriculture university, 2011). The tertiary structure of TLPs proteins is generally composed of 3 domains, domain I is formed by 11 β sheets (β -sheet) folded antiparallel, domain II and domain III are mainly composed of α -helical regions, and a Cleft (Cleft) with strong electronegativity is formed between domain I and domain II. However, there are some specific TLPs, whose tertiary structure only has domain I and domain II, and even some TLPs only contain domain I, and thus plant TLPs have different molecular weights, typically 16-40 kDa.

TLPsThe expression of the gene is related to the plant growth environment and the disease resistance of the plant. Cedar (A), (B), (C), (D), (Juniperus ashei) Having allergenic activity in pollenTLPsThe content difference in different years is up to 5.0 times or more (A Zamani, RN Sturrock, et al. Gene cloning and tissue expression analysis of a PR-5 thaumatin-like protein) phellinus weirii-fed douglas-fir, Phytopathology, 2004, 94 (11): 1235-. Barley (A)Hordeum vulgare) And oats: (Avena sativa) During the process from the ovary wall to the aleurone layer,TLPsthe expression of the gene is altered. PepperTLPsThe gene is also expressed during fruit growth. Crown rot of wheat (Fusarium pseudograminearum) Disease-resistant wheat variety after infection for 4 daysTLPsThe gene expression is obviously higher than that of susceptible varieties. However, there are someTLPsThe gene is insensitive to pathogenic bacteria stress, and is expressed in large quantity when the plant is induced by chemical or physical factors (Xiaolingling, Huangqiuzao et al. progress of research of plant sweet protein gene family. Zhejiang agriculture and forestry university report 2012, 29(2):279 287).

The antimicrobial action of TLPs is mainly reflected by their unique domains and acidic clefts. Rye (A), (B)Secale cereale) The interaction of acidic residues in domain I of TLPs with aquaporins, ion-channel proteins and osmoreceptors on fungal cell membranes, renders TLPs antifungal activity (Chan Y, Gri)ffith M, et al. Cloning of a cDNA encoding the thaumatin-like protein of winter rye (Secale cerealeL, Musketeer) and its functional characterization, Journal of Experimental Botany, 1999, 50(339): 1627-. Binding of TLPs to pathogenic bacteria beta-1, 3-glucan occurs in the cleft region, several residues in the cleft region form hydrogen bonds with carbohydrates of the fungal cell wall, and aromatic amino acids participate in forming stacking force at the cleft region to destroy the structure of the fungal cell wall together, so that TLPs contact with the cell membrane, and the fungal cell is killed. Altering the cell wall structure is a prerequisite for TLPs to inhibit fungal infestation. TLPs can alter the cell structure through other means besides specific binding to beta-1, 3-glucan on the cell wall to alter the cell wall structure.

Disclosure of Invention

The invention aims to provide a full-length gene for cloning and obtaining a sweet-like protein with antifungal activity from pseudo-ginsengPnTLP5Notoginseng sweet protein genePnTLP5The nucleotide sequence is shown as SEQ ID NO. 1, the gene cDNA full length sequence is 1170 bp, comprises an open reading frame of 726 bp, a 5 'untranslated region of 186 bp, a 3' untranslated region of 258 bp, and encodes protein of the amino acid sequence shown as SEQ ID NO. 2.

The present invention separates and clones complete cDNA segment of antifungal related gene of notoginseng and utilizes Agrobacterium tumefaciens (A. tumefaciens)Agrobacterium tumefaciens) The target gene is transferred into a receptor plant by a mediation method and is over-expressed, whether the gene has antifungal activity is verified by further experiments, a foundation is laid for the capability of improving tobacco and other plants to resist fungal diseases by utilizing the gene in the later period, and the inventor names the gene asPnTLP5。

The invention relates to a pseudo-ginseng disease course related protein 5 family sweet protein genePnTLP5Application of the compound in improving the resistance of tobacco to fusarium solani (F)Fusarium solani) Fusarium verticillatum (A)F. verticillioides) Sclerotinia sclerotiorum (A) and (B)Sclerotinia sclerotiorum) Ginseng, alternaria alternata (Alternaria panax) Staphylococus viticola (A. vinifera)Botryosphaeria dothidea) Resistance, in particularThe operation is as follows:

(1) extracting total RNA of young leaf of Notoginseng radix by guanidinium isothiocyanate method, extracting RNA as template, extracting oligo (dT)15 as Reverse transcription primer, and amplifying by Reverse transcription-polymerase chain reaction (RT-PCR)PnTLP5Then connecting the coding region to a pMD-18T vector, and obtaining a clone with a target gene through sequencing;

(2) using restriction endonucleasesBamHI andEcoRI enzyme digestion pMD-18T-PnTLP5Obtaining target gene fragment by glue recovery, using same endonuclease to enzyme-cut plant expression vector pCAMBIA2300s, obtaining required vector large fragment by glue recovery, and obtaining the obtained vector large fragmentPnTLP5Connecting the gene fragment with the pCAMBIA2300s fragment to construct a plant overexpression vector, and then transferring the constructed recombinant vector into tobacco to express through the mediation of agrobacterium tumefaciens;

(3) the regenerated tobacco plant is screened by a marker (kanamycin resistance gene) on the recombinant vector T-DNA, a real transgenic plant is obtained through PCR and RT-PCR detection, the inhibition activity of leaf protein of the transgenic plant on the growth of fungi is analyzed, and finally the transgenic plant with obviously enhanced fungal resistance is screened.

The invention provides a new method for improving the resistance of plants to fungal diseases, the defects of traditional breeding can be overcome by cultivating disease-resistant plants by means of genetic engineering, the breeding period is shortened, the operation is simple, and high-resistance materials are easy to obtain; the present invention relates to a sweet-like protein gene derived from Panax notoginsengPnTLP5Can enhance the resistance of plants to various pathogenic fungi, and can generate new varieties and new materials with fungal resistance by introducing the gene into tobacco. The cultivation of resistant plant varieties and materials by using genetic engineering technology has obvious advantages and irreplaceable importance. The invention not only can provide convenience for large-scale production of grain crops, economic crops, Chinese herbal medicines, ornamental plants and the like, reduce the use of chemical pesticides, but also can save the cost for agricultural production and reduce the environmental pollution, thereby having wide market application prospect.

Drawings

FIG. 1 is a part of the present inventionPnTLP5The PCR detection result of the transgenic tobacco genome DNA is shown as follows: the Marker is DL2000 DNA Marker (Dalibao biology); the positive control is plasmid pMD-18T-PnTLP5PCR products as templates; WT is the product of PCR using total DNA of non-transgenic tobacco (wild type) as template;

FIG. 2 is a partial positive of the present inventionPnTLP5In transgenic tobaccoPnTLP5A graph of the results of expression analysis at the transcriptional level; in the figure: marker is DL2000 DNA Marker (Dalibao biology); WT is a PCR product with non-transgenic tobacco total RNA reverse transcription cDNA as a template; the positive control was plasmid pMD-18T-PnTLP5A PCR product as a template;

FIG. 3 is a drawing of the present inventionPnTLP5The in vitro bacteriostatic activity effect graph of the transgenic tobacco; in the figure, a, b, c, d and e are sclerotinia sclerotiorum, ginseng alternaria, fusarium verticillium, fusarium solani and botrytis respectively; WT is the total protein of wild type tobacco; buffer is a blank control, i.e. a no protein control (Buffer used for protein extraction).

Detailed Description

The present invention is further illustrated by the following figures and examples, but the scope of the present invention is not limited to the above description, and the examples are conventional methods unless otherwise specified, and reagents used are conventional commercially available reagents or reagents formulated according to conventional methods unless otherwise specified.

Example 1:PnTLP5 full-Length Gene cloning and sequence analysis

Extracting total RNA from three-year-old panax notoginseng leaves, grinding the panax notoginseng leaves into powder by using liquid nitrogen, transferring the powder into a centrifugal tube, extracting the total RNA by using a guanidinium isothiocyanate method, synthesizing a cDNA first chain by using reverse transcriptase M-MLV (promega) and using the total RNA as a template, wherein a reaction system and an operation process are as follows: taking 5 μ g of Total RNA, adding 50 ng oligo (dT), 2 μ L dNTP (2.5 mM each) and DEPC water in turn to make the reaction volume be 14.5 μ L; after mixing, heating and denaturation at 70 ℃ for 5 min, then rapidly cooling on ice for 5 min, then adding 4 μ L of 5 XFirst-stand buffer, 0.5 μ L of RNase (200U) and 1 μ L M-MLV (200U) in sequence, mixing and centrifuging for a short time, bathing at 42 ℃ for 1.5 h, taking out, heating at 70 ℃ for 10 min, and terminating the reaction. The first strand cDNA is synthesized and stored at-20 deg.C for further use.

Amplifying target gene using synthesized first strand cDNA as templatePnTLP5The sequences of the upstream and downstream primers used were 5 'TTGTCAACTTAAACAATATGAGCTA 3' and 5 'AACCTTTTAACTTATTGGAACTGCT 3', respectively. Advantage is taken^TM2 PCR Enzyme (Clontech) amplifies the target gene; and (3) PCR reaction conditions: 2 min at 95 ℃; 30 cycles of 95 ℃ for 30s, 57 ℃ for 30s, and 72 ℃ for 1 min; 10 min at 72 ℃; the reaction system (20. mu.L) was 1. mu.L of cDNA, 2. mu.L of 10 × Advantage 2 PCR Buffer, 1.8. mu.L of 50 × dNTP Mix (10 mM each), 0.2. mu.L of forward primer (10. mu.M), 0.2. mu.L of reverse primer (10. mu.M), 0.2. mu.L of Advantage 2 PCR Polymerase Mix, 14.6. mu.L of PCR-Grade water; after the PCR was completed, 5. mu.L of the resulting mixture was subjected to agarose gel electrophoresis to examine the specificity and size of the amplified product.

The agarose gel electrophoresis result shows that the PCR product has only one DNA band, so the TA cloning is directly carried out on the PCR product, the used kit is pMD18-T vector kit (Dalianbao biology), and the reaction system and the operation process are as follows: mu.L of the PCR product was taken, and 1. mu.L of pMD18-T vector (50 ng/. mu.L) and 2.5. mu.L of 2 × Ligation solution I were added in this order, mixed well and allowed to react overnight at 16 ℃. The ligation product was transformed into E.coli DH 5. alpha. using a heat shock transformation method. Screening positive clones with LB solid medium containing Ampicillin (Ampicillin, Amp), selecting several single colonies, shaking, and amplifyingPnTLP5Identifying the multiple cloning site insertionPnTLP5The clones identified are sequenced and finally obtainedPnTLP5The full-length cDNA was 1170 bp, which was found to contain an open reading frame of 726 bp by NCBI ORF finder (http:// www.ncbi.nlm.nih.gov/gorf. html) analysis (see sequence listing),PnTLP5 encodes a 241 amino acid protein PnPTLP 5, the molecular weight of the protein is 26.4 kD, and the isoelectric point (pI) is 7.75, which indicates that the protein is basic protein. These include 16 acidic (D, E), 19 basic (K, R, H), 113 hydrophobic and 89 hydrophilic amino acids. Gene structure analysis finding by SMARTPnTLP5 has one possible signal peptide.

Example 2: construction of plant overexpression vectors

The insertion is extracted by adopting a SanPrep column type plasmid DNA small extraction kit (Shanghai worker)PnTLP5The Escherichia coli plasmid pMD-18T-PnTLP5And the plasmid of the plant expression vector pCAMBIA2300s, taking 1 microliter to be used for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmid; using restriction endonucleasesBamHI (TaKaRa) andEcoRI (TaKaRa) against plasmid pMD-18T-PnTLP5And pCAMBIA2300s (100 mu L system), wherein the reaction system and the operation process are as follows: taking 20. mu.L of pMD-18T-PnTLP5And pCAMBIA2300s plasmid, 10. mu.L 10 XK buffer, and 5. mu.L BamHI、5 μL EcoRI、60 μL ddH₂O, mixing uniformly, centrifuging for a short time, and reacting at 37 ℃ overnight; all the products of the digestion are spotted in agarose gel for electrophoresis, and thenPnTLP5Respectively carrying out gel recovery on the fragment and the large fragment of the pCAMBIA2300s vector; taking 1 microliter of the recovered product, detecting the size and concentration of the recovered fragment by agarose gel electrophoresis, and storing at-20 ℃ for later use.

The recovered DNA was purified by using T4 DNA Ligase (TaKaRa)PnTLP5 The DNA fragment and the pCAMBIA2300s vector fragment were ligated, and the reaction system (20. mu.L) and the procedure were as follows: taking 10 μ LPnTLP5 The DNA fragment was sequentially added with 2. mu.L of pCAMBIA2300s vector DNA, 2. mu.L of 10 XT 4 DNA Ligase Buffer, 1. mu. L T4 DNA Ligase, and 5. mu.L of ddH₂And O, mixing uniformly, centrifuging for a short time, and then carrying out water bath at 16 ℃ for overnight reaction. The ligation products were then transferred into E.coli DH 5. alpha. by heat shock transformation and positive clones were selected on solid medium containing 50 mg/L Kanamycin (Kanamycin, Km). Selecting single colony shake bacteria, taking bacteria liquid as template for amplificationPnTLP5The specific primers of (1) are subjected to PCR, and selectedPnTLP5If the detected strain is positive, the clone successfully connected with pCAMBIA2300s is added with glycerol and stored at-80 ℃ for later use.

Extracting and purifying pCAMBIA2300s-PnTLP5A plasmid. Then freezing and thawing by liquid nitrogenThe plant expression vector pCAMBIA2300s-PnTLP5Transferred into Agrobacterium tumefaciens LBA4404 competent cells. The operation steps are as follows: taking 2 μ g of pCAMBIA2300s-PnTLP5The plasmid is added into a centrifuge tube containing 200 mu L of competent cells, the mixture is gently mixed and then is subjected to ice bath for 5 min, then the mixture is transferred into liquid nitrogen to be frozen for 1 min, then the mixture is rapidly placed in a water bath at 37 ℃ for 5 min, then is subjected to ice bath for 2 min immediately, and is added with 800 mu L of LB liquid culture medium to be subjected to shaking culture at 28 ℃ for 4 h. The activated agrobacterium is smeared on LB solid culture medium containing 50 mg/L Km and is statically cultured at 28 ℃. Selecting single colony shake bacteria, and amplifyingPnTLP5The specific primer of (2) is used for PCR to detect pCAMBIA2300s-PnTLP5Whether it is transferred into agrobacterium. For positive clones, glycerol was added and stored at-80 ℃ for future use.

Example 3: agrobacterium-mediated genetic transformation of plants and transgenic plant screens

The transgenic recipient in this experiment was tobacco, tobacco seeds were soaked in 75% ethanol for 30s, washed with sterile water and then washed with 0.1% HgCl₂Soaking for 8 min, washing with sterile water for several times, sowing on 1/2MS culture medium, dark culturing at 28 deg.C for 6 d, germinating, transferring to light incubator (25 deg.C, 16h/d light), and subculturing with 1/2MS culture medium once a month.

The preserved liquid containing pCAMBIA2300s was taken out from the-80 ℃ refrigeratorPnTLP5Agrobacterium LBA4404 strain of plasmid was inoculated into 5 mL LB liquid medium containing 50 mg/L Km and 20 mg/L rifampicin, and cultured at 28 ℃ until the medium became turbid. Sucking 1 mL of turbid bacterial liquid to an LB solid culture medium containing 50 mg/L Km, and culturing for 48 h at 28 ℃; then, appropriate amount of the agrobacteria on LB solid medium was scraped and inoculated into MGL liquid medium supplemented with 20 mg/L acetosyringone, and shake-cultured at 28 ℃ for 2-3 h to activate the agrobacteria.

Cutting leaves of aseptic seedling of tobacco into 1 cm²The left and right leaf discs are completely soaked in the MGL liquid culture medium containing the activated agrobacterium, the dip dyeing time is 15 min, the bacteria liquid on the surfaces of the leaf discs is sucked dry by sterile filter paper, the leaf discs are placed on a co-culture medium for room temperature culture, the co-culture medium for tobacco transformation is MS +0.02 mg/L6-BA +2.1 mg/L NAA +30 g/L sucrose +6 g/L agar,the cells were cultured at 22 ℃ for 2 days in the absence of light.

Transferring the co-cultured leaf discs to an MS screening culture medium added with antibiotics to be divided into seedlings, and screening transgenic plants. The tobacco screening culture medium is MS +0.5 mg/L6-BA +0.1 mg/L NAA +30 g/L sucrose +6 g/L agar +50 mg/L Km +200 mg/L cephamycin (Cef); during screening culture, the culture bottle is transferred to an illumination incubator for culture (25 ℃, 16h/d illumination and 8h/d darkness), after the tobacco buds, the MS culture medium containing 50 mg/L Km and 200 mg/L Cef is used for subculture, and finally, the regenerated seedlings with better rooting are selected for PCR detection.

Extracting genome DNA of transgenic tobacco plant leaf by CTAB method, collecting 1 μ L of the extracted genome DNA, detecting its integrity and concentration by agarose gel electrophoresis, and amplifying with the genome DNA of transgenic plant as templatePnTLP5After the PCR is finished, 8 mu L of the product is used for agarose gel electrophoresis to detect positive transgenic plants, the amplification result of part of tobacco transgenic plants is shown in figure 1,PnTLP530 positive transgenic plants are screened out from the transgenic tobacco.

Example 4: in transgenic tobaccoPnTLP5Expression analysis and antifungal Activity analysis of transgenic plants

Taking positive transgenic single plant and tender leaf of non-transgenic tobacco (wild type) to extract total RNA, reverse transcribing to generate first strand cDNA, and using it as template to make amplificationPnTLP5The specific primers are used for carrying out PCR, and each transgenic individual is analyzed according to the PCR resultPnTLP5The expression of transcription level, total RNA extraction and RT-PCR were performed in the same manner as in example 1, and after completion of PCR, 5. mu.L of the DNA was subjected to agarose gel electrophoresis, and the results of detection of a part of the individual strains are shown in FIG. 2.

Inoculating a plurality of fungi stored in a laboratory on a PDA solid culture medium (200 g/L of potatoes, 15 g/L of agar and 20 g/L of glucose), carrying out dark culture at 28 ℃, adding protein when bacterial colonies grow to the diameter of about 2-3 cm, and analyzing the in-vitro antifungal activity of a transgenic plant. In order to prevent the extracted protein from being polluted by other mixed bacteria, the whole vegetable protein extraction process is aseptic operation, and 1 g of transbasal medium is firstly takenBecause the tobacco single plant (numbered 4, 11, 19 and 26 respectively) and the wild type leaf are put into a mortar, 1 mL of protein extracting solution (1M NaCl, 0.1M sodium acetate, 1% PVP, pH 6) is added, and the mixture is fully ground; transferring into 1.5 mL centrifuge tube, mixing, standing overnight at 4 deg.C, centrifuging at 4 deg.C for 30 min (12,000 g/min), collecting supernatant, and determining total protein concentration with ultraviolet spectrophotometer. The total protein concentration of the transgenic and wild type plants was adjusted to 1.2. mu.g/. mu.L, then 20. mu.L of each was dropped on sterile filter paper of each fungus culture medium, total protein of different transgenic tobacco plants was added to each fungus plate, total protein of wild type tobacco and blank control (solution for protein extraction) were added in parallel, and after culturing at 28 ℃ for several days, growth of each treated fungus was observed and evaluated based on the resultsPnTLP5The results of the in vitro antifungal activity of the transgenic tobacco are shown in FIG. 3,PnTLP5the transgenic tobacco leaf protein has strong inhibiting effect on the growth of sclerotinia sclerotiorum, ginseng alternaria, fusarium verticillium, fusarium solani and gluconobacter vinifera.

Sequence listing

<110> university of Kunming science

<120> pseudo-ginseng sweet protein gene PntTLP 5 and application

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1170

<212> DNA

<213> Panax notoginseng

<400> 1

ggccgcctct agttttagta caatatagtg gcggtattct ttaactaaaa taatgacaag 60

tcagaagagt ggcttatcta ggtgaagtta aaagccgccc ttaccctata taaatccttc 120

atttgctcac aataaaaaac caagctcaaa ttatacaaat attaatttgt tgtcaactta 180

aacaatatga gctacttggc cattgtccca ttcctcctcc tcctccctag cctcttcacc 240

atcaccagtg ccgcgacttt tgaaatccgc aacaactgcc cttacaccgt gtgggctgca 300

gcttcgccag gtggtggtcg tcgacttaac cgaggcgaaa cttggtggtt atatgcacct 360

cctggcacca aaatggcacg catttggggt cgaaccaatt gcaactttga tggttccggt 420

aggggccgct gccaaacagg agattgtggg tccctccagt gcactggctg gggagtccca 480

ccgaataccc tagccgaata tgccctgaac caattcggta acctagattt ttatgacatt 540

tcactagtag atggattcaa tattcctatg gatttcagcc ccaccactaa tcttggaggg 600

aaatgcaaac aacttctgtg tacggcggat atcaacgggc aatgcccgaa cccaatgcgg 660

gttgcgggtg ggtgtaataa cccatgcacg acgttcaaga ctccacaata ctgttgcacc 720

aatggaccat gtggccccac aggttactca aggtttttca aggaaaggtg ccctgatgcc 780

tatagttatc ctcaggatga tccaactagt acttttactt gccccggaaa tagtaattat 840

agggttgtgt tttgcccttg gggatctcct catctggaga taaatggaag tgattataag 900

cagttccaat aagttaaaag gttcaaaatt tgcacgcatg cgtgtgtgaa ggttccacca 960

ctaccgtaca aataagtttt ttgttaaaac caaataacag tgagaaagtg agggaaaaga 1020

gtgtgctagt aattaagtgg tggttgtttt aatgtaattt gttatcttct tgttgttttg 1080

atgtaatttg ttagctaact tcttgttagc agatggaaac atgatcagta gtactatata 1140

tgactaaaaa aaaaaaaaaa aaaaaaaaaa 1170

<210> 2

<211> 241

<212> PRT

<213> Panax notoginseng

<400> 2

Met Ser Tyr Leu Ala Ile Val Pro Phe Leu Leu Leu Leu Pro Ser Leu

1 5 10 15

Phe Thr Ile Thr Ser Ala Ala Thr Phe Glu Ile Arg Asn Asn Cys Pro

20 25 30

Tyr Thr Val Trp Ala Ala Ala Ser Pro Gly Gly Gly Arg Arg Leu Asn

35 40 45

Arg Gly Glu Thr Trp Trp Leu Tyr Ala Pro Pro Gly Thr Lys Met Ala

50 55 60

Arg Ile Trp Gly Arg Thr Asn Cys Asn Phe Asp Gly Ser Gly Arg Gly

65 70 75 80

Arg Cys Gln Thr Gly Asp Cys Gly Ser Leu Gln Cys Thr Gly Trp Gly

85 90 95

Val Pro Pro Asn Thr Leu Ala Glu Tyr Ala Leu Asn Gln Phe Gly Asn

100 105 110

Leu Asp Phe Tyr Asp Ile Ser Leu Val Asp Gly Phe Asn Ile Pro Met

115 120 125

Asp Phe Ser Pro Thr Thr Asn Leu Gly Gly Lys Cys Lys Gln Leu Leu

130 135 140

Cys Thr Ala Asp Ile Asn Gly Gln Cys Pro Asn Pro Met Arg Val Ala

145 150 155 160

Gly Gly Cys Asn Asn Pro Cys Thr Thr Phe Lys Thr Pro Gln Tyr Cys

165 170 175

Cys Thr Asn Gly Pro Cys Gly Pro Thr Gly Tyr Ser Arg Phe Phe Lys

180 185 190

Glu Arg Cys Pro Asp Ala Tyr Ser Tyr Pro Gln Asp Asp Pro Thr Ser

195 200 205

Thr Phe Thr Cys Pro Gly Asn Ser Asn Tyr Arg Val Val Phe Cys Pro

210 215 220

Trp Gly Ser Pro His Leu Glu Ile Asn Gly Ser Asp Tyr Lys Gln Phe

225 230 235 240

Gln

<210> 3

<211> 25

<212> DNA

<213> Artificial sequence (Artificial)

<400> 3

ttgtcaactt aaacaatatg agcta 25

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence (Artificial)

<400> 4

aaccttttaa cttattggaa ctgct 25

Claims (2)

1. Pseudo-ginseng sweet protein genePnTLP5The method is characterized in that: the nucleotide sequence is shown as SEQ ID NO:1 is shown.

2. The thaumatin gene of notoginseng of claim 1PnTLP5In increasing the resistance of tobacco to fusarium solani: (Fusarium solani) Fusarium verticillatum (A)F. verticillioides) Sclerotinia sclerotiorum (A) and (B)Sclerotinia sclerotiorum) Ginseng, alternaria alternata (Alternaria panax) Staphylococus viticola (A. vinifera)Botryosphaeria dothidea) Use in resistance.

Images