CN106636091A - Litchi leaf specific expression gene LcGRX promoter and application thereof - Google Patents
Litchi leaf specific expression gene LcGRX promoter and application thereof Download PDFInfo
- Publication number
- CN106636091A CN106636091A CN201611039268.1A CN201611039268A CN106636091A CN 106636091 A CN106636091 A CN 106636091A CN 201611039268 A CN201611039268 A CN 201611039268A CN 106636091 A CN106636091 A CN 106636091A
- Authority
- CN
- China
- Prior art keywords
- lcgrx
- promoter
- specific expression
- gene
- litchi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8225—Leaf-specific, e.g. including petioles, stomata
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a litchi leaf specific expression gene LcGRX promoter and application thereof. The invention provides (1) a method for obtaining a primer sequence of the litchi leaf specific expression gene LcGRX promoter, (2) a construction method of a recombinant expression vector which takes pCAMBIA1304 as a basic expression vector and contains the LcGRX promoter and an LcTLP gene segment, and (3) a method for verifying the function of the promoter by using biolistic transformation and GUS transient gene expression. An experiment shows that the litchi leaf specific expression promoter is cloned from litchi and is verified to be a promoter for tissue specific expression, so that a basis is supplied to further transgenic breeding of litchi.
Description
Technical field
The present invention relates to start subdomains, in particular to a kind of Litchi Leaves specific expression gene LcGRX promoters and its
Using.
Background technology
Lichee is a kind of important fruit tree in south China, and critical role is occupied in agricultural economy.However, adopt front fruit easily being eaten into
The harm such as base of a fruit worm causes shedding serious, so as to reduce Yield of Litchi；Rear litchi fruits not storage tolerance is adopted, pericarp browning, disease are tight
Weight and dehydration are dried and easily split, and serious curtailment lichee shelf life reduces the commodity value of lichee, limit lichee industry and send out
Exhibition.The new varieties for cultivating the resistance to storage of multi-resistance high-quality are the fundamental ways for solving these problems.But because lichee hereditary basis is narrow, lack
Weary Resistance resource, makes resistance breeding make slow progress.
In history, crossbreeding with grow directly from seeds seed selection be Litchi Varieties improvement main path.But, lichee juvenile phase is long, miscellaneous
Hand over breeding cycle long, and reproduction isolation is there may be between different parents and causes hybridization not affine, or because flowering asynchronism is difficult to
Hybridization, makes hybridization there is technical difficulty.Excellent strain is screened from the semi-wild colony grown directly from seeds, and then it is a kind of to cultivate as improved seeds
Effective method, but efficiency of selection is low.At present, with the acceleration of land development and utilization, lichee seedling density scale quickly contracts
It is little, add in history through repeatedly screening, select that the difficulty of excellent strain is increasing from seedling density, efficiency is lower.
The rise of modern plants transgenic technology provides new direction with lichee breeding is developed into.Transgenic technology both may be used
With the homologous gene (Cisgenesis) of the expressed receptor in acceptor, it is also possible to break the restriction of species, express to come in acceptor
From in the foreign gene (heterologous transgene) different from acceptor, so as to not by scarcity of resources affected to reach orderly improvement it is a certain or
The purpose of some proterties.
Transgenic breeding is typically all what is completed by genetic engineering, and donor, acceptor and carrier are engineered three
Big key element.Wherein, the expression of promoter regulation foreign gene, and become the important component of gene engineering expression carrier.Open
Mover can be divided three classes by the mode of action：Constitutive promoter, tissue-specific promoter and inducible promoter.Tissue is special
Specific Promoters often have the feature of inducible promoter.In transgenic breeding, tissue-specific promoter opens than composing type
Mover has wider purposes.Because constitutive promoter can have different degrees of with regulatory gene in plant is respectively organized
Expression, so that the heterologous protein or metabolite in each organ of plant is accumulated in a large number, breaks the original metabolism of plant and puts down
Weighing apparatus, or even toxin can be produced, and then the normal growth development of plant is affected, Plant death is resulted even in, in addition, also can give people
Class brings the relevant issues such as edible safety.And by using tissue-specific promoter, orientation adjustment genes of interest is in specific device
Express in official or tissue, orderly improvement crop character is one of feasible genetically modified crops Breeding Strategies.Research lichee promoter
Particularly organizing specific expression gene promoter, contributes to carrying out qualitative improvement to lichee proterties, so as to educate for lichee transgenosis
Plant and direction is provided.
The content of the invention
It is an object of the present invention to provide a kind of Litchi Leaves specific expression gene LcGRX promoters and its application, the present invention
Basis is provided for lichee genetic engineering breeding.
For achieving the above object, a kind of Litchi Leaves specific expression gene LcGRX promoters that the present invention is provided, its nucleosides
Acid sequence is as shown in SEQ IDNO.1.It derives from Sapindaceae lichee (L.chinensis Sonn) cv. Feizixiao kind.
The invention provides the primer pair for obtaining above-mentioned Litchi Leaves specific expression gene LcGRX promoters, described
Primer pair is：
Forward primer P1：5'-GTGCCCCATGACTTATTTTAT-3'；
Reverse primer P2：5'-TCTTTCACCAACCTTGCTATT-3'.
The invention provides a kind of preparation method of Litchi Leaves specific expression gene LcGRX promoters, with lichee
The lichee genomic DNA of leaf specific expressino gene LcGRX is template, using following primer pair：
Forward primer P1：5'-GTGCCCCATGACTTATTTTAT-3'；
Reverse primer P2：5'-TCTTTCACCAACCTTGCTATT-3'.
Enter performing PCR amplification, the Litchi Leaves specific expression gene LcGRX promoter sequences that it is obtained are SEQ IDNO.1
It is shown.
Preferably, the PCR reaction systems：
The PCR reaction conditions：94 DEG C of denaturations 4min；94 DEG C of denaturation 30s；61 DEG C of annealing 30s；72 DEG C of extension 2min,
After circulation 35 times；72 DEG C of extension 8min.
Present invention also offers a kind of recombinant expression carrier, it contains above-mentioned Litchi Leaves specific expression gene LcGRX and opens
The plant expression vector of mover.Preferably, plant expression vector is pCAMBIA1304.Containing promoter of the present invention
Recombinant vector, the host strain containing carrier, expression cassette, transgenic cell line or transfer-gen plant belong to the guarantor of the present invention
Shield scope.
The invention provides a kind of construction method of above-mentioned recombinant expression carrier, it is characterised in that：Comprise the following steps：
1) template design primer is shown with Litchi Leaves specific expression gene LcGRX promoter sequence such as SEQ IDNO.1
It is right, it is as follows：
LcGRX-F：AACTGCAGGTGCCCCATGACTTATTTTAT (underscore is Pst I restriction enzyme sites),
LcGRX-R：CGGAATTCTCTTTCACCAACCTTGCTATT (underscore is EcoR I restriction enzyme sites)；
2) performing PCR is entered by template of Litchi Leaves specific expression gene LcGRX sequences, PCR amplification conditions are as follows：
Reaction system：
Response procedures are：94 DEG C of denaturations 4min；94 DEG C of denaturation 30s；61 DEG C of annealing 30s；72 DEG C of extension 2min, circulation 35
After secondary；72 DEG C of extension 8min；Obtain PCR primer 1；
3) it is as follows with lichee class thaumatin T LcTLP genes as template design primer pair：
Forward primer P3：5'-CG(GAATTC) TCATGAAGCTCTTCAAAATCC-3',
Reverse primer P4：5'-GG(ACTAGT)GGGGCAAAAGACAACCTT-3'；
4) performing PCR is entered by template of lichee class thaumatin T LcTLP genes, PCR amplification conditions are as follows：
94 DEG C of denaturations 4min；94 DEG C of denaturation 30s；61 DEG C of annealing 30s；72 DEG C of extension 2min, after circulating 35 times；72 DEG C are prolonged
Stretch 8min；Obtain PCR primer 2；
5) digestion is carried out to PCR primer 1 with Pst I, EcoRI, purifying recovery is recycled product 1, with EcoRI, SpeI
Digestion is carried out to PCR primer 1, purifying recovery is recycled product 2, meanwhile, pCAMBIA1304 carriers are entered with PstI, SpeI
Row double digestion, removes CaMV35S promoters, and digestion products run agarose gel electrophoresis and detect and reclaim large fragment；
6) in 10 μ L systems, the pCAMBIA1304 carrier large fragments of recovery, recovery product 1 and recovery product 2 are used into T4
4 DEG C of connections of ligase overnight, use by connection product conversion bacillus coli DH 5 alpha competent cell, the positive colony that screening is obtained
PstI, SpeI carry out digestion verification, obtain expressing plant recombination expression vector pCAMBIA1304-GRX- of Gus genes
TLP。
The invention provides a kind of one of following items are starting destination gene expression and are cultivating answering in new variety of plant
With,
(1) above-mentioned promoter；
(2) above-mentioned recombinant expression carrier；
Further, the plant is dicotyledon.
Yet further, the plant is lichee, tomato or arabidopsis.
The beneficial effects of the present invention is：
The promoter of the present invention has the high expression of blade specific, and the characteristic of pulp low expression can be applicable to transgenosis and educate
The field of kind.By building the plant expression vector containing the promoter, plant, such as base of dicotyledon lichee etc. are transformed into
Because in group, driving genes of interest specificity overexpression in plant leaf blade, can be used to cultivate new breeding material, be further
Lichee transgenic breeding provides basis.
Description of the drawings
Fig. 1 is quantitative PCR expression figure of the LcGRX genes in lichee different tissues；
Fig. 2 is LcGRX gene promoter expression vector establishment figures；
Fig. 3 is expression activity figure of the pCAMBIA1304-GRX-TPL expression vectors in lichee different tissues.
Specific embodiment
In order to preferably explain the present invention, the main contents of the present invention are further elucidated below in conjunction with specific embodiment, but
Present disclosure is not limited solely to following examples.
The acquisition of the Litchi Leaves different expression gene LcGRX promoter sequences of embodiment 1
The ripe functional leaf and just open flower of bearing basal shoot middle part no disease and pests harm are won, experiment is transported in 3h back
Room, sterile water wash is clean, blots excessive moisture, and liquid nitrogen flash freezer, -80 DEG C of ultra low temperature freezers are saved backup.Pluck medium well " prince wife
Son is laughed at " laboratory is transported back in fruit and 3h, the healthy fruit of no disease and pests harm is selected, aqua sterilisa is rinsed for several times, blots excessive moisture,
Pericarp, seed and pulp are stripped, liquid nitrogen flash freezer, -80 DEG C of ultra low temperature freezers are saved backup." cv. Feizixiao " mature seed is in nursery plug
In cultivate healthy seedling, after 3 months, take root, aseptic water washing is clean, blots excessive moisture, liquid nitrogen flash freezer, and -80 DEG C ultralow
Temperature refrigerator is saved backup.Above material extracts total serum IgE with CHMC's ocean polysaccharide polyphenol plant RNA extraction kit.
" the I III Reverse Transcriptase that 1.6 μ g total serum IgEs taken, with the SuperScriptT of Invirtrogen
The synthesis chains of cDNA first.Concrete operations are as follows：
System is gently mixed, brief centrifugation, 25 DEG C of incubation 10min；42 DEG C of incubation 30min；85 DEG C of heating 5s；- 20 DEG C of ice
Case is preserved.
From early stage lichee, each organizes (root, leaf, flower, pericarp, pulp, fruit stone) transcript profile data analysis to show, lichee
LcGRX genes are in Ye Zhongyou very strong expression activity, and expression is very low in pulp.According to the sequence of lichee transcript profile splicing
The special primer (P1, P2) of LcGRX gene promoters is directed to the sequences Design of genome.Its sequence is
Forward primer P1：GTGCCCCATGACTTATTTTAT；
Reverse primer P2：TCTTTCACCAACCTTGCTATT.
With Litchi Varieties cv. Feizixiao blade as material, gene is extracted using the DNA Mini Kits of Ai Delai companies
Group DNA, agarose gel electrophoresis and its concentration of micro UV spectrophotometer measuring and purity.With its DNA as template, P1, P2
Enter performing PCR for primer.
Response procedures are：94 DEG C of denaturations 4min；94 DEG C of denaturation 30s；61 DEG C of annealing 30s；72 DEG C of extension 2min, circulation 35
After secondary；72 DEG C of extension 8min.
Glue reclaim purpose band is cut after agarose gel electrophoresis detection.PCR recovery products connect PMD18-T carriers, conversion
E. coli competent.After blue hickie screening, picking positive colony single bacterium colony is used to shake bacterium, extracts plasmid.Screening has amplification
The monoclonal of purpose fragment, after send Beijing Hua Da technique for gene engineering Services Co., Ltd be sequenced.Sequencing obtains LcGRX genes and compiles
Code area and upstream sequence, by obtained purpose fragment sequence and early stage sequence alignment analysis are obtained, and two sequences base composition is consistent.
Choose translation initiation site upstream 1996bp to be studied as promoter sequence, its nucleotide sequence such as SEQ IDNO.1 institutes
Show.
The lichee LcGRX genes of embodiment 2 are investigated in the expression pattern of different tissues
Due to lichee actin (actin) genes lichee each tissue expression it is basically identical, so detection litchi
The relative expression quantity of branch gene generally uses actin as reference gene.
The RT-PCR primer of the following specificity of design：
Act-F：CAACTGGTATTGTCTTGGATTCTG；
Act-R：TCATCAAGGCATCGGTTAGA.
LcGRX-RT-F：AAGACCTCTTGTTGCATCAGCT；
LcGRX-RT-R:CACCTCCTACGAGTTCTTGACC。
RT-PCR reaction systems are as follows：
Reaction condition is：95 DEG C of denaturations 30s；95 DEG C of denaturation 5s；60 DEG C of annealing 34s；Circulation 40 times, 72 DEG C of extensions
8min。
Quantitative PCR analysis result shows, LcGRX genes are expressed Litchi Leaves are high, in remaining 5 tissues expression compared with
Low, especially expression is minimum in pulp.The promoter for confirming LcGRX genes is Litchi Leaves specific expressing promoter.
The structure of the plant LcGRX gene promoter expression vectors of embodiment 3
1) template design primer is shown with Litchi Leaves specific expression gene LcGRX promoter sequence such as SEQ IDNO.1
It is right, and primer pair above adds respectively Pst I, EcoR I restriction enzyme sites and protection base, it is as follows：
Forward primer P1：5'-GTGCCCCATGACTTATTTTAT-3'；
Reverse primer P2：5'-TCTTTCACCAACCTTGCTATT-3'.
Enter performing PCR by template of Litchi Leaves specific expression gene LcGRX promoter sequences, PCR amplification conditions are as follows：
Reaction system：
Response procedures are：94 DEG C of denaturations 4min；94 DEG C of denaturation 30s；61 DEG C of annealing 30s；72 DEG C of extension 2min, circulation 35
After secondary；72 DEG C of extension 8min；Obtain PCR primer 1；
3) with the lichee class thaumatin T LcTLP genes as shown in SEQ IDNO.2 as template design primer pair, and primer pair
Respectively upper plus EcoR I, Spe I protection bases, as follows：
Forward primer P3：
5'-CG(GAATTC) TCATGAAGCTCTTCAAAATCC-3',
Reverse primer P4：5'-GG(ACTAGT)GGGGCAAAAGACAACCTT-3'；
4) performing PCR is entered by template of lichee class thaumatin T LcTLP genes, PCR amplification conditions are as follows：
94 DEG C of denaturations 4min；94 DEG C of denaturation 30s；61 DEG C of annealing 30s；72 DEG C of extension 2min, after circulating 35 times；72 DEG C are prolonged
Stretch 8min；Obtain PCR primer 2；
5) digestion is carried out to PCR primer 1 with Pst I, EcoR I, purifying recovery is recycled product 1, with EcoR I, Spe
I carries out digestion to PCR primer 2, and purifying recovery is recycled product 2, meanwhile, with Pst I, Spe I by pCAMBIA1304 carriers
Double digestion is carried out, CaMV35S promoters are removed, digestion products run agarose gel electrophoresis and detect and reclaim large fragment；
6) in 10 μ L systems, the pCAMBIA1304 carrier large fragments of recovery, recovery product 1 and recovery product 2 are used into T4
4 DEG C of connections of ligase overnight, use by connection product conversion bacillus coli DH 5 alpha competent cell, the positive colony that screening is obtained
Pst I, Spe I carry out digestion verification, obtain expressing plant recombination expression vector pCAMBIA1304-GRX- of Gus genes
TLP。
7) picking positive colony single bacterium colony is used to shake bacterium, extracts plasmid, and Jing after PCR detections and digestion identification Beijing Hua Da is sent
Technique for gene engineering Services Co., Ltd is sequenced.Sequencing result confirms the insertion sequence of different fragments, and insertion LcGRX genes are opened
Mover is consistent with the sequence shown in SEQ IDNO.1, and the plant expression vector of structure is pCAMBIA1304-GRX-TLP, and carrier is such as
Shown in accompanying drawing 2.
The via Particle Bombardment Transformation of embodiment 4 verifies promoter function with gus gene transient expression
The ripe functional leaf and just open flower of bearing basal shoot middle part no disease and pests harm are won, experiment is transported in 3h back
Room, sterile water wash is clean, blots excessive moisture.Pluck in medium well " cv. Feizixiao " fruit and 3h and transport laboratory back, select nothing
The healthy fruit of pest and disease damage, 0.1%HgCl2After sterilization 1min, aqua sterilisa is rinsed for several times, after drying, strips pericarp, seed and fruit
Meat." cv. Feizixiao " mature seed cultivates healthy seedling in nursery plug, after 3 months, take the elongation zone of root tissue, meristematic zone with
And root cap, aseptic water washing is clean, blots excessive moisture.Above material is immediately available for via Particle Bombardment Transformation experiment.
It is prepared by micro- missile-borne body
1. 10mg tungsten powders are weighed, in being placed in the sterile centrifugation tube of 2.0ml.
2. the ethanol of 1ml 70% is added in pipe, being fully vortexed mixes 3min, is then stored at room temperature 15min, 3000rpm
Centrifugation 5min.
3. supernatant is abandoned, 1ml sterilized waters are added, is fully vortexed 3min, be stored at room temperature 15min, 3000rpm centrifugation 5min；
With sterilized water repeated washing three times.
4. supernatant is abandoned, 50% glycerine (autoclaving) is added, the final concentration of 60mg/ml of tungsten powder is made.
5. the tungsten powder of above-mentioned preparation is fully vortexed after mixing and takes 50 μ L and proceed in another aseptic 1.5mL centrifuge tubes.
6. 5 μ l plasmids (1mg/ml), CaCl2 (2.5M, the autoclaving) solution of 50 μ l and 20 μ L spermidines are sequentially added
(0.1M, filtration sterilization is now with the current).
7. mixture is fully vortexed 8min, is stored at room temperature 15min, 12000rpm centrifugation 5min.
8. supernatant is abandoned, the 70% of 150 μ l ethanol is added, is vortexed and is mixed 1min, 12000rpm centrifugation 1min.
9. supernatant is abandoned, the absolute ethyl alcohol of 150 μ l is added, is vortexed and is mixed 1min, 12000rpm centrifugation 1min.
10. supernatant is abandoned, adds the absolute ethyl alcohol of 50 μ l, resuspended particle then centrifuge tube to be immersed in ultrasonic cleaner
10sec, discrete particles, each shell hole loading 10 μ l, each loading can bombard 2-3 time.
Transformation receptor material
1. dry after superclean bench sterilizing.
2. clean particle gun with 75% ethanol to carry out disinfection, it is that in advance autoclaving prepares to stop net and can break disk
It is good.
3. high pressure helium gas cylinder and particle gun (model are connected：SJ-500), disk can be split with sterilizing tweezers gripping and stops net,
And screw and install.
4. micro- bullet that 10 μ l make is taken every time, in being spread evenly across each shell hole.
5. the cartridge clip for installing micro- bullet is fitted in particle gun.
6. helium pressure is transferred to 3.5MPa, by particle gun operation instruction trigger bombardment receptor material is pressed.
7. bombarded every time, change cartridge clip, replacing can row disk and stop net, repeat 4～6 steps, then bombardment conversion
Acceptor material.
8. respectively with pCAMBIA1304 plasmids as positive control, tungsten powder is negative control, pCAMBIA1304-GRX-TLP
Plasmid bombards above-mentioned lichee different tissues material.The lichee experiment material bombarded is placed in 28 DEG C of 24～36h of light culture.
GUS histochemical stains
1. by the acceptor material after conversion culture, sample surfaces water is blotted with filter paper with sterile water wash sample for several times；
2. lichee pericarp is stripped out, and is cut into the pericarp of biolistic bombardment, seed and blade little with aseptic operation knife
Block；
3. the sample for cutting is gone in the sterile centrifugation tube of 10mL, the fixer (component of 5mL is often added in pipe：1%
(concentration expressed in percentage by volume) formaldehyde, 0.05M sodium phosphate buffers, 0.05% (mass percentage concentration) Triton-100), it is put into shaking table
Upper 200rpm gently shakes 30min；
4. fixer is removed, with 0.05M sodium phosphate buffers washing sample three times, is often gently shaken inferior to 200rpm
10min；Remove used buffer solution；
5. the GUS dyeing liquors (formula of the existing preparation of 600 μ L is often added in pipe：50mM sodium phosphate buffer pH7.0,0.1M
The potassium ferricyanide, 0.1M potassium ferrocyanides, 10mM EDTA, 0.1%Triton-100,20% formaldehyde, 0.5mMX-gluc) submergence turn
Change material, in 37 DEG C of water bath heat preservation 1h；
6. material is taken out, with 75% ethanol rinse 20min；
7. successively 20min is respectively soaked with 20% ethanol, 50% ethanol；
8. examine under a microscope the coloration result of the GUS of converting material and take pictures.
Analysis coloration result find, pCAMBIA1304 plasmids (positive control) in a organized way in occur in that blue spot
Point, shows that CaMV35S promoters can regulate and control the expression of the gus gene in pCAMBIA1304 plasmids.Tungsten powder (negative control) bombardment exists
Do not occur blue spot in all material, show that tungsten powder bombardment is not result in that blue spot occurs in lichee tissue, tie experiment
There is false positive in fruit.The plant expression vector pCAMBIA1304-GRX-TLP of structure is expressed strongly in blade, at the same root,
There is faint expression in flower, pericarp and seed, but the plant expression vector for building is illustrated without occurring in pulp
PCAMBIA1304-GRX-TLP can regulate and control gus gene specificity overexpression in the blade of lichee, but can not regulate and control it in pulp
Middle expression.
Other unspecified parts are prior art.Although above-described embodiment is made that to the present invention retouching in detail
State, but it is only a part of embodiment of the invention, rather than whole embodiments, people can with according to the present embodiment without
Other embodiment is obtained under the premise of creativeness, these embodiments belong to the scope of the present invention.
<110>Research Institute of Environment and Plant Protection, Chinese Academy of Tropi
<120>Litchi Leaves specific expression gene LcGRX promoters and its application
<211> 1996bp
<212> DNA
<213>Litchi Leaves specific expression gene LcGRX promoters
<400>
GTGCCCCATGACTTATTTTATGCTTTAGAAATTTATTTTATACATGCAGTTATTGAGATGTGATCTATTGACT
TGATAATGACTACTAATATGAAATAATAACTTTTTTTCCAACGTGGCAACAAAATGCTAGGAAGATTTTTTATAAAA
TCAGAAAAAAGGGCTATTTTAAAAACTTTTTCCTAAACGGTAAACATGAAAGGAGTTACAATATTATTAAAGGGTCG
TTTATTTTTTCCACTTAAAATTTAATTGTATCAAATTATATCTATTAAGTTATTTTTGTTTGTATTTTTAAGTGATC
AAACCACTTAAAACTATCAAAGAACAATTGAAAAAAATAAGTAAGAATTTTTAATATTTACTTTTTTTCTCCTGATA
CTTACAAAAAATATATTTGAAAAGTAAAAAATGAATGTTTAAATTGTAAATTATAATATATTAGTTTAATTTTAAGA
TAGCTTTTCACTTAATTGTAAATCATTTAATGATATTTAAAAGTTTTTATTTCAAATCTATCCTCCCAAAAATAACA
TAATTTTAAAGTTATCCTAATTTTACATTACTCAAATTTTCTTTTTTTTTTTCCCCTTGATACTTACAAAAAATATA
TTTACAAAGTAAAATCTAAATACATCGCATCTCAAATTATCTTAGAATTAAACTAATATATTTTAATTTATAATTTG
AATATTCATTTTTAATTGTTTTCTTAAATATATTTAAATATATAAATATGGTTAATATTACTATATTTTTTAATCGT
ATTTTAACTATAGATAAAAAATTATTAATATGTACATAAAAAATGTTTTAGATTTTATTAAATTATTTATTTTCAGA
TGTTTGTAGTAAATTAATTAAAATTATATAACAGCAAATAAAAAATATATATAAATGTCAACTTATTAGTTTTCAGA
CAATTTTAAATTTAAAAAACAAACAAGTTTACAATATAATCAGAGGTAAAGAAAAAAAAATATTATTCGGATTTCAA
ATTTCAGTCATCATTCAGTCTTCAGTAGCACTGTTCAGTCTTCAGACAAAAAAAATAAACAACCTCTTGGACTATCA
ATATTTAGGGTGCAAATAATCCACACTATATTGTTATAAACAATGTGAGATGGTTTGTCACACAGTTTATTCAAACA
AAATAATAAATGAATTGTCTACACTCAAAACAAATTAATATTACATTAAGACTTTAAACATATATAAATACCTTAAA
AGGACAACAATTCTTCTAATACCATGCAAATCTCTCCCTCTCTTTTTTCTTTAAAATGTACCACAAATTTGAAATAT
CAAGTTACTCTTGTTATGGTATATATACATAATTTTCTTATTTTTAGTCCCGGTTATCAATGGGTAAAGAAAATTCT
GGAAAATTTCAAGTTGAATATGTGCATATACTATAAAGAAATAGAATTATAGAACTGATTTAAGCTTTGATTGAACA
GTATTATTTAGTATGCTTACTATTATTATAGGCGGTTGCTCTTTGCTCTGAATTTTTCTAATGGCAATGACAACGCT
AATGTCGTACAGATCTCAGCGATCAAGGACGAATATGCTGAATTGAGATGGACGTTGCCAATTATATCATAAGCACT
CTAGATAATATCATATTTGTTGGGCATCATCTACATAGTATCACTTCAACACATTATTTTAGTCACATTTTTCTTGT
CTATAGACTATTTAGCTTGATATTGCAAGTTACCATCAAGGGTAGTCTGGGAATCAAAGAAAACATCCTCTTTGGAA
CATTTTATTCCCTTCCTGTACTGATTCCATCTGGAAACAAATTAGATATGAAATCCCAATCCCACCACCATAATAAA
AAAATTCTTGTTATAAATAGACCTCCATGGTTGTTCAAGTCTCCTCACAGCAAAACTTCATCAACTCTCTCAATAAC
AAGCTTAGTAACATTCAAGACTCCCATTTTTATTTGATTTGCGGCCATGGACACAATAGCAAGGTTGGTGAAAGA
<210> 2
<211> 671bp
<212> DNA
<213>Lichee class thaumatin T LcTLP genes
<400> 2
TCATGAAGCTCTTCAAAATCCTCCTTTCCTTTTTTGCCATTGCACTCTCCACCACCTTGGTTTATGCAGCCAA
ATTTGACATCACCAACAACTGTCCTGAGACTATTTGGGCAGCTGCCGTGCCTGGTGGTGGCAAGAAACTAGACAAAG
GCGAAACATGGACCATAACTGCCGCCCCAGGTACCAAAGAAGCCAGAATTTGGGGACGTACCAAGTGCAATTTCGAT
GCCAGCGGGAAAGGCAAGTGTGAGACAGGTGACTGCAACGGCGTCCTCGAGTGCCAAGGCTATGGATCCCCTCCCAA
TACCTTGGCTGAGTACGCGTTGCAGCAGTTCAACAACATGGACTTCATTGACATGTCCAACATTGATGGTTTTAATG
TCCCAATGGAGTTCAGCTCCACCTCTCCTGGATGCAACCGTGTGATCAAATGCACGGGTGACTTGGTAGGGCAGTGC
CCTAATGAGCTCAAAGTACCAGGAGGATGTCAAGGGCCATGCTGGGTGTTCAAGACCAACGAGCACTGTTGCAATTC
TGGTAGTTGTGGACCTACAGATTTCTCCAGGTTTTTCAAAGATAGGTGCCCGGATGTTTATAGTTATCCAAAAGATG
ATGCAACAAGTGTTTTTACTTGCCCTAGTGGAACAGACTATAAGGTTGTCTTTTGC
Claims (10)
1. a kind of Litchi Leaves specific expression gene LcGRX promoters, it is characterised in that：It is characterized in that；Its nucleotide sequence
As shown in SEQ IDNO.1.
2. it is used to obtain the primer pair of Litchi Leaves specific expression gene LcGRX promoters described in claim 1, its feature exists
In；The primer pair is：
Forward primer P1：5'-GTGCCCCATGACTTATTTTAT-3'；
Reverse primer P2：5'-TCTTTCACCAACCTTGCTATT-3'.
3. a kind of preparation method of Litchi Leaves specific expression gene LcGRX promoters described in claim 1 or 2, its feature exists
In：With the lichee genomic DNA with Litchi Leaves specific expression gene LcGRX as template, using following primer pair：
Forward primer P1：5'-GTGCCCCATGACTTATTTTAT-3'；
Reverse primer P2：5'-TCTTTCACCAACCTTGCTATT-3'.
Enter performing PCR amplification, the Litchi Leaves specific expression gene LcGRX promoter sequences that it is obtained are SEQ IDNO.1 institutes
Show.
4. according to claim 3 Litchi Leaves specific expression gene LcGRX promoters preparation method, it is characterised in that：
The PCR reaction systems：
The PCR reaction conditions：94 DEG C of denaturations 4min；94 DEG C of denaturation 30s；61 DEG C of annealing 30s；72 DEG C of extension 2min, circulation
After 35 times；72 DEG C of extension 8min.
5. a kind of recombinant expression carrier, it is characterised in that：It contains Litchi Leaves specific expression gene described in claim 1
The plant expression vector of LcGRX promoters.
6. recombinant expression carrier according to claim 5, the plant expression vector is pCAMBIA1304.
7. the construction method of recombinant expression carrier described in a kind of claim 4 or 5, it is characterised in that：Comprise the following steps：
1) template design primer pair is shown with Litchi Leaves specific expression gene LcGRX promoter sequence such as SEQ IDNO.1,
It is as follows and primer pair is respectively plus PstI, EcoRI restriction enzyme site and protection base：
LcGRX-F：AACTGCAGGTGCCCCATGACTTATTTTAT,
PstI；
LcGRX-R：CGGAATTCTCTTTCACCAACCTTGCTATT；
EcoRI
Enter performing PCR by template of Litchi Leaves specific expression gene LcGRX promoter sequences, PCR amplification conditions are as follows：
Reaction system：
Response procedures are：94 DEG C of denaturations 4min；94 DEG C of denaturation 30s；61 DEG C of annealing 30s；72 DEG C of extension 2min, circulate 35 times
Afterwards；72 DEG C of extension 8min；Obtain PCR primer 1；
3) with lichee class thaumatin T LcTLP genes as template design primer pair, and primer pair upper plus EcoRI, SpeI protection respectively
Base is as follows：
Forward primer P3：5'-CGGAATTCTCATGAAGCTCTTCAAAATCC-3',
Reverse primer P4：5'-GGACTAGTGGGGCAAAAGACAACCTT-3'；
4) performing PCR is entered by template of lichee class thaumatin T LcTLP genes, PCR amplification conditions are as follows：
94 DEG C of denaturations 4min；94 DEG C of denaturation 30s；61 DEG C of annealing 30s；72 DEG C of extension 2min, after circulating 35 times；72 DEG C of extensions
8min；Obtain PCR primer 2；
5) digestion is carried out to PCR primer 1 with PstI, EcoRI, purifying recovery is recycled product 1, with EcoRI, SpeI to PCR
Product 1 carries out digestion, and purifying recovery is recycled product 2, meanwhile, pCAMBIA1304 carriers are carried out into double enzymes with PstI, SpeI
Cut, remove CaMV35S promoters, digestion products run agarose gel electrophoresis and detect and reclaim large fragment；
6) in 10 μ L systems, the pCAMBIA1304 carrier large fragments of recovery, recovery product 1 and recovery product 2 are connected with T4
4 DEG C of enzyme connects overnight, connection product conversion bacillus coli DH 5 alpha competent cell, the positive colony PstI that screening is obtained,
SpeI carries out digestion verification, obtains expressing plant recombination expression vector pCAMBIA1304-GRX-TLP of Gus genes.
8. application of one of the following items in destination gene expression and culture cultivation new variety of plant is started, it is characterised in that：
(1) promoter described in claim 1；
(2) recombinant expression carrier described in claim 5 or 6.
9. application according to claim 8, it is characterised in that：The plant is dicotyledon.
10. application according to claim 8, it is characterised in that：The plant is lichee, tomato or arabidopsis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611039268.1A CN106636091A (en) | 2016-11-21 | 2016-11-21 | Litchi leaf specific expression gene LcGRX promoter and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611039268.1A CN106636091A (en) | 2016-11-21 | 2016-11-21 | Litchi leaf specific expression gene LcGRX promoter and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106636091A true CN106636091A (en) | 2017-05-10 |
Family
ID=58811194
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611039268.1A Pending CN106636091A (en) | 2016-11-21 | 2016-11-21 | Litchi leaf specific expression gene LcGRX promoter and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636091A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109234284A (en) * | 2018-09-14 | 2019-01-18 | 昆明理工大学 | A kind of Radix Notoginseng class sweet protein gene PnTLP5 and application |
| CN110184268A (en) * | 2019-05-31 | 2019-08-30 | 中国热带农业科学院橡胶研究所 | A kind of rubber tree U6 gene promoter proHbU6.2 and its clone and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105755000A (en) * | 2016-03-20 | 2016-07-13 | 中国热带农业科学院环境与植物保护研究所 | Functional identification and application of lychee leaf characteristic expressed gene LcFKBP16-2 promoter |
-
2016
- 2016-11-21 CN CN201611039268.1A patent/CN106636091A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105755000A (en) * | 2016-03-20 | 2016-07-13 | 中国热带农业科学院环境与植物保护研究所 | Functional identification and application of lychee leaf characteristic expressed gene LcFKBP16-2 promoter |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109234284A (en) * | 2018-09-14 | 2019-01-18 | 昆明理工大学 | A kind of Radix Notoginseng class sweet protein gene PnTLP5 and application |
| CN109234284B (en) * | 2018-09-14 | 2021-04-09 | 昆明理工大学 | Pseudo-ginseng sweet protein gene PnTLP5 and application |
| CN110184268A (en) * | 2019-05-31 | 2019-08-30 | 中国热带农业科学院橡胶研究所 | A kind of rubber tree U6 gene promoter proHbU6.2 and its clone and application |
| CN110184268B (en) * | 2019-05-31 | 2020-08-04 | 中国热带农业科学院橡胶研究所 | Rubber tree U6 gene promoter proHbU6.2 and cloning and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Scafaro et al. | A thermotolerant variant of Rubisco activase from a wild relative improves growth and seed yield in rice under heat stress | |
| Sade et al. | The role of plasma membrane aquaporins in regulating the bundle sheath-mesophyll continuum and leaf hydraulics | |
| BRPI0706526A2 (en) | nucleotide sequences and corresponding polypeptides that confer improved nitrogen efficiency in plants | |
| BR112013010278B1 (en) | method to produce a plant, method to modulate the biomass composition in a plant, isolated nucleic acid and method to alter the biomass composition in a plant | |
| WO2020097026A1 (en) | High throughput protoplast isolation and transformation of plant cells from a novel leaf-based cell culture-derived system | |
| CN110408650A (en) | Application of the protein of NOR-like1 gene and its coding in regulation tamato fruit yield | |
| CN103695439B (en) | Gold mandarin orange FcWRKY70 gene and the application in raising drought tolerance in plants thereof | |
| CN102675441B (en) | Application of OsMADS57 protein or coding gene thereof to inhibiting tillering of rice | |
| CN110713529A (en) | Application of VvDUF642 gene in causing abortion of plant seeds | |
| CN115161339A (en) | Method for enhancing heat resistance of tomato by high-temperature induction of SlWRKY3 gene | |
| CN102690341A (en) | Plant tillering related protein and coding gene thereof | |
| CN106636091A (en) | Litchi leaf specific expression gene LcGRX promoter and application thereof | |
| CN105039353A (en) | Gene CaMS1 related to chili pollen development and application thereof | |
| CN102703465A (en) | Salt-tolerant drought-tolerant wheat gene TaWRKY79 and application thereof | |
| CN104313035A (en) | Eggplant root-knot nematode related gene and application thereof | |
| CN109468333A (en) | Citrus laccase family gene CsiLAC4 and its application | |
| CN104945492B (en) | Plant stress tolerance correlative protein TaAREB3 and its encoding gene and application | |
| CN104818258A (en) | Gossypium hirsutum glycosyltransferase GhUGT85O1, coding gene and applications thereof | |
| CN109517827B (en) | Drought-resistant and salt-resistant gene of brachypodium distachyon and encoding protein and application thereof | |
| CN114853860B (en) | Protein related to shortening larch breeding cycle and application thereof | |
| CN103725692A (en) | Zinc finger protein gene used for controlling rice fertility | |
| CN103789314B (en) | Swede type rape P17673 promotor and preparation method and application | |
| CN110408648A (en) | A kind of method of quick detection plant disease resistance genes | |
| CN103348009A (en) | Method for preparing fertility-lowered plant | |
| CN105755000B (en) | A kind of Function Identification of Litchi Leaves characteristic expressing gene LcFKBP16-2 promoters and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170510 |
|
| RJ01 | Rejection of invention patent application after publication |