CN110408650A - Application of the protein of NOR-like1 gene and its coding in regulation tamato fruit yield - Google Patents
Application of the protein of NOR-like1 gene and its coding in regulation tamato fruit yield Download PDFInfo
- Publication number
- CN110408650A CN110408650A CN201910675952.6A CN201910675952A CN110408650A CN 110408650 A CN110408650 A CN 110408650A CN 201910675952 A CN201910675952 A CN 201910675952A CN 110408650 A CN110408650 A CN 110408650A
- Authority
- CN
- China
- Prior art keywords
- plant
- like1
- sequence
- protein
- fruit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Physiology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses application of the protein of NOR-like1 gene and its coding in regulation tamato fruit yield.The protein of NOR-like1 gene coding disclosed by the invention is the protein that amino acid sequence is sequence 3.The present invention has been mutated the NOR-like1 gene in plant using CRISPR/Cas9 method, NOR-like1 gene mutation body is obtained, what the fruit size and weight of the mutant obtained significantly improve, and (fruit diameter improves about 15.7%, 36.2%) weight improves about, show, the protein of NOR-like1 gene and its coding can regulate and control the size of fruit, can be used for plant breeding, improve plant fruit yield.
Description
Technical field
The present invention relates in field of biotechnology, the protein of NOR-like1 gene and its coding is in regulation tamato fruit
Application in yield.
Background technique
Important organ of multiplication of the fruit as plant, is the carrier of seed development and propagation.Meanwhile fruit is because containing carbon water
The nutritional ingredient abundant such as compound, vitamin, microelement, dietary fiber and human and animal's indispensable food
Source.Therefore, it improves fruit yield and has great importance to the research for adopting rear dehydration.
Summary of the invention
The technical problem to be solved by the present invention is to how improve plant fruit yield.
In order to solve the above technical problems, present invention firstly provides the substances or tune of regulation NOR-like1 protein active
Control plant NOR-like1 protein content substance in D1)-D6) and it is any in application:
D1) regulate and control plant fruit yield；
D2) promote growing of plant fruit；
D3 it) cultivates fruit yield and increases plant；
D4) preparation regulation plant fruit yield product；
D5) preparation promotes growing of plant fruit product；
D6) fruit yield increase plant product is cultivated in preparation.
In above-mentioned application, the NOR-like1 protein is following A1), A2) or A3):
A1) amino acid sequence is the protein of sequence 3；
A2) by amino acid sequence shown in sequence 3 in sequence table by one or several amino acid residues substitution and/or
Deletion and/or addition and protein with the same function；
A3) in A1) or the obtained fused protein of N-terminal A2) or/and C-terminal connection label；
The substance of the regulation plant NOR-like1 protein content is NOR-like1 protein or its associated biomolecule material
Material；The biomaterial is any one of following B1) to B9):
B1 the nucleic acid molecules of the NOR-like1 protein) are encoded；
B2) contain B1) expression cassettes of the nucleic acid molecules；
B3) contain B1) recombinant vectors of the nucleic acid molecules or contain B2) recombinant vector of the expression cassette；
B4) contain B1) recombinant microorganisms of the nucleic acid molecules or contain B2) recombinant microorganism of the expression cassette or
Contain B3) recombinant microorganism of the recombinant vector；
B5) contain B1) the transgenic plant cells systems of the nucleic acid molecules or contain B2) transgenosis of the expression cassette
Plant cell；
B6) contain B1) Transgenic plant tissues of the nucleic acid molecules or contain B2) transgenosis of the expression cassette plants
Object tissue；
B7) contain B1) the genetically modified plants organs of the nucleic acid molecules or contain B2) transgenosis of the expression cassette plants
Sundries official；
B8) inhibit the nucleic acid molecules of NOR-like1 protein coding gene expression；
B9) contain B8) expression cassette, recombinant vector, recombinant microorganism or the transgenic plant cells system of the nucleic acid molecules.
Above-mentioned A2) in NOR-like1 protein, for the amino acid sequence of protein shown in sequence 3 have 75% or
75% or more identity and protein with the same function.It is described have 75% or 75% or more identity be with 75%,
With 80%, with 85%, with 90%, with 95%, with 96%, with 97%, with 98% or with 99% it is same
One property.
Above-mentioned A2) in NOR-like1 protein can be artificial synthesized, can also first synthesize its encoding gene, then carry out biology
Expression obtains.
Above-mentioned A2) in the encoding gene of NOR-like1 protein can be by will be lacked in DNA sequence dna shown in sequence 2
The codon of one or several amino acid residues, and/or carry out the missense mutation of one or several base-pairs, and/or its 5 '
The coded sequence that end and/or 3 ' ends connect common protein tag obtains.Wherein, 3 institute of DNA molecular coded sequence shown in sequence 2
The NOR-like1 protein shown.
In above-mentioned application, B1) nucleic acid molecules can be following b1)-b5) any one of:
B1) coded sequence is the cDNA molecule or DNA molecular of sequence 2 in sequence table；
B2) cDNA molecule or DNA molecular shown in sequence 2 in sequence table；
B3) cDNA molecule or DNA molecular shown in sequence 1 in sequence table；
B4) and b1) or b2) or the nucleotide sequence that b3) limits there is 75% or 75% or more identity, and described in encoding
The cDNA molecule or DNA molecular of NOR-like1 protein；
B5) under strict conditions with b1) or b2) or b3) or the nucleotide sequence hybridization that b4) limits, and described in encoding
The cDNA molecule or DNA molecular of NOR-like1 protein.
Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules can also
To be RNA, such as mRNA or hnRNA.
Those of ordinary skill in the art can easily adopt by known method, such as the side of directed evolution and point mutation
Method is mutated the nucleotide sequence of coding NOR-like1 protein of the invention.Those have by manually modified
The nucleotide sequence 75% of isolated NOR-like1 protein or the nucleotide of higher identity with the present invention, as long as
Encode NOR-like1 protein and there is NOR-like1 protein function, be derived from nucleotide sequence of the invention and
It is equal to sequence of the invention.
Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair
Amino acid sequence shown in bright coded sequence 3 composition protein nucleotide sequence have 75% or higher or 85% or
Higher or 90% or higher or 95% or higher identity nucleotide sequence.Identity can with the naked eye or computer software
It is evaluated.Using computer software, identity between two or more sequences can be indicated with percentage (%), can be with
For evaluating the identity between correlated series.
In above-mentioned application, the stringent condition can be as follows: 50 DEG C, in 7% lauryl sodium sulfate (SDS), 0.5M
NaPO4Hybridize in the mixed solution of 1mM EDTA, is rinsed in 50 DEG C, 2 × SSC, 0.1%SDS；May be used also are as follows: 50 DEG C, In
7%SDS, 0.5M NaPO4Hybridize in the mixed solution of 1mM EDTA, is rinsed in 50 DEG C, 1 × SSC, 0.1%SDS；May be used also
Are as follows: 50 DEG C, in 7%SDS, 0.5M NaPO4Hybridize in the mixed solution of 1mM EDTA, at 50 DEG C, 0.5 × SSC, 0.1%
It is rinsed in SDS；May be used also are as follows: 50 DEG C, in 7%SDS, 0.5M NaPO4Hybridize in the mixed solution of 1mM EDTA, at 50 DEG C,
It is rinsed in 0.1 × SSC, 0.1%SDS；May be used also are as follows: 50 DEG C, in 7%SDS, 0.5M NaPO4In the mixed solution of 1mM EDTA
Hybridization, rinses in 65 DEG C, 0.1 × SSC, 0.1%SDS；It can also are as follows: in 6 × SSC, the solution of 0.5%SDS, at 65 DEG C
Hybridization, then with 2 × SSC, 0.1%SDS and 1 × SSC, it is primary that 0.1%SDS respectively washes film；It can also are as follows: 2 × SSC, 0.1%SDS
Solution in, hybridize at 68 DEG C and wash film 2 times, each 5min, and in 0.5 × SSC, the solution of 0.1%SDS, at 68 DEG C
Lower hybridization simultaneously washes film 2 times, each 15min；Can also are as follows: 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS solution in, 65 DEG C
Under the conditions of hybridize and wash film.
Above-mentioned 75% or 75% or more identity can be 80%, 85%, 90% or 95% or more identity.
In above-mentioned application, B2) described in the nucleic acid molecules containing coding NOR-like1 protein expression cassette (NOR-
Like1 expression casette), it is the DNA for referring to express NOR-like1 protein in host cell, which not only may include
The promoter for starting NOR-like1 genetic transcription may also include the terminator for terminating NOR-like1 genetic transcription.Further, institute
Stating expression cassette may also include enhancer sequence.Promoter for use in the present invention includes but is not limited to: constitutive promoter, group
It knits, the promoter and inducible promoter that organ and development are special.The example of promoter includes but is not limited to: Cauliflower Mosaic
The constitutive promoter 35S of virus；Wound-inducible promoter from tomato, leucine aminopeptidase (" LAP ", Chao
Et al. (1999) Plant Physiol 120:979-992)；Chemical inducible promoter from tobacco, pathogenesis correlation 1
(PR1) it (is induced by salicylic acid and BTH (diazosulfide -7- carbothioic acid S-methyl ester))；Tomato protease inhibitors II is opened
Mover (PIN2) or LAP promoter (available methyl jasmonate induction)；Heat-shock promoters (United States Patent (USP) 5,187,
267)；Tetracycline inducible promoter (United States Patent (USP) 5,057,422)；Seed specific promoters, such as Millet Seed specificity
Promoter pF128 (CN101063139B (Chinese patent 200710099169.7)), the special promoter of seed storage protein matter
(for example, promoter (Beachy et al. (1985) of phaseolin, napin, oleosin and soybean beta conglycin
EMBO is J.4:3047-3053)).They can be used alone or are used in combination with other plant promoters.Institute cited herein
There is bibliography to be cited in full text.Suitable transcription terminator includes but is not limited to: Agrobacterium nopaline syntase terminator
(NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and kermes ammonia
Sour and octopine synthase terminator (see, e.g.: Odell et al. (I985)Nature 313:810；Rosenberg et al.
(1987)Gene,56:125；Guerineau et al. (1991) Mol.Gen.Genet, 262:141；Proudfoot(1991)
Cell,64:671；Sanfacon et al. Genes Dev., 5:141；Mogen et al. (1990) Plant Cell, 2:1261；
Munroe et al. (1990) Gene, 91:151；Ballad et al. (1989) Nucleic Acids Res.17:7891；Joshi etc.
People (1987) Nucleic Acid Res., 15:9627).
The recombinant vector of the NOR-like1 expression casette can be contained with existing expression vector establishment.The plant
Expression vector includes double base agrobacterium vector and the carrier etc. that can be used for plant micropellet bombardment.As pAHC25, pBin438,
pCAMBIA1302、pCAMBIA2301、pCAMBIA1301、pCAMBIA1300、pBI121、pCAMBIA1391-Xa、PSN1301
Or pCAMBIA1391-Xb (CAMBIA company) etc..The plant expression vector also may include 3 ' end non-translational regions of foreign gene
Domain, i.e., comprising polyadenylation signals and any other DNA fragmentation for participating in mRNA processing or gene expression.The polyadenylic acid letter
Number bootable polyadenylic acid is added to 3 ' ends of mRNA precursor, as Agrobacterium crown gall nodule induces (Ti) plasmid gene (such as nopaline
Synthase gene Nos), plant gene (such as soybean storage protein genes) 3 ' end transcription non-translational region all have similar functions.
When using gene constructed plant expression vector of the invention, enhancer, including translational enhancer or transcriptional enhancer also can be used,
These enhancer regions can be ATG initiation codon or neighboring region initiation codon etc., but must read with coded sequence
Frame is identical, to guarantee the correct translation of entire sequence.The source of the translation control signal and initiation codon be it is extensive,
Can be it is natural, be also possible to synthesis.Translation initiation region can come from transcription initiation region or structural gene.In order to just
In transgenic plant cells or plant are identified and screened, plant expression vector used can be processed, it can as being added
The coding expressed in plant can produce the enzyme of color change or gene (gus gene, luciferase genes of luminophor
Deng), the marker gene of antibiotic (if assigned the nptII gene to kanamycins and associated antibiotic resistance, assigns to herbicide
The bar gene of phosphinothricin resistance assigns the hph gene to antibiotic hygromycin resistance, and assigns to methotrexate resistance
Dhfr gene is assigned to the EPSPS gene of glyphosate) or (such as anti-herbicide base such as anti-chemical reagent marker gene
Cause), provide metabolism mannose ability mannose-6-phosphate isomerase gene.It, can not from the security consideration of genetically modified plants
Add any selected marker, transformed plant is directly screened with adverse circumstance.
In above-mentioned application, the carrier can be plasmid, sticking grain, bacteriophage or viral vectors.
B9) recombinant vector can be the weight that can reduce NOR-like1 content prepared using CRISPR/Cas9 method
Group carrier.The recombinant vector can express targeting B1) sgRNA of the nucleic acid molecules.The target sequence of the sgRNA can for T1,
T2, T3 and/or T4, the T1 are 1262-1281 of sequence 1, and the T2 is the reversed of 1224-1205 of sequence 1
Complementary series, the T3 are 1327-1346 of sequence 1, and the T4 is 285-266 reverse complemental sequences of sequence 1
Column.
The recombinant vector concretely pYLCRISPR/Cas9-NOR-like1 gene editing carrier.It is described
PYLCRISPR/Cas9-NOR-like1 gene editing carrier is using BsaI in pYLCRISPR/Cas9-Pubi-H
Multiple cloning sites between be sequentially inserted into LacZ-AtU3d-T1-gRNA, AtU3b-T2-gRNA, AtU6-1-T3-gRNA and AtU6-
The recombinant vector that 29-T4-gRNA is obtained.
In above-mentioned application, the microorganism can be yeast, bacterium, algae or fungi.Wherein, bacterium can be Agrobacterium, such as agriculture
Bacillus GV3101.
In above-mentioned application, the transgenic plant cells system, Transgenic plant tissue and genetically modified plants organ are not wrapped
Include propagation material.
In above-mentioned application, the plant can be M1) or M2) or M3):
M1) dicotyledon or monocotyledon；
M2) plant of Solanaceae；
M3) tomato.
The present invention also provides the methods of following M1 or M2:
M1, the method for improving plant fruit yield, comprising: reduce the activity of NOR-like1 protein in recipient plant, drop
The content of NOR-like1 protein in low recipient plant, the table for inhibiting the encoding gene of NOR-like1 protein in recipient plant
The encoding gene for reaching or knocking out NOR-like1 protein in recipient plant, obtain compared with the recipient plant fruit size and/
Or the increased purpose plant of weight, realize the raising of fruit yield；
M2, the method that fruit yield increases plant is cultivated, comprising: reduce the work of NOR-like1 protein in recipient plant
Property, reduce recipient plant in NOR-like1 protein content, inhibit recipient plant in NOR-like1 protein coding base
The expression of cause or the encoding gene for knocking out NOR-like1 protein in recipient plant, obtain the fruit compared with the recipient plant
Size and/or the increased purpose plant of weight, the purpose plant are that fruit yield increases plant.
In the above method, the encoding gene for knocking out NOR-like1 protein in recipient plant can utilize CRISPR/
Cas9 method is realized.
The target sequence of sgRNA can be T1, T2, T3 and/or T4 in the CRISPR/Cas9 method, and the T1 is sequence 1
1262-1281, the T2 is 1224-1205 reverse complementary sequences of sequence 1, and the T3 is the of sequence 1
1327-1346, the T4 is 285-266 reverse complementary sequences of sequence 1.
In one embodiment of the invention, the recipient plant is nor-like1#1 or nor-like1#11.
Compared with wild-type plant, at the T4 sequence of the NOR-like1 gene of two chromosomes of the nor-like1#1
The middle insertion that 1 nucleotide occurs, i.e., insert a nucleotide T between 268-269 nucleotide of sequence 1.With wild type
Plant is compared, and has lacked 11 nucleosides at the T2 sequence of the NOR-like1 gene of two chromosomes of the nor-like1#11
Acid has lacked 1200-1210 nucleotide of sequence 1.
The recipient plant can be M1) or M2) or M3):
M1) dicotyledon or monocotyledon；
M2) plant of Solanaceae；
M3) tomato.
The present invention also provides with D1)-D3) in any function product, the product contains the NOR-like1 egg
White matter or the biomaterial:
D1) regulate and control plant fruit yield；
D2) promote growing of plant fruit；
D3 it) cultivates fruit yield and increases plant.
The product can the NOR-like1 protein or the biomaterial as its active constituent, can also be by institute
It states NOR-like1 protein or the biomaterial and substance with the same function is combined together as its active constituent.
In the said goods, the plant can be M1) or M2) or M3):
M1) dicotyledon or monocotyledon；
M2) plant of Solanaceae；
M3) tomato.
In the present invention, the fruit yield be may be embodied in fruit size and/or weight.
The present invention has been mutated the NOR-like1 gene in tomato using CRISPR/Cas9 method, has obtained NOR-like1
Gene mutation body, what the fruit size and weight of the mutant obtained significantly improve, and (fruit diameter improves about 15.7%, weight
Amount improves the size for about 36.2%) showing that the protein of NOR-like1 gene and its coding can regulate and control fruit, can
To be used for plant breeding, plant fruit yield is improved.
Detailed description of the invention
Fig. 1 is four target sequences and its position on NOR-like1 gene.
Fig. 2 is the step of preparing the DNA fragmentation of the sgRNA expression cassette containing target sequence by over-lap PCR.
Fig. 3 is CR-NOR-like1T0It is analyzed for target spot edit mode.A:PCR expands the Ago-Gel electricity of target spot segment
Swimming analysis.B:CR-NOR-like1#1 and CR-NOR-like1#11 gene editing mode is analyzed, CR-NOR-like1#1-T2,
CR-NOR-like1#1-T3 and CR-NOR#1-like1-T4 respectively indicates T2, T3 and T4 upstream and downstream sequence of CR-NOR-like1#1
Column, CR-NOR-like1#11-T1, CR-NOR-like1#11-T2 and CR-NOR-like1#11-T3 respectively indicate CR-NOR#3
T1, T2 and T3 upstream and downstream sequence.In b figure, " × n in bracket*" in n represent and accordingly edited in 12 sequences measuring at random
The number that mode occurs.
Fig. 4 is nor-like1#1 and two strain target spot edit modes of nor-like1#11 are analyzed and protein expression detection.
A:nor-like1#1 and nor-like1#11 gene editing mode is analyzed；It is lacked in b:nor-like1#1 and nor-like1#11
NOR-like1 albumen.#1 and #11 respectively indicate nor-like1#1 and nor-like1#11.
Fig. 5 is the size and fruit weight analysis of two strain fruits of nor-like1#1 and nor-like1#11.A:WT, nor-
Like1#1 and nor-like1#11 fruit size compares figure, and scale represents 2cm.B:WT, nor-like1#1 and nor-like1#
The diameter and single fruit weight of 11 fruits compare figure, and * * indicates p < 0.01.
Fig. 6 is that two strain fruits of nor-like1#1 and nor-like1#11 adopt rear weight-loss ratio analysis.A:WT, nor-
Like1#1 and nor-like1#11 fruit 10 days phenotypic maps of postharvest storage.B:nor-like1#1 and nor-like1#11 mutation
Body fruit adopts rear weight-loss ratio and is apparently higher than WT, and * * represents p < 0.01.
Fig. 7 is two strain fruit Toluidine blue staining result figures of nor-like1#1 and nor-like1#11.
Specific embodiment
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.Experimental method in following embodiments is unless otherwise specified
Conventional method.Material as used in the following examples, reagent, instrument etc., are commercially available unless otherwise specified.
Quantitative test in following embodiment, is respectively provided with three repeated experiments, and results are averaged.In following embodiments, such as without special
Illustrate, the 1st of each nucleotide sequence is the 5 ' terminal nucleotides of corresponding DNA/RNA in sequence table, and last bit is corresponding
3 ' the terminal nucleotides of DNA/RNA.
Wild-type tomatoes kind Solanum lycopersicum cv Ailsa Craig in following embodiments
(Marian Bemer et al.,The Tomato FRUITFULL Homologs TDR4/FUL1and MBP7/
FUL2Regulate Ethylene-Independent Aspects of Fruit Ripening,The Plant Cell,
Vol.24:4437-4451) public can obtain the biomaterial from applicant, and which only attaches most importance to the phase of duplicate invention
It closes used in experiment, not can be used as other purposes and use.
Embodiment 1, the yield of NOR-like1 gene regulation tamato fruit and adopt rear dehydration
The present embodiment is mutated the NOR-like1 gene in tomato, and tamato fruit size increases after finding the gene mutation, and
It is easy to dehydration after adopting, the genome sequence of NOR-like1 gene is classified as sequence 1 in sequence table, and CDS sequence is sequence in sequence table
2, NOR-like1 protein shown in sequence 3 in polynucleotide.Specific step is as follows:
One, the building of recombinant vector
1, target sequence selects: selected target sequence is T1 (1262-1281 of sequence 1), the T2 (1224- of sequence 1
1205 reverse complementary sequences), T3 (1327-1346 of sequence 1) and T4 (285-266 reverse mutuals of sequence 1
Complementary series), it is specifically shown in Fig. 1.
2,4 small nuclear RNA promoters in arabidopsis source are used the selection of promoter:: AtU3d,
AtU3b, AtU6-1, AtU6-29, promoter put in order are as follows: AtU3d, AtU3b, AtU6-1, AtU6-29.
3, the preparation of the DNA fragmentation of the sgRNA expression cassette containing target sequence:
According to the principle of Fig. 2, by two-wheeled PCR, four DNA fragmentations are obtained, respectively LacZ-AtU3d-T1-gRNA,
AtU3b-T2-gRNA, AtU6-1-T3-gRNA and AtU6-29-T4-gRNA include targeting T1 in LacZ-AtU3d-T1-gRNA
SgRNA (sgRNA is denoted as sgRNA1) expression cassette, and the expression of sgRNA1 is driven by AtU3d；AtU3b-T2-gRNA
In the sgRNA (sgRNA is denoted as sgRNA2) comprising targeting T2 expression cassette, and the expression of sgRNA2 is driven by AtU3b；
The expression cassette of sgRNA (sgRNA is denoted as sgRNA3) comprising targeting T3 in AtU6-1-T3-gRNA, and the expression of sgRNA3
It is driven by AtU6-1；The expression cassette of sgRNA (sgRNA is denoted as sgRNA3) comprising targeting T3 in AtU6-29-T4-gRNA,
And the expression of sgRNA3 is driven by AtU6-29.This four DNA fragmentations the preparation method is as follows:
(1) first round PCR
First round PCR reaction system is prepared on ice according to table 1.Wherein, KOD enzyme and 10 × KOD Plus Buffer are
The sequence of TOYOBO Products, each primer is shown in Table 2.
Table 1, first round PCR reaction system
GRT#+ used in first round PCR is gR-NOR-like1T1, U#T#- used when preparing LacZ-AtU3d-T1-gRNA
For U3d-NOR-like1T1, PYLgRNA-AtU# plasmid used is PYLgRNA-AtU3d plasmid；When preparing AtU3b-T2-gRNA
GRT#+ used in first round PCR is gR-NOR-like1T2, and U#T#- used is U3b-NOR-like1T2, PYLgRNA- used
AtU# plasmid is PYLgRNA-AtU3b plasmid；GRT#+ used in first round PCR is gR-NOR- when preparing AtU6-1-T3-gRNA
Like1T3, U#T#- used are U6-1-NOR-like1T3, and PYLgRNA-AtU# plasmid used is PYLgRNA-AtU6-1 plasmid；
GRT#+ used in first round PCR is gR-NOR-like1T4 when preparing AtU6-29-T4-gRNA, and U#T#- used is U6-29-NOR-
Like1T4, PYLgRNA-AtU# plasmid used are PYLgRNA-AtU6-29 plasmid.PYLgRNA-AtU3d plasmid, PYLgRNA-
AtU3b plasmid, PYLgRNA-AtU6-1 plasmid and PYLgRNA-AtU6-29 plasmid be documented in document (Ma X, Zhang Q,
Zhu Q,Liu W,Chen Y,Qiu R,Wang B,Yang Z,Li H,Lin Y,Xie Y,Shen R,Chen S,Wang Z,
Chen Y,Guo J,Chen L,Zhao X,Dong Z,Liu Y G.A Robust CRISPR/Cas9System for
Convenient,High-Efficiency Multiplex Genome Editing in Monocot and Dicot
Plants [J] .Molecular Plant, 2015,8 (8): 1274-1284) in.
Table 2, primer sequence
| U-F | CTCCGTTTTACCTGTGGAATCG |
| gR-R | CGGAGGAAAATTCCATCCAC |
| U3d-NOR-like1T1 | GCGGTGAGCACCGGCTTGTCTGACCAATGGTGCTTTG |
| gR-NOR-like1T1 | GACAAGCCGGTGCTCACCGCGTTTTAGAGCTAGAAAT |
| U3b-NOR-like1T2 | AACGGGGCGCGCCCAAATAGTGACCAATGTTGCTCC |
| gR-NOR-like1T2 | CTATTTGGGCGCGCCCCGTTGTTTTAGAGCTAGAAAT |
| U6-1NOR-like1T3 | CTTTGGGTGGTTTGCCACCACAATCACTACTTCGTCT |
| gR-NOR-like1T3 | TGGTGGCAAACCACCCAAAGGTTTTAGAGCTAGAAAT |
| U6-29NOR-like1T4 | CAATTGCCACCTGGATTTCGCAATCTCTTAGTCGACT |
| gR-NOR-like1T4 | CGAAATCCAGGTGGCAATTGGTTTTAGAGCTAGAAAT |
After having configured reaction system, first round PCR is carried out according to the condition of table 3.
Table 3, first round PCR response procedures
PCR after reaction, obtains four kinds of PCR products.
(2) second wheel PCR
Prepare the second wheel PCR reaction system on ice according to table 4, template is the corresponding first round PCR reaction for diluting 10 times
Product.Specific primer is to for following four pairs of primers, pair of primers in each reaction system:
The primer pair of Pps-GGL and Pgs-GG2 composition, for expanding LacZ-AtU3d-T1-gRNA；Pps-GG2 and Pgs-
The primer pair of GG3 composition, for expanding AtU3b-T2-gRNA；The primer pair of Pps-GG3 and Pgs-GG4 composition, for expanding
AtU6-1-T3-gRNA；The primer pair of Pps-GG4 and Pgs-GGR composition, for expanding AtU6-29-T4-gRNA.Each primer is shown in
Table 5.
Table 4, second takes turns PCR reaction system
In table 4, the concentration of specific primer pair refers to the concentration of every primer in the primer pair.
Table 5, primer sequence
| Primer | Sequence (5 ' -3 ') |
| Pps-GGL | TTCAGAGGTCTCTCTCGACTAGTATGGAATCGGCAGCAAAGG |
| Pgs-GG2 | AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC |
| Pps-GG2 | TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG |
| Pgs-GG3 | AGCGTGGGTCTCGTCTTCACTCCATCCACTCCAAGCTC |
| Pps-GG3 | TTCAGAGGTCTCTAAGACTTTGGAATCGGCAGCAAAGG |
| Pgs-GG4 | AGCGTGGGTCTCGAGTCCTTTCCATCCACTCCAAGCTC |
| Pps-GG4 | TTCAGAGGTCTCTGACTACATGGAATCGGCAGCAAAGG |
| Pgs-GGR | AGCGTGGGTCTCGACCGACGCGTATCCATCCACTCCAAGCT |
After having configured reaction system, the second wheel PCR is carried out according to the condition of table 6.
Table 6, second takes turns PCR response procedures
After the reaction was completed, it will be purified after four kinds of PCR product mixed in equal amounts, obtain the mixing of following four DNA fragmentations
Object: LacZ-AtU3d-T1-gRNA, AtU3b-T2-gRNA, AtU6-1-T3-gRNA and AtU6-29-T4-gRNA.
4, the preparation of recombinant vector
Target DNA fragment and pYLCRISPR/Cas9-P are completed using Golden Gate cloning methodubi- H carrier
(Ma X,Zhang Q,Zhu Q,Liu W,Chen Y,Qiu R,Wang B,Yang Z,Li H,Lin Y,Xie Y,Shen R,
Chen S,Wang Z,Chen Y,Guo J,Chen L,Zhao X,Dong Z,Liu Y G.A Robust CRISPR/
Cas9System for Convenient,High-Efficiency Multiplex Genome Editing in Monocot
And Dicot Plants [J] .Molecular Plant, 2015,8 (8): 1274-1284) digestion connect reaction, reaction knot
The correct recombinant vector of sequence is denoted as pYLCRISPR/Cas9-NOR-like1 gene editing carrier by Shu Hou.Reaction system is shown in
Table 7, reaction condition is shown in Table 8.
PYLCRISPR/Cas9-NOR-like1 gene editing carrier: pYLCRISPR/Cas9-NOR-like1 gene editing
Carrier is using BsaI in pYLCRISPR/Cas9-PubiBe sequentially inserted between the multiple cloning sites of-H LacZ-AtU3d-T1-gRNA,
The recombinant vector that AtU3b-T2-gRNA, AtU6-1-T3-gRNA and AtU6-29-T4-gRNA are obtained.
Table 7, sgRNA expression cassette and pYLCRISPR/Cas9-PubiDigestion-linked system of-H carrier
In table 7,10 × CutSmart Buffer is NEB Products, T4DNA ligase and 10 × T4 DNA
Ligase Buffer is Promaga Products, and BsaI-HF is NEB Products.
Table 8, Golden Gate cloning reaction condition
Two, tomato genetic transformation
PYLCRISPR/Cas9-NOR-like1 gene editing carrier is converted using the leaf disc transformation method of mediated by agriculture bacillus
Wild-type tomatoes kind AC.All operations carry out in aseptic operating platform, the specific steps are as follows:
(1) it sows: taking appropriate tomato seeds in sterile petri dish, impregnate (shaking keeps contact uniform) with 75% ethyl alcohol
5min is sterilized, ethanol solution is outwelled, then impregnate (shaking keeps contact uniform) 8min with 4% liquor natrii hypochloritis, finally with sterile
Water cleans 7-8 times, impregnates 1min every time.Seed is seeded in seed germination medium T0 later.
(2) seed is sprouted: after the completion of step (1), the seed sowed being placed in darkroom culture 3-4d or so, postposition of sprouting
2-4d is cultivated under light, for operating in next step after cotyledon is fully deployed.
(3) preculture: after the completion of step (2), tomato seedling root being placed in sterile water, cotyledon blade tip is cut off, will be every
The remainder of piece cotyledon is cut into the square of two 5 × 5mm, back side up to be placed in the T1 preculture culture for being covered with one layer of filter paper
On base, cultivates two days, obtain the explant of preculture.
(4) infected liquid is prepared: by pYLCRISPR/Cas9-NOR-like1 gene editing vector introduction Agrobacterium GV3101
In, recombinant bacterium is obtained, it is (big containing 50 μ g/mL kanamycins, 50 μ g/mL celebrating that picking recombinant bacterium single bacterium falls within 3mL LB culture medium
Mycin and 50 μ g/mL rifampins) in, 28 DEG C of overnight shake culture 16h.Next day takes 300 μ l bacterium solutions (to contain 50 μ in 20mL LB
G/mL kanamycins, 50 μ g/mL gentamicins and 50 μ g/mL rifampins) in culture medium, 28 DEG C of shake culture 6-7h to OD600
Reach 0.5-0.6.5000rpm is centrifuged 10min and collects thallus, and thallus is resuspended to 0D with sterile water600=0.1-0.2, is infected
Liquid.
(5) it co-cultures: the explant of step (3) preculture being dipped into the infected liquid of step (4), 5min is gently shaken
After outwell infected liquid, explant is placed back in precultivation medium T1 after blotting extra infected liquid, is placed in darkroom altogether
Cultivate 2d.
(6) bud inducement cultivation: after the completion of step (5), the explant for co-culturing 2d is taken out from darkroom, the back side is placed in downwards
In bud inducement cultivation base T21,7d is cultivated under 25 DEG C of 16h illumination/8h dark conditions, is transferred to fresh bud inducement cultivation base later
T21 squamous subculture, every the culture medium that 2 weeks more renew, until explant grows callus and grows leaflet.
(7) bud elongation culture: after the completion of step (6), being transferred in bud elongation medium T22 after explant grows leaflet,
Fresh culture medium is replaced every two weeks, until stem is extended to 4-5cm.
(8) culture of rootage: after the completion of step (7), callus is cut off after stem elongation, is transferred in root media T3, is trained
It supports 3-4 weeks, until well developed root system.
(9) earth culture: after the completion of step (8), carefully removing seedling from culture medium, with clear water by culture remaining on root
Base is cleaned, and seedling is transferred in wet native basin, and culture obtains 14 plants of T0For NOR-like1 gene editing plant.
Seed germination medium T0 (800mL): MS salt 1.77g, sucrose 12g is adjusted after being completely dissolved with 1mol/L NaOH
PH to 5.8, adds agar 5.33g, 121 DEG C of high pressure steam sterilization 20min, to be cooled to pour into culture bottle to 55 DEG C or so；
T1 precultivation medium (800mL): MS salt 3.55g, sucrose 24g adjust pH with 1mol/L NaOH after being completely dissolved
To 5.8, add agar 5.33g, 121 DEG C of high pressure steam sterilizations 20min, to be cooled to 55 DEG C or so addition 6-BA to concentration are 1mg/
L, IAA is 0.1mg/L to concentration, prepares plate after mixing；
Bud inducement cultivation base T21 (800mL): MS salt 3.55g, sucrose 24g is adjusted after being completely dissolved with 1mol/L NaOH
PH to 5.8, adds agar 5.33g, 121 DEG C of high pressure steam sterilization 20min, and to be cooled to 55 DEG C or so addition hygromycin to concentration are
It is 1mg/L, IAA to concentration to concentration is 0.1mg/L that 10mg/L, Ticarcillin/Clavulanate Acid to concentration, which are 200mg/L, ZT, is prepared after mixing flat
Plate；
Bud elongation medium T22 (800mL): MS salt 3.55g, sucrose 24g is adjusted after being completely dissolved with 1mol/L NaOH
PH to 5.8, adds agar 5.33g, 121 DEG C of high pressure steam sterilization 20min, and to be cooled to 55 DEG C or so addition hygromycin to concentration are
It is 0.5mg/L, GA to concentration to concentration is 1mg/L that 10mg/L, Ticarcillin/Clavulanate Acid to concentration, which are 200mg/L, ZT, and culture is poured into after mixing
In bottle；
Root media T3 (800mL): MS salt 1.77g, sucrose 24g, after being completely dissolved with 1mol/L NaOH adjust pH to
5.8, add agar 5.33g, 121 DEG C of high pressure steam sterilization 20min, to be cooled to 55 DEG C or so addition hygromycin to concentration are 5mg/
L, it to concentration is 2mg/L that Ticarcillin/Clavulanate Acid to concentration, which is 150mg/L, IBA, is poured into culture bottle after mixing.
Three, the detection of NOR-like1 gene editing plant
Using the genomic DNA of NOR-like1 gene editing plant obtained by step 2 as template, it is utilized respectively each target sequence
The DNA sequence dna of the 600bp near PCR primer amplification target sequence that upstream and downstream about 300bp is nearby designed or so, and be sequenced,
It is detected for gene Group Edit Mode, PCR primer sequence is shown in Table 9.
Table 9, NOR-like1 gene target abrupt climatic change primer
In table 9, primers F or and Rev are used to amplification target fragment, and Seq1, Seq2 and Seq are sequencing primer.
Be sequenced successfully after by target spot edit mode analyzing web site DSDecode (http:// dsdecode.scgene.com/) and artificial reading peak figure and gene standard sequence is combined to compare the method for analysis to each target sequence
And its edit mode of upstream and downstream is analyzed.
According to the difference of allele edit mode, the transgenosis of acquisition can be divided into it is following several, as shown in table 10:
Table 10, CRISPR/Cas9 gene editing mode list
16 plants of T0For in the PCR amplification result such as Fig. 3 of each target sequence of NOR-like1 gene editing plant and its upstream and downstream
It shown in a, is found after analyzing each target spot PCR product sequencing result, in this 16 strains, selects 2 representative generation NOR-
The strain CR-NOR-like1#1 and CR-NOR-like1#11 of like1 gene editing carry out subsequent experimental, the base of the two strains
Because edit mode is as shown in b in Fig. 3.
Since CRISPR/Cas9 gene editing system has the risk missed the target, it is therefore desirable to be edited to target gene
Positive transgenic strain carry out analysis of missing the target, with determine only have target gene occur gene editing.Firstly, obtaining CRISPR-P
The location information that the possibility of website prediction is missed the target, two gene orders that each Sites Screening most probable misses the target (be shown in by information of missing the target
Table 12)；Then the DNA sequence dna that possible off-target gene is downloaded in the website SGN, finds the position that may be missed the target, and design PCR primer expands
Increase and be sequenced (miss the target detect PCR primer and sequencing primer is shown in Table 11)；Determine that the position is finally by comparing with standard sequence
It is no miss target phenomenon occur.The results show that miss target phenomenon does not occur in CR-NOR-like1#1 and CR-NOR-like1#11.
Table 11, site primer of missing the target primer
In table 11, primers F or and Rev are used to amplification target fragment, and Seq is sequencing primer.
Table 12, potential site primer result of missing the target
Then, the T of NOR-like1 gene editing is collected0For transgenic line CR-NOR-like1#1 and CR-NOR-
The tomato seeds of like1#11 are seeded in wet native basin after vernalization.After 3 weeks, plant is numbered respectively, true leaf is taken to extract
DNA, and using this DNA as each target sequence of template PCR amplifications, after sequencing analysis, Mutants homozygous is filtered out for subsequent experimental.
By the above method, from two T of CR-NOR-like1#1 and CR-NOR-like1#110It is homozygous for being filtered out respectively in strain
Transgenic line is respectively designated as nor-like1#1 and nor-like1#11.The gene mutation mode of the two homozygous lines is such as
Shown in Fig. 4, in the two strains, frameshift mutation occurs for NOR-like1 gene, and protein translation terminates in advance, and acquisition is cut
Remaining 22 amino acid and 85 amino acid, NAC structural domain are destroyed short albumen respectively.Specifically, two of nor-like1#1
The insertion of 1 nucleotide, i.e. 268-269 nucleosides of sequence 1 occur at the T4 sequence of the NOR-like1 gene of chromosome
A nucleotide T is inserted between acid.It is lacked at the T2 sequence of the NOR-like1 gene of two chromosomes of nor-like1#11
11 nucleotide have lacked 1200-1210 nucleotide of sequence 1.
To confirm NOR-like1 protein function missing in nor-like1#1 and nor-like1#11, NOR-like1 is synthesized
Protein specific antibody (c-PIDHERDDLNIDMM) has detected nor-like1#1, nor- with westernblot method
Like1#11 and WT tomato breaks the expression of NOR-like1 albumen in color phase fruit.The result shows that: compared with wild type,
Complete NOR-like1 albumen is lacked in nor-like1#1 and nor-like1#11, as shown in b in Fig. 4, it was demonstrated that nor-
NOR-like1 protein translation terminates in advance in like1#1 and nor-like1#11, NOR-like1 protein function missing.
C-PIDHERDDLNIDMM's the preparation method is as follows: antibody used is that commission Shanghai Ai Bimate biotechnology is limited
The standby rabbit of corporation is mostly anti-.
Nor-like1#1 and nor-like1#11 miss the target and is shown after analysis, the two strains are not missed the target
Phenomenon, testing result of missing the target are shown in Table 12.In addition, inventor is also to the homologous gene NOR (Solyc10g006880) of NOR-like1
The DNA sequence dna of gene is measured, and does not find to miss the target.In addition to this, other two reported participation tomato fruit is also had detected
The DNA sequence dna of real mature SlNAC4 (Solyc11g017470) and SlNAC1 (Solyc04g009440), also discovery is not de-
Target.These results illustrate, in two strains of nor-like1#1 and nor-like1#11, only NOR-like1 gene mutates
Single-gene mutant, and the phenotype of mutant is as caused by NOR-like1 gene mutation.
Four, phenotypic analysis
Plant to be measured: wild-type tomatoes kind AC (WT), nor-like1#1 and nor-like1#11.
1, the measurement of tamato fruit size and seed weight
Both red ripe phase fruit is picked, using its transverse direction maximum diameter and minimum diameter of vernier caliper measurement after picking, take
Diameter of the average value as tomato；And the weight for the fruit that weighs with scale.Every kind of measurement includes at least 15 biology and repeats.
As a result (Fig. 5) is shown, the diameter of WT, nor-like1#1 and nor-like1#11 is respectively 42.21 ± 1.95,
49.08 ± 3.22, the diameter of 48.18 ± 3.82mm, nor-like1#1 and nor-like1#11 are noticeably greater than WT；WT,nor-
The fruit weight of like1#1 and nor-like1#11 is respectively 42.65 ± 3.75,58.65 ± 8.69,57.63 ± 5.40g,
The fruit weight of nor-like1#1 and nor-like1#11 is noticeably greater than WT.Show that NOR-like1 gene mutation can be improved
Fruit size and weight.
2, tamato fruit adopts rear dehydration experiment
The red ripe phase tamato fruit of each plant to be measured is won, with carpopodium wound has been sealed with wax to prevent fruit from picking wound
Dehydration is weighed immediately, record fruit weight M0, and take pictures.Weighing daily later, when dehydration phenotype is obvious, record fruit weight Mn, take pictures
And fruit weight-loss ratio is calculated, fruit weight-loss ratio=(M0-Mn)/M0× 100%.
Storage experiment discovery after being adopted by red ripe phase tamato fruit, compared with WT, tomato fruit after NOR-like1 gene mutation
It is real to be easier dehydration.As shown in fig. 6, WT tamato fruit surface is smooth after room storage 10 days, but NOR-like1 base
Because being mutated tamato fruit but dehydration shrinkage.It is found after calculating the weight-loss ratio of fruit, the average weight-loss ratio of WT fruit is
2.72%, and the average weight-loss ratio of nor-like1#1 and nor-like1#11 fruit is up to 12.68% and 12.54% respectively, shows
It writes and is higher than wild type.That is, the percentage of water loss of nor-like1#1 and nor-like1#11 fruit dramatically increases compared with wild type.
Toluidine blue staining experiment:
It wins plant to be measured and breaks the progress Toluidine blue staining experiment of color phase tamato fruit, concrete operations are as follows:
The fresh fruit won is immersed in 5% toluidine blue solution (the 1/4 of submergence fruit), takes out, uses after 4h
Clear water rinses, and observes the staining conditions of fruit and photographs to record.
As shown in fig. 7, it is existing that slight toluidine blue infiltration occurs in WT fruit surface with after 5% Toluidine blue staining 4h
As, but there is serious toluidine blue and penetrates into phenomenon, explanation in nor-like1#1 and nor-like1#11 tamato fruit surface
The cuticula of tamato fruit is implicitly present in defect after NOR-like1 gene mutation.
The above results explanation: NOR-like1 gene editing is unfavorable for the postharvest storage of tamato fruit, can pass through NOR-
Like1 gene mutation prepares tamato fruit and adopts rear dehydration model and cuticula developmental defect model.
<110>China Agricultural University
<120>application of the protein of NOR-like1 gene and its coding in regulation tamato fruit yield
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 2811
<212> DNA
<213>tomato
<400> 1
caaatattat taaccaaacc aatttccagc tgattttctg tatttttgta ctactaactc 60
acagcacaca caccatttct ctctctcttc taagctgaat tttcgtatca tacaatttac 120
tctttctttc ttttttttta ttattatttt tattatatag ttttataatc aggtcgctct 180
gattaaatat atttgaaaat ttttatcaaa taatattgtg gtcatggaga gtaccgattc 240
atcaaccggc tctcatcatc aaccacaatt gccacctgga tttcgatttc atccaactga 300
tgaagagctt gtggttcatt atcttaagaa aagagttgcc tctgttcctc ttcctgtttc 360
tattattgct gaagttgatc tttacaaatt tgatccttgg gaactacctg gtatgtaatt 420
aatttttatc gcgctttata ttctgctggt attgatcgat cactaaaaaa aattgtgaga 480
tttttttcga gaatatgaaa attcacagga actttaatct ttcgtggagt tttaagtgtt 540
ttgagagggt tttcatataa taagtgtgaa tttgattctt ttgatttttt ttatttttta 600
ttttattgtt gttcaacttt tttatttctt cttccatctt cttttttatt ttgcgaattt 660
ttaagtgtga gaggattttt catataacaa gtataattct ctggttgttc cacctttttt 720
atttctcctc cttttcttcc tctcctcata ataaaatgat aatttggatt tttttttgat 780
gattctttat aagtgtttga aaaattttta ctcgataagt ttgtgtttga ttctcttttt 840
ttaaaaaaaa aaaaaatcct cctcttgttc ttcttcttct tgaggtaaca taattagcgt 900
gaattctatt ctcgtcaatt tcctttttat tttcctttcc ttcttctctc acgtcataaa 960
tgacgactca aaaatttgat aaccttttga gtgtttgaga attttccagc atgcaataag 1020
tgtgaattcg attctcgtta ttctctcttt ttatattttc cttttccttc tcccatggaa 1080
tagagttccc aggggtaatt ttgaaatttt gataacacgc gtttttcaat ttttattttc 1140
agctaaggcg acatttggag aacaagaatg gtatttcttc agtccaagag atagaaaata 1200
tcctaacggg gcgcgcccaa atagggcggc aacttccggt tattggaagg ctaccggaac 1260
cgacaagccg gtgctcaccg ccggcgggac ccaaaaagta ggtgtcaaaa aggcattggt 1320
gttttatggt ggcaaaccac ccaaaggggt gaagacaaat tggattatgc atgaatatag 1380
gcttgctgat aataaaacaa ataataagcc ccctggttgt gaccttgcca ataaaaaatc 1440
actaagggta agtacttctt tattttatta taatgtcatt ttcatacttt atttttaaat 1500
tttaatattt tcacagcaca ccatttgttg gaatagtaag tattcctttt ttgtgataat 1560
cacattagca aatacttcta tattgctaat gtttgtttca atattttata tatgacataa 1620
tgcattttgt aactcattta tgtttttttt ttaaaaataa agtaataaat agatacaatc 1680
aaatcgttga ttatatatta tattttcctt tgatacagat gtattcagtg gcataattat 1740
ataaaatgat aaataatagt caatttgaca tatacatata tcataaatct taaatacccg 1800
taataaaata tttgacctta gatattacct acctgatata gccgcctagt tagcaaaaag 1860
aaaaagatgt aataaaattg actattaaaa ggattacatt tgattggcta atggtttttt 1920
attttttaaa atatgcagct agatgattgg gttttatgta ggatttacaa gaagaataat 1980
actcaaaggc caattgatca tgaaagagat gatttgaata ttgatatgat gatgggatca 2040
tcatcaattc atccatcatg tataccaaat tcaatgtcaa tgccaaatat atttggtcaa 2100
ccaaaaatac cacaactaaa atcttcaaat tttggcacta cattaattca tgatcaaaat 2160
gaccaaaatt tatatgaagg tggatcacaa tattcttcaa aaaggccact agcaaatttg 2220
tattggaatg atcaagatgg aggagctagt aacgataatt ctcaatcaac aaaaaggttt 2280
ttgacagaaa atatggaaga tggattaaat atgaatgctc gagcagatga acaaaatgga 2340
tctatcgtaa gtcttctcag tcaacaacaa gttcttgggt ctctaagtga aggagttttt 2400
cgacaacctt attcaggcat gaattggtac tcttaaaata tcgaattata atataaaaaa 2460
aatatacgat attattatac catacaaatt aaaggtgttt gattattaca ggatcctaac 2520
taattaagat tgattaacga gtgtgttaaa attagattag tgggattgct ggatttgggt 2580
atttgagatt ttgttggttt taaattagat gatttataga tttagtgaaa aaataataat 2640
aataataatt aggtgaggga catgtatatt tttgttttat taactgttta tttttacatt 2700
atagttttat tatatatata tatatatata taaaaataca tacatctcag gaggtttgtc 2760
tgtgaataga gatgcatagg aacaaatatt gtaattaatc atatatattt t 2811
<210> 2
<211> 990
<212> DNA
<213>tomato
<400> 2
atggagagta ccgattcatc aaccggctct catcatcaac cacaattgcc acctggattt 60
cgatttcatc caactgatga agagcttgtg gttcattatc ttaagaaaag agttgcctct 120
gttcctcttc ctgtttctat tattgctgaa gttgatcttt acaaatttga tccttgggaa 180
ctacctgcta aggcgacatt tggagaacaa gaatggtatt tcttcagtcc aagagataga 240
aaatatccta acggggcgcg cccaaatagg gcggcaactt ccggttattg gaaggctacc 300
ggaaccgaca agccggtgct caccgccggc gggacccaaa aagtaggtgt caaaaaggca 360
ttggtgtttt atggtggcaa accacccaaa ggggtgaaga caaattggat tatgcatgaa 420
tataggcttg ctgataataa aacaaataat aagccccctg gttgtgacct tgccaataaa 480
aaatcactaa ggctagatga ttgggtttta tgtaggattt acaagaagaa taatactcaa 540
aggccaattg atcatgaaag agatgatttg aatattgata tgatgatggg atcatcatca 600
attcatccat catgtatacc aaattcaatg tcaatgccaa atatatttgg tcaaccaaaa 660
ataccacaac taaaatcttc aaattttggc actacattaa ttcatgatca aaatgaccaa 720
aatttatatg aaggtggatc acaatattct tcaaaaaggc cactagcaaa tttgtattgg 780
aatgatcaag atggaggagc tagtaacgat aattctcaat caacaaaaag gtttttgaca 840
gaaaatatgg aagatggatt aaatatgaat gctcgagcag atgaacaaaa tggatctatc 900
gtaagtcttc tcagtcaaca acaagttctt gggtctctaa gtgaaggagt ttttcgacaa 960
ccttattcag gcatgaattg gtactcttaa 990
<210> 3
<211> 329
<212> PRT
<213>tomato
<400> 3
Met Glu Ser Thr Asp Ser Ser Thr Gly Ser His His Gln Pro Gln Leu
1 5 10 15
Pro Pro Gly Phe Arg Phe His Pro Thr Asp Glu Glu Leu Val Val His
20 25 30
Tyr Leu Lys Lys Arg Val Ala Ser Val Pro Leu Pro Val Ser Ile Ile
35 40 45
Ala Glu Val Asp Leu Tyr Lys Phe Asp Pro Trp Glu Leu Pro Ala Lys
50 55 60
Ala Thr Phe Gly Glu Gln Glu Trp Tyr Phe Phe Ser Pro Arg Asp Arg
65 70 75 80
Lys Tyr Pro Asn Gly Ala Arg Pro Asn Arg Ala Ala Thr Ser Gly Tyr
85 90 95
Trp Lys Ala Thr Gly Thr Asp Lys Pro Val Leu Thr Ala Gly Gly Thr
100 105 110
Gln Lys Val Gly Val Lys Lys Ala Leu Val Phe Tyr Gly Gly Lys Pro
115 120 125
Pro Lys Gly Val Lys Thr Asn Trp Ile Met His Glu Tyr Arg Leu Ala
130 135 140
Asp Asn Lys Thr Asn Asn Lys Pro Pro Gly Cys Asp Leu Ala Asn Lys
145 150 155 160
Lys Ser Leu Arg Leu Asp Asp Trp Val Leu Cys Arg Ile Tyr Lys Lys
165 170 175
Asn Asn Thr Gln Arg Pro Ile Asp His Glu Arg Asp Asp Leu Asn Ile
180 185 190
Asp Met Met Met Gly Ser Ser Ser Ile His Pro Ser Cys Ile Pro Asn
195 200 205
Ser Met Ser Met Pro Asn Ile Phe Gly Gln Pro Lys Ile Pro Gln Leu
210 215 220
Lys Ser Ser Asn Phe Gly Thr Thr Leu Ile His Asp Gln Asn Asp Gln
225 230 235 240
Asn Leu Tyr Glu Gly Gly Ser Gln Tyr Ser Ser Lys Arg Pro Leu Ala
245 250 255
Asn Leu Tyr Trp Asn Asp Gln Asp Gly Gly Ala Ser Asn Asp Asn Ser
260 265 270
Gln Ser Thr Lys Arg Phe Leu Thr Glu Asn Met Glu Asp Gly Leu Asn
275 280 285
Met Asn Ala Arg Ala Asp Glu Gln Asn Gly Ser Ile Val Ser Leu Leu
290 295 300
Ser Gln Gln Gln Val Leu Gly Ser Leu Ser Glu Gly Val Phe Arg Gln
305 310 315 320
Pro Tyr Ser Gly Met Asn Trp Tyr Ser
325
Claims (10)
1. regulate and control the substance of NOR-like1 protein active or regulate and control the substance of plant NOR-like1 protein content in D1)-
D6 the application in) any:
D1) regulate and control plant fruit yield；
D2) promote growing of plant fruit；
D3 it) cultivates fruit yield and increases plant；
D4) preparation regulation plant fruit yield product；
D5) preparation promotes growing of plant fruit product；
D6) fruit yield increase plant product is cultivated in preparation.
2. application according to claim 1, it is characterised in that: the NOR-like1 protein is following A1), A2) or
A3):
A1) amino acid sequence is the protein of sequence 3；
A2) amino acid sequence shown in sequence 3 in sequence table is passed through to the substitution and/or missing of one or several amino acid residues
And/or addition and protein with the same function；
A3) in A1) or the obtained fused protein of N-terminal A2) or/and C-terminal connection label；
The substance of the regulation plant NOR-like1 protein content is NOR-like1 protein or its relevant biological material；Institute
Biomaterial is stated as any one of following B1) to B9):
B1 the nucleic acid molecules of the NOR-like1 protein) are encoded；
B2) contain B1) expression cassettes of the nucleic acid molecules；
B3) contain B1) recombinant vectors of the nucleic acid molecules or contain B2) recombinant vector of the expression cassette；
B4) contain B1) recombinant microorganisms of the nucleic acid molecules or contain B2) recombinant microorganism of the expression cassette or contain
B3) the recombinant microorganism of the recombinant vector；
B5) contain B1) the transgenic plant cells systems of the nucleic acid molecules or contain B2) genetically modified plants of the expression cassette
Cell line；
B6) contain B1) Transgenic plant tissues of the nucleic acid molecules or contain B2) the genetically modified plants group of the expression cassette
It knits；
B7) contain B1) the genetically modified plants organs of the nucleic acid molecules or contain B2) the genetically modified plants device of the expression cassette
Official；
B8) inhibit the nucleic acid molecules of NOR-like1 protein coding gene expression；
B9) contain B8) expression cassette, recombinant vector, recombinant microorganism or the transgenic plant cells system of the nucleic acid molecules.
3. application according to claim 1 or 2, it is characterised in that: B1) nucleic acid molecules are following b1)-b5) in
It is any:
B1) coded sequence is the cDNA molecule or DNA molecular of sequence 2 in sequence table；
B2) cDNA molecule or DNA molecular shown in sequence 2 in sequence table；
B3) cDNA molecule or DNA molecular shown in sequence 1 in sequence table；
B4) and b1) or b2) or the nucleotide sequence that b3) limits there is 75% or 75% or more identity, and encode the NOR-
The cDNA molecule or DNA molecular of like1 protein；
B5) under strict conditions with b1) or b2) or b3) or the nucleotide sequence hybridization that b4) limits, and encode the NOR-
The cDNA molecule or DNA molecular of like1 protein.
4. application according to claim 1 to 3, it is characterised in that: the fruit yield is embodied in fruit size
And/or in weight.
5. application according to any one of claims 1-4, it is characterised in that: the plant be M1) M2) or M3):
M1) dicotyledon or monocotyledon；
M2) plant of Solanaceae；
M3) tomato.
6. the method for following M1 or M2:
M1, improve plant fruit yield method, comprising: reduce recipient plant in NOR-like1 protein activity, reduce by
The content of NOR-like1 protein in body plant, inhibit in recipient plant the expression of the encoding gene of NOR-like1 protein or
The encoding gene for knocking out NOR-like1 protein in recipient plant obtains compared with the recipient plant fruit size and/or again
Increased purpose plant is measured, realizes the raising of fruit yield；
M2, the method that fruit yield increases plant is cultivated, comprising: reduce the activity, drop of NOR-like1 protein in recipient plant
The content of NOR-like1 protein in low recipient plant, the table for inhibiting the encoding gene of NOR-like1 protein in recipient plant
The encoding gene for reaching or knocking out NOR-like1 protein in recipient plant, obtain compared with the recipient plant fruit size and/
Or the increased purpose plant of weight, the purpose plant are that fruit yield increases plant.
7. according to the method described in claim 6, it is characterized by: described knock out NOR-like1 protein in recipient plant
Encoding gene is realized using CRISPR/Cas9 method.
8. according to the method described in claim 7, it is characterized by: in CRISPR/Cas9 method sgRNA target sequence be T1,
T2, T3 and/or T4, the T1 are 1262-1281 of sequence 1, and the T2 is the reversed of 1224-1205 of sequence 1
Complementary series, the T3 are 1327-1346 of sequence 1, and the T4 is 285-266 reverse complemental sequences of sequence 1
Column.
9. according to the method any in claim 6-8, it is characterised in that: the recipient plant is M1) or M2) or M3):
M1) dicotyledon or monocotyledon；
M2) plant of Solanaceae；
M3) tomato.
10. with D1)-D3) in any function product, containing the NOR-like1 protein any in claim 1-3 or
The biomaterial:
D1) regulate and control plant fruit yield；
D2) promote growing of plant fruit；
D3 it) cultivates fruit yield and increases plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910675952.6A CN110408650B (en) | 2019-07-25 | 2019-07-25 | Application of NOR-like1 gene and protein encoded by same in regulation of tomato fruit yield |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910675952.6A CN110408650B (en) | 2019-07-25 | 2019-07-25 | Application of NOR-like1 gene and protein encoded by same in regulation of tomato fruit yield |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110408650A true CN110408650A (en) | 2019-11-05 |
| CN110408650B CN110408650B (en) | 2021-04-23 |
Family
ID=68363103
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910675952.6A Active CN110408650B (en) | 2019-07-25 | 2019-07-25 | Application of NOR-like1 gene and protein encoded by same in regulation of tomato fruit yield |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110408650B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112048510A (en) * | 2020-09-11 | 2020-12-08 | 浙江师范大学 | Application of one gene in enlarging tomato fruit |
| CN112175969A (en) * | 2020-10-13 | 2021-01-05 | 广东省农业科学院果树研究所 | Preparation and application of corn ZmFKF1 gene and gene editing mutant thereof |
| CN113881685A (en) * | 2021-10-09 | 2022-01-04 | 江苏省农业科学院 | Gene PpHSP20-like1 for promoting plant organs to generate red color and application thereof |
| CN113980106A (en) * | 2021-10-27 | 2022-01-28 | 中国农业大学 | Small peptide for regulating and controlling sizes of plant seeds and organs, and coding gene and application thereof |
| WO2023065966A1 (en) * | 2021-10-22 | 2023-04-27 | 新疆农业科学院园艺作物研究所 | Application of bfne gene in tomato plant type improvement and biological yield increase |
| CN116574701A (en) * | 2022-12-09 | 2023-08-11 | 中国科学院华南植物园 | Histone demethylase SlJMJ10, coding gene thereof and application thereof in regulating and controlling tomato fruit size |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102260679A (en) * | 2010-05-27 | 2011-11-30 | 中国科学院上海生命科学研究院 | Protein for regulating growth of fruits and seeds and use thereof |
| CN103220905A (en) * | 2010-05-28 | 2013-07-24 | 纽海姆有限公司 | Plants with increased fruit size |
| CN104561025A (en) * | 2013-10-29 | 2015-04-29 | 华中农业大学 | Tomato slml1 gene and application |
-
2019
- 2019-07-25 CN CN201910675952.6A patent/CN110408650B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102260679A (en) * | 2010-05-27 | 2011-11-30 | 中国科学院上海生命科学研究院 | Protein for regulating growth of fruits and seeds and use thereof |
| CN103220905A (en) * | 2010-05-28 | 2013-07-24 | 纽海姆有限公司 | Plants with increased fruit size |
| CN104561025A (en) * | 2013-10-29 | 2015-04-29 | 华中农业大学 | Tomato slml1 gene and application |
Non-Patent Citations (5)
| Title |
|---|
| ACCESSION NO: KC143040.1: "Solanum lycopersicum sinor-likeprotein 1 mRNA, complete cds", 《GENBANK》 * |
| GAO ET AL.: "A NAC transcription factor, NOR-like1, is a new positive regulator of tomato fruit ripening", 《HORTICULTURE RESEARCH》 * |
| WANG ET AL.: "Diversification of NOR-like genes resulted in functional similarity in tomato", 《PLANT GROWTH REGULATION》 * |
| 舒攀等: "CRISPR/Cas9基因编辑技术在果蔬作物中的应用", 《植物生理学报》 * |
| 赵一博等: "过表达核糖体装配调控蛋白NOG1对番茄果实大小的影响", 《分子植物育种》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112048510A (en) * | 2020-09-11 | 2020-12-08 | 浙江师范大学 | Application of one gene in enlarging tomato fruit |
| CN112048510B (en) * | 2020-09-11 | 2022-12-20 | 浙江师范大学 | Application of one gene in enlarging tomato fruit |
| CN112175969A (en) * | 2020-10-13 | 2021-01-05 | 广东省农业科学院果树研究所 | Preparation and application of corn ZmFKF1 gene and gene editing mutant thereof |
| CN113881685A (en) * | 2021-10-09 | 2022-01-04 | 江苏省农业科学院 | Gene PpHSP20-like1 for promoting plant organs to generate red color and application thereof |
| CN113881685B (en) * | 2021-10-09 | 2024-03-29 | 江苏省农业科学院 | Gene PpHSP20-like1 for promoting plant organ to produce red color and application thereof |
| WO2023065966A1 (en) * | 2021-10-22 | 2023-04-27 | 新疆农业科学院园艺作物研究所 | Application of bfne gene in tomato plant type improvement and biological yield increase |
| CN113980106A (en) * | 2021-10-27 | 2022-01-28 | 中国农业大学 | Small peptide for regulating and controlling sizes of plant seeds and organs, and coding gene and application thereof |
| CN116574701A (en) * | 2022-12-09 | 2023-08-11 | 中国科学院华南植物园 | Histone demethylase SlJMJ10, coding gene thereof and application thereof in regulating and controlling tomato fruit size |
| CN116574701B (en) * | 2022-12-09 | 2024-02-23 | 中国科学院华南植物园 | Histone demethylase SlJMJ10, coding gene thereof and application thereof in regulating and controlling tomato fruit size |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110408650B (en) | 2021-04-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110408650A (en) | Application of the protein of NOR-like1 gene and its coding in regulation tamato fruit yield | |
| EP2383345B1 (en) | Polynucleotides and polypeptides involved in plant fiber development and methods of using same | |
| BRPI0718977A2 (en) | METHOD FOR INCREASING SEED Yield IN PLANTS IN RELATION TO CONTROL PLANTS, CONSTRUCTION, USE OF THE SAME, PLANT, PART OF PLANT OR PLANT CELL, METHOD FOR THE PRODUCTION OF A TRANSGENIC PLANT HAVING INCREASE IN PLANT SEED CONTROL , Transgenic plant, harvestable parts of a plant, products, and use of a nucleic acid | |
| CN107827964A (en) | A kind of transcription factor PwNAC2 related to plant stress tolerance and its encoding gene and application | |
| CN103695438A (en) | Arabidopsis MYB family transcription factor AtMYB17 gene as well as coding sequence and application thereof | |
| EP3390641B1 (en) | Compositions and methods for manipulating the development of plants | |
| CN101123870A (en) | Isolated polypeptides and polynucleotides encoding same for generating plants with increased cuticlar water permeability | |
| CN110408649A (en) | Application of the protein of NOR gene and its coding in regulation tamato fruit in flavonoids synthesis | |
| CN107459565A (en) | Application of the soybean drought resisting GAP-associated protein GAP in regulating and controlling soybean drought resistance | |
| CN109021084A (en) | Trifoliate orange Cold resistant genes PtrERF109 and its application in plant cold resistance genetic improvement | |
| CN102399268B (en) | Plant stress tolerance-related transcription factor GmNAC11, coding gene and application thereof | |
| MX2011005719A (en) | Methods and compositions for the improvement of plant tolerance to environmental stresses. | |
| CN107105627B (en) | Methods for monocot plant improvement | |
| CN109971766A (en) | A kind of and plant stress tolerance-associated protein PwRBP1 and its encoding gene and application | |
| CN108997487A (en) | Application of the resistance relevant protein Z76 in regulation stress resistance of plant | |
| MX2014007711A (en) | Methods for improving crop yield. | |
| CN104945492B (en) | Plant stress tolerance correlative protein TaAREB3 and its encoding gene and application | |
| CN110373425A (en) | Application of the protein of NOR-like1 gene and its coding after regulation tamato fruit is adopted in dehydration | |
| CN110218247A (en) | Two kinds of interactions between protein collaborations of PwRBP1 and PwNAC1 improve plant stress tolerance and its application | |
| CN111116721A (en) | Plant stress resistance-related transcription factor PwNAC30, and coding gene and application thereof | |
| CN109797158A (en) | The rice high temperature resistant gene of application and acquisition of the gene OsNTL3 in terms of improveing rice high temperature resistance | |
| CN105713078B (en) | Application of the drought resistant correlative protein in regulation plant drought resistance | |
| CN109811005A (en) | The application of plant type GAP-associated protein GAP OsSLA1 and its encoding gene in adjusting and controlling rice Leaf inclination | |
| CN105646683B (en) | The application of complete salt tolerant protein matter and relevant biological material in regulation plant salt endurance | |
| CN107022011B (en) | A kind of soybean transcription factor GmDISS1 and its encoding gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |