CN110184268B - Rubber tree U6 gene promoter proHbU6.2 and cloning and application thereof - Google Patents
Rubber tree U6 gene promoter proHbU6.2 and cloning and application thereof Download PDFInfo
- Publication number
- CN110184268B CN110184268B CN201910462085.8A CN201910462085A CN110184268B CN 110184268 B CN110184268 B CN 110184268B CN 201910462085 A CN201910462085 A CN 201910462085A CN 110184268 B CN110184268 B CN 110184268B
- Authority
- CN
- China
- Prior art keywords
- vector
- promoter
- hevea brasiliensis
- gene
- rubber tree
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
Abstract
The invention belongs to the technical field of genetic engineering, and particularly relates to a hevea brasiliensis RNA polymerase III type promoter, more particularly to a hevea brasiliensis U6 gene promoter proHbU6.2, and further discloses a cloning method and application thereof. The hevea brasiliensis RNA polymerase III type promoter, namely hevea brasiliensis endogenous U6 promoter proHbU6.2, is obtained by cloning in hevea brasiliensis for the first time, has high-efficiency transcription activity, can drive the expression of downstream sgRNA, verifies the activity of the promoter and the feasibility of the promoter in a hevea CRISPR/Cas9 gene editing system by instantaneously converting hevea brasiliensis protoplasts, and realizes CRISPR/Cas 9-mediated targeted editing of hevea brasiliensis genomes for the first time.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a hevea brasiliensis RNA polymerase III type promoter, more particularly to a hevea brasiliensis U6 gene promoter proHbU6.2, and further discloses a cloning method and application thereof.
Background
Natural rubber is always an important strategic material and reserve resource in China, and at present, the breeding of new varieties of rubber trees in China is still mainly the traditional crossbreeding. The slow growth of the rubber trees causes the problems of low efficiency and long period of conventional breeding, and the breeding process of the rubber trees is seriously hindered. With the development of biotechnology, the application of molecular breeding technology in rubber trees accelerates the cultivation of new varieties of rubber trees, and the introduction of exogenous genes through agrobacterium or a gene gun becomes an important mode for genetic improvement of rubber trees. However, in the above-mentioned process of introducing the foreign gene fragment, the gene fragment is randomly inserted into the genome of rubber tree, and not only the insertion site is not controlled, but also the position benefit is problematic (Yutaka et al, 2018, Chromosoma, doi:10.1007/s 00412-018-one 0677-6.).
The emergence of CRISPR/Cas9 (restricted regulated linear intercalary plasmids/CRISPR-associated nuclear 9) genome editing technology provides a new approach for the precise modification of the genome (Yongwei et al, 2016, Front Plant Sci,7: 1928; Collonnier et al, 2017, Methods,121-122: 103-117; Yutaka et al, 2018, Chromosoma, doi:10.1007/S00412-018-0677-6), the basic principle of mediating gene editing is that the transient gene editing is achieved by means of single-stranded guide RNA (single guide RNA, sgRNA) introduction, using a site-specific nuclease binding and cleavage of a genome-specific site (PAM), generating a DNA double-strand break (DSBs), which in turn causes mutations in rice plants by Homologous Repair (HR) or non-homologous ligation of NHEd junction (NHEd) and cutting of a specific target site (PAM) DNA, the exogenous DNA, the promoter.
Studies show that the level of sgRNA content in recipient cells is one of the important factors affecting the editing efficiency in the CRISPR/Cas9 gene editing system, and thus, a polymerase III type promoter that can precisely initiate the transcription of sgRNA in vivo has gained wide attention (Jinek et al, 2016, Science 337: 816-821; Mali et al, 2013, Science 339: 823-826; Cong et al, 2013, Science 339: 819-823). U6RNA is a non-coding RNA involved in splicing with mRNA precursors, and its corresponding U6 promoter is a type of RNA polymerase III promoter, and has been used in a number of species of CRISPR/Cas9 systems (Kim and Nam, 2013, plant mol. Bio.Rep.31: 581-593; L i et al, 2007, J.integer plant ol. 49: 222: 229; H.Jpo 9, 2014-934, 806).
Although the CRISPR/Cas9 genome editing technology is widely applied to various species at present, the gene editing technology aiming at the rubber tree is not reported yet. This is mainly due to the fact that although the U6 promoter has been reported in large numbers in many species, the exogenous U6 promoter is not generally applicable (x.sun et al, 2015, sci.rep.,5 p.10342). Therefore, the lack of a suitable U6 promoter becomes a restriction factor of the CRISPR/Cas9 gene editing system of the rubber tree at present, and also limits the application of the CRISPR/Cas9 genome editing technology in rubber tree breeding. Therefore, screening of the U6 promoter with functional activity in rubber trees has positive significance for the development of gene breeding technology of rubber trees.
Disclosure of Invention
Therefore, the technical problem to be solved by the invention is to provide a hevea brasiliensis U6 gene promoter proHbU6.2, and further disclose a cloning method and application thereof.
In order to solve the technical problems, the rubber tree U6 gene promoter proHbU6.2 provided by the invention comprises a promoter proHbU6.2 shown as SEQ ID No: 1. The hevea brasiliensis U6 gene promoter prohbu6.2 is an RNA polymerase type III promoter of hevea brasiliensis U6snRNA gene and is derived from hevea brasiliensis (Heveabrasiliensis).
Specifically, the DNA nucleotide sequence of the promoter proHbU6.2 is shown as SEQ ID No: 1 is shown.
The invention also discloses a transient transformation editing vector of the rubber tree, namely the vector contains the rubber tree U6 gene promoter proHbU6.2.
Specifically, the transient transformation editing vector is a recombinant plasmid proHbU6.2-sgRNA-163Cas 9M.
The invention also discloses a method for cloning the hevea brasiliensis U6 gene promoter proHbU6.2, which comprises the following steps:
(1) the genome DNA of the leaf of Hevea brasiliensis was used as a template to design the following specific primers:
proHbU6.2-F：TCTAAGCTAAAGGAATAGCTTAGCAC；
proHbU6.2-R：CAATTGCTACTGCCTATTC；
(2) PCR amplification was performed in a 20. mu.l reaction using KOD FX enzyme;
(3) cloning the amplified product TA to a pMD19-T vector, transforming into escherichia coli Dh5 α, and selecting recombinant monoclonal sequencing to obtain the 345bp rubber tree U6 gene promoter DNA fragment proHbU6.2.
Specifically, in the step (2), the reaction procedure of the PCR amplification step is: pre-denaturation at 95 ℃ for 2min, denaturation at 98 ℃ for 10s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 1min, 35 cycles, and final extension at 72 ℃ for 5 min.
The invention also discloses a method for constructing the instantaneous transformation editing vector of the rubber tree, which comprises the following steps:
(a) the cloned promoter proHbU6.2 is constructed on an intermediate vector SK-5G
Using SalI and XhoI to double-enzyme-cut an SK-5G carrier, recovering a 2913bp carrier skeleton fragment, designing the following primers, respectively introducing homologous sequences at two ends of a proHbU6.2 sequence and a carrier gRNA sequence, and assembling proHbU6.2 and gRNA on the SK-5G carrier to obtain proHbU6.2-SK-5G:
proHbU6.2-lF：
GCGGCCGCAGATCTGCTAGCGTCGACTCTAAGCTAAAGGAATAGC；
proHbU6.2-lR：
GTGTTGTGTTCACCTGCGAGCCAATTGCTACTGCCTATTC；
gRNA-sF：GCTCGCAGGTGAACACAACACC；
gRNA-sR：TTGGGTACCGAGGATCCTCTAGA；
(b) constructing target sites on proHbU6.2-SK-5G vector
Selecting the following target sites on the HbTF L1-3 gene of rubber tree:
GCCCAGCATAGGGATCCAC, cutting proHbU6.2-SK-5G carrier by AarI enzyme, and forming two sticky ends of 3 '-TAAC and 5' -GTTT at two ends;
target site sequences were synthesized and the two sticky ends of 5 '-ATTG and 3' -CAAA were introduced:
forward direction: ATTGGCCCAGCATAGGGATCCAC, respectively;
and (3) reversing: AAACGTGGATCCCTATGCTGGGC, respectively;
uniformly mixing the forward target sequence DNA and the reverse target sequence DNA, annealing at room temperature after treatment at 100 ℃ to form double-stranded DNA with a complementary cohesive end with a proHbU6.2-SK-5G vector, and then connecting the fragment to the downstream position of a promoter of the proHbU6.2 vector by using T4 DNA ligase to obtain a complete sgRNA expression frame;
(c) construction of sgRNA expression cassette onto transient transformation editing vector 163Cas9M
Carrying out double enzyme digestion on proHbU6.2-sgRNA-SK-5G vector by using KpnI and BglII, and recovering a 494bp small fragment sgRNA expression frame;
carrying out double enzyme digestion on the 163Cas9M vector by KpnI and BamHI, and recovering a 7919bp large fragment;
and (3) constructing a small-fragment sgRNA expression frame on a 163Cas9M vector by using T4 DNA ligase to obtain a rubber tree transient conversion editing vector proHbU6.2-sgRNA-163Cas9M, and thus obtaining the rubber tree transient conversion editing vector.
The invention also discloses a method for genome editing of the rubber tree, which comprises the step of introducing the rubber tree transient transformation editing vector into the rubber tree protoplast.
The invention also discloses application of the hevea brasiliensis U6 gene promoter proHbU6.2 in the technical field of hevea brasiliensis molecular breeding.
The invention also discloses application of the rubber tree instantaneous transformation editing vector in the technical field of rubber tree molecular breeding.
The invention clones a hevea brasiliensis RNA polymerase III type promoter, namely hevea brasiliensis endogenous U6 promoter proHbU6.2, for the first time, the promoter is the hevea brasiliensis endogenous RNA polymerase III type promoter, the promoter has high-efficiency transcription activity and can drive the expression of downstream sgRNA, the promoter is constructed to the downstream of the proHbU6.2 promoter in an editing vector after the target sequence of a hevea endogenous flowering regulatory gene HbTF L1-3 is screened, the editing vector is introduced into hevea brasiliensis cells through PEG-mediated hevea blade protoplasm instant conversion to realize the editing of the HbTF L1-3 gene target sites, the activity of the proHbU6.2 promoter is verified, and an effective CRISPR/Cas9 gene editing technical system is also established in the hevea brasiliensis for the first time.
The invention verifies the activity of the cloned hevea brasiliensis endogenous RNA polymerase III type promoter and the feasibility of the promoter in applying the hevea brasiliensis CRISPR/Cas9 gene editing system by transiently transforming hevea brasiliensis protoplast for the first time, and realizes CRISPR/Cas9 mediated hevea brasiliensis genome targeted editing for the first time. Through verification, the edited target site clone sequencing result shows that most of mutation types are deletion and insertion of single base, wherein deletion of multiple bases and insertion of small fragments also occur. Therefore, the cloned promoter proHbU6.2 can be applied to a hevea rubber tree CRISPR/Cas9 gene editing system, thereby realizing efficient and accurate variety improvement on hevea rubber trees.
Drawings
In order that the present disclosure may be more readily and clearly understood, the following detailed description of the present disclosure is provided in connection with specific embodiments thereof and the accompanying drawings, in which,
FIG. 1 shows the alignment of the HbU6.2 gene of rubber tree with the U6 gene sequence of Arabidopsis and cotton, wherein the frame line positions are the key elements USE (upstream sequence element) and TATA box of U6snRNA transcription, and the arrow position is the transcription start site;
FIG. 2 is a clone electrophoresis diagram of a promoter of a hevea brasiliensis HbU6.2 gene, which shows that a 345bp promoter fragment of the HbU6.2 gene is obtained by PCR amplification;
FIG. 3 is a simplified structural diagram of rubber tree transient transformation editing vector proHbU6.2-sgRNA-163Cas9M, a target sequence is in a frame line, a BamHI recognition enzyme cutting site is underlined, and sticky ends complementary to the vector are arranged at two ends of the BamHI recognition enzyme cutting site;
FIG. 4 shows the result of enzyme digestion (PCR/RE) identification of the target gene fragment PCR product of the rubber tree protoplast genome; wherein, 1: PCR products of rubber tree protoplast DNA target gene segments; 2: performing BamHI enzyme digestion on a protoplast DNA target gene fragment PCR product of a control 163Cas9M vector; 3: carrying out BamHI enzyme digestion on a protoplast DNA target gene fragment PCR product of a proHbU6.2-sgRNA-163Cas9M vector; the unedited target gene fragment is cut into small fragments of 500bp and 331bp by BamHI enzyme, and the target gene fragment after the gene editing mutation is a band which can not be cut by enzyme at the arrow;
FIG. 5 shows the result of enzyme digestion verification of the target gene fragment in the monoclonal after TA cloning, and it can be seen that 13 target site mutations are obtained and the monoclonal cannot be digested by BamHI;
FIG. 6 shows the result of the target site editing sequence alignment analysis; it can be seen that the main mutation types are single base deletion and insertion, and multi-base deletion and small fragment insertion exist when 13 edited target sites are sequenced and compared with the wild type.
Detailed Description
In the following examples of the present invention, unless otherwise specified, all the methods are conventional. The intermediate vector SK-5G and the transient transformation vector 163Cas9M in the following examples were offered by the project group of King Ke Jian of China Rice (construction and application of the multi-gene knockout vector of King Ke Jian, King spring, Shenlan, etc.), and the biomaterial was only used for repeating the experiments related to the present invention, and could not be used for other applications.
Example 1 obtaining of the Brachychiton rupestris U6 Gene promoter proHbU6.2
The DNA sequences of an arabidopsis AtU6-26 gene (Genebank accession number: X52528.1) and a cotton GhU6-9 gene (Genebank accession number: XR _001680717.1) are used as references, a rubber tree genomic database built by us is searched, a rubber tree HbU6 gene (Genebank accession number: XR _002491074.1) is found in a homologous alignment mode, and an upstream reference sequence of the gene is obtained.
The method comprises the following steps of designing the following proHbU6.2-F and proHbU6.2-R specific primers by taking the genomic DNA of the leaf of the Brazilian rubber tree of 7-33-97 (cultivated by rubber institute of Chinese tropical agrology academy of sciences) as a template to clone a 345bp DNA fragment of the promoter region:
proHbU6.2-F：TCTAAGCTAAAGGAATAGCTTAGCAC；
proHbU6.2-R：CAATTGCTACTGCCTATTC；
PCR amplification was performed using KOD FX enzyme (TOYOBO) in a 20. mu.l reaction system using the following reaction program: pre-denaturation at 95 ℃ for 2min, denaturation at 98 ℃ for 10s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 1min, 35 cycles, and final extension at 72 ℃ for 5 min.
Cloning the amplified product TA to pMD19-T vector, transforming into Escherichia coli Dh5 α, selecting single clone for sequencing, and obtaining a clone electrophoresis result as shown in figure 2. finally, obtaining 345bp of rubber tree U6 gene promoter DNA fragment proHbU6.2 as shown in SEQ ID No. 1.
The promoter sequence was compared with the base sequences of Arabidopsis AtU6-26 and cotton GhU6-9 and their promoters using Vector NTI align X (Invitrogen) and found to contain TATA box, a critical site for U6snRNA transcription, and the USE sequence element (as shown in FIG. 1), and the positions of these two elements relative to the transcription initiation site are also substantially identical to the promoter sequences of AtU6-26 and cotton GhU6-9, which has an important role in the binding of geometrically symmetric RNA polymerases (Kim and Nam, (2013) plant mol. Bio. Rep.31: 581-593).
Example 2 construction of a rubber Tree Gene editing vector
(1) Construction of proHbU6.2 onto intermediate vector SK-5G vector
Carrying out double enzyme digestion on an SK-5G vector and a downstream gRNA fragment by SalI and XhoI, removing a rice U3 promoter on the vector, recovering a 2913bp vector skeleton fragment, and designing a primer:
proHbU6.2-lF：
GCGGCCGCAGATCTGCTAGCGTCGACTCTAAGCTAAAGGAATAGC；
proHbU6.2-lR：
GTGTTGTGTTCACCTGCGAGCCAATTGCTACTGCCTATTC (SK-5G vector homologous sequences are underlined).
Taking rubber tree genome DNA as a template, carrying out pre-denaturation at 95 ℃ for 2min, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min, 35 cycles and final extension at 72 ℃ for 5min in a 20 mu l reaction system by using KOD FX enzyme (TOYOBO) so as to obtain a proHbU6.2 promoter fragment, and introducing SK-5G vector homologous sequences at two ends of the proHbU6.2 promoter fragment. Designing a primer:
gRNA-sF：GCTCGCAGGTGAACACAACACC；
gRNA-sR：TTGGGTACCGAGGATCCTCTAGA；
using SK-5G carrier plasmid as template, using KOD FX enzyme (TOYOBO) to pre-denature 2min at 95 deg.C, denature 10s at 98 deg.C, anneal 30s at 60 deg.C, extend 1min at 72 deg.C, extend for 35 cycles, and finally extend for 5min at 72 deg.C in 20 μ l reaction system to obtain gRNA fragment.
The obtained homologous sequence proHbU6.2 promoter fragment and gRNA fragment were assembled into an SK-5G vector using the Gibson assembly Cloning Kit (NEB) to obtain proHbU6.2-SK-5G.
(2) The target site is constructed on a proHbU6.2-SK-5G carrier
In order to verify the functional activity of the proHbU6.2 promoter, the hevea brasiliensis flowering regulatory gene HbTF L1-3 is selected as a target gene edited by CRISRP/Cas9, and a proper target site GCCCAGCATAG is selected on the geneGGATCCAC, which contains the BamHI recognition site GGATCC (underlined) 2 bases upstream of the AGG of the PAM site, and is useful for enzyme identification after the target site has been edited.
The synthetic target site sequences are as follows:
forward direction:ATTGGCCCAGCATAGGGATCCAC；
and (3) reversing:AAACGTGGATCCCTATGCTGGGC, underlined 5' -ATTG and3' -CAAA two cohesive ends.
After cleavage of the proHbU6.2-SK-5G vector with AarI, two cohesive ends, 3 '-TAAC and 5' -GTTT, were formed downstream of the proHbU6.2 promoter. Meanwhile, 10 mul of forward and reverse target sequences with the concentration of 100 muM are respectively taken and mixed evenly, treated at 100 ℃ for 5min and annealed at room temperature to form a target site double-stranded DNA fragment with a complementary cohesive end with the proHbU6.2-SK-5G carrier. This fragment was then ligated into the proHbU6.2-SK-5G vector downstream of the proHbU6.2 promoter using T4 DNA ligase (NEB) to obtain the complete sgRNA expression cassette.
(3) Construction of sgRNA expression frame on transient transformation CRISRP/Cas9 gene editing vector 163Cas9M
Carrying out double enzyme digestion on the proHbU6.2-sgRNA-SK-5G vector by using KpnI and BglII, and recovering a 494bp small fragment proHbU6.2-sgRNA expression frame;
carrying out double enzyme digestion on the 163Cas9M vector by KpnI and BamHI, and recovering a 7919bp large fragment;
according to the characteristic that the same cohesive ends are generated after BamHI and BglII enzyme digestion, a small fragment sgRNA expression frame is constructed on a 163Cas9M vector by using T4 DNA ligase (NEB) to obtain a rubber tree transient transformation editing vector proHbU6.2-sgRNA-163Cas9M (the construction result is shown in FIG. 3).
Example 3 transformation of rubber Tree protoplasts
This example uses PEG-mediated editing vector prohbu6.2-sgRNA-163Cas9M to transform hevea protoplasts and 163Cas9M vector without sgRNA expression cassette as control.
The tissue culture seedling of the rubber tree cultivated for one month is transferred to dark condition at 26-28 ℃ for 5-7 days, 2g of color-changing period leaves are immediately soaked in 0.6M mannitol solution for 10min and then used for preparing protoplast. Protoplast preparation and transformation procedures were referred to (Yoo, S.D. et al, 2007, Nature Protocols,2: 1565-1575.). The transformed protoplast was cultured at 26-28 ℃ for 48 hours in the dark and then used for detection of the mutation at the target site.
Example 4 detection of mutation sites of the rubber Tree HbTF L1-3 target sequence
A plant genomic DNA extraction kit (Tiangen) is used for extracting genomic DNA of rubber tree protoplasts, and mutation on a target site sequence of HbTF L1-3 gene is detected by a method of carrying out RE-Enzyme digestion (PCR/Restriction Enzyme digestion, PCR/RE) by using a genomic DNA PCR product (Henao-Mejia J et al, 2016, Cold Spring harbor protocols,2016(2): pdb.prot090704.).
Designing the PCR amplification primers:
HbTFL1-3-F:CACCTAGGGCATAACTTCTAC；
HbTFL1-3-R:ACGGGATCTTAGTTGGATGG；
taking rubber tree protoplast genome DNA as a template, and carrying out PCR amplification to obtain a 831bpHbTF L1-3 target gene fragment containing an editing site, wherein the reaction program comprises pre-denaturation at 95 ℃ for 2min, denaturation at 98 ℃ for 10s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 1min, 35 cycles and final extension at 72 ℃ for 5 min.
As the target gene editing site contains a BamHI restriction enzyme recognition site, the editing of the target site is detected by BamHI enzyme digestion of the recovered HbTF L1-3 gene fragment, the result is shown in FIG. 4, part of the target gene fragment is no longer recognized and digested by BamHI due to mutation of the BamHI recognition site, which preliminarily indicates that the target gene has been successfully edited, while the unedited target gene fragment is digested into two small fragments of 500bp and 331bp, to eliminate the influence of the remaining part of the unedited target gene fragment due to incomplete digestion, the unedited fragment in the PCR product is recovered, TA thereof is cloned on a pMD-19T (TAKARA) vector, E.coli Dh5 α is transformed, and then a single clone is selected, BamHI enzyme digestion verification is performed again on the target site, the result is shown in FIG. 5, the unadited single clone is subjected to DNA sequencing, and the mutation of the target site sequence of Hevea Hb rubber tree HbTF L1-3 is analyzed by sequence alignment, thereby confirming the editing result in the protoplast cell of the Hevea rubber tree protoplast cell.
Therefore, the hevea brasiliensis RNA polymerase III type promoter proHbU6.2 promoter obtained from hevea brasiliensis has transcription activity, can drive the expression of downstream sgRNA, and realizes CRISPR/Cas9 mediated hevea genome targeted editing for the first time; as a result of edited target site clone sequencing, most of the mutation types are deletion and insertion of single base, wherein deletion of multiple bases and insertion of small fragments also occur. Therefore, the promoter disclosed by the invention can be applied to a hevea brasiliensis CRISPR/Cas9 gene editing system, so that the efficient and accurate variety improvement of hevea brasiliensis is realized.
It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.
Sequence listing
<110>
<120> rubber tree U6 gene promoter proHbU6.2 and cloning and application thereof
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>345
<212>DNA
<213>proHbU6.2
<400>1
tctaagctaa aggaatagct tagcaccaac tttaatgttg gttattttaa gggtgtgaaa 60
aatgaaggtc tttataattg ttatagaagt ggaagtatct tgtaacttgt aagcttatgc 120
caacaccagg tgcccttagc gcatggcaag tagggtgtct tagcattggg ctttgaccaa 180
cttaggcctg atgtacaact cagaacccat ttgtgggcct aatgaaatta tttaacccat 240
cctggttgta aagtcatctg gttggttgga ttgaacttag tcccacatca tttagttaca 300
tatagttgca agccttcata agcaaagaat aggcagtagc aattg 345
Claims (9)
1. A rubber tree U6 gene promoter proHbU6.2 is characterized in that the DNA nucleotide sequence of the promoter proHbU6.2 is shown as SEQ ID No: 1 is shown.
2. A transient transformation editing vector for rubber trees, which comprises the promoter proHbU6.2 of the rubber tree U6 gene of claim 1.
3. The hevea brasiliensis transient conversion editing vector of claim 2, wherein the transient conversion editing vector is the recombinant plasmid prohbu6.2-sgRNA-163Cas 9M.
4. A method for cloning the hevea brasiliensis U6 gene promoter prohbu6.2 according to claim 1, comprising the steps of:
(1) the genome DNA of the leaf of Hevea brasiliensis was used as a template to design the following specific primers:
proHbU6.2-F：TCTAAGCTAAAGGAATAGCTTAGCAC；
proHbU6.2-R：CAATTGCTACTGCCTATTC；
(2) PCR amplification was performed in a 20. mu.l reaction using KOD FX enzyme;
(3) cloning the amplified product TA to a pMD19-T vector, transforming into escherichia coli Dh5 α, and selecting recombinant monoclonal sequencing to obtain the 345bp rubber tree U6 gene promoter DNA fragment proHbU6.2.
5. The method for cloning the hevea brasiliensis U6 gene promoter prohbu6.2 according to claim 4, wherein in step (2), the reaction procedure of the PCR amplification step is: pre-denaturation at 95 ℃ for 2min, denaturation at 98 ℃ for 10s, annealing at 59 ℃ for 30s, extension at 72 ℃ for 1min, 35 cycles, and final extension at 72 ℃ for 5 min.
6. A method for constructing the hevea transient transformation editing vector of claim 2 or 3, comprising the steps of:
(a) the cloned promoter proHbU6.2 is constructed on an intermediate vector SK-5G
Using SalI and XhoI to double-enzyme-cut an SK-5G carrier, recovering a 2913bp carrier skeleton fragment, designing the following primers, respectively introducing homologous sequences at two ends of a proHbU6.2 sequence and a carrier gRNA sequence, and assembling proHbU6.2 and gRNA on the SK-5G carrier to obtain proHbU6.2-SK-5G:
proHbU6.2-lF：
GCGGCCGCAGATCTGCTAGCGTCGACTCTAAGCTAAAGGAATAGC；
proHbU6.2-lR：
GTGTTGTGTTCACCTGCGAGCCAATTGCTACTGCCTATTC；
gRNA-sF：GCTCGCAGGTGAACACAACACC；
gRNA-sR：TTGGGTACCGAGGATCCTCTAGA；
(b) constructing target sites on proHbU6.2-SK-5G vector
Selecting the following target sites on the HbTF L1-3 gene of rubber tree:
GCCCAGCATAGGGATCCAC, cutting proHbU6.2-SK-5G carrier by AarI enzyme, and forming two sticky ends of 3 '-TAAC and 5' -GTTT at two ends;
target site sequences were synthesized and the two sticky ends of 5 '-ATTG and 3' -CAAA were introduced:
forward direction: ATTGGCCCAGCATAGGGATCCAC, respectively;
and (3) reversing: AAACGTGGATCCCTATGCTGGGC, respectively;
uniformly mixing the forward target sequence DNA and the reverse target sequence DNA, annealing at room temperature after treatment at 100 ℃ to form double-stranded DNA with a complementary cohesive end with a proHbU6.2-SK-5G vector, and then connecting the fragment to the downstream position of a promoter of the proHbU6.2 vector by using T4 DNA ligase to obtain a complete sgRNA expression frame;
(c) construction of sgRNA expression cassette onto transient transformation editing vector 163Cas9M
Carrying out double enzyme digestion on proHbU6.2-sgRNA-SK-5G vector by using KpnI and BglII, and recovering a 494bp small fragment sgRNA expression frame;
carrying out double enzyme digestion on the 163Cas9M vector by KpnI and BamHI, and recovering a 7919bp large fragment;
and (3) constructing a small-fragment sgRNA expression frame on a 163Cas9M vector by using T4 DNA ligase to obtain a rubber tree transient conversion editing vector proHbU6.2-sgRNA-163Cas9M, and thus obtaining the rubber tree transient conversion editing vector.
7. A method for genome editing of hevea brasiliensis comprising the step of introducing the hevea transient transformation editing vector of claim 2 or 3 into the protoplasts of hevea brasiliensis.
8. The use of the hevea brasiliensis U6 gene promoter prohbu6.2 according to claim 1 in the technical field of molecular breeding of hevea brasiliensis.
9. The use of the transient transformation editing vector of hevea brasiliensis as claimed in claim 2 or 3 in the field of molecular breeding technology of hevea brasiliensis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910462085.8A CN110184268B (en) | 2019-05-31 | 2019-05-31 | Rubber tree U6 gene promoter proHbU6.2 and cloning and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910462085.8A CN110184268B (en) | 2019-05-31 | 2019-05-31 | Rubber tree U6 gene promoter proHbU6.2 and cloning and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110184268A CN110184268A (en) | 2019-08-30 |
| CN110184268B true CN110184268B (en) | 2020-08-04 |
Family
ID=67718881
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910462085.8A Active CN110184268B (en) | 2019-05-31 | 2019-05-31 | Rubber tree U6 gene promoter proHbU6.2 and cloning and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110184268B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112980847B (en) * | 2021-04-21 | 2023-05-02 | 中国热带农业科学院橡胶研究所 | Rubber tree ubiquitin gene promoter proHbUBI3 and cloning and application thereof |
| CN114774414B (en) * | 2022-03-31 | 2023-05-23 | 东北林业大学 | Fraxinus mandshurica U6 gene promoter proFMU6.5, cloning and application thereof |
| CN117487847A (en) * | 2023-10-31 | 2024-02-02 | 中国热带农业科学院橡胶研究所 | Method for obtaining homozygous gene editing plant of rubber tree |
| CN117866966A (en) * | 2024-03-13 | 2024-04-12 | 中国热带农业科学院三亚研究院 | Betel nut U6 promoter and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636091A (en) * | 2016-11-21 | 2017-05-10 | 中国热带农业科学院环境与植物保护研究所 | Litchi leaf specific expression gene LcGRX promoter and application thereof |
-
2019
- 2019-05-31 CN CN201910462085.8A patent/CN110184268B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636091A (en) * | 2016-11-21 | 2017-05-10 | 中国热带农业科学院环境与植物保护研究所 | Litchi leaf specific expression gene LcGRX promoter and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| Identification, Functional Study, and Promoter Analysis of HbMFT1, a Homolog of MFT from Rubber Tree (Hevea brasiliensis);Zhenghong Bi等;《Int. J. Mol. Sci.》;20160302;第17卷(第3期);第1-20页 * |
| 橡胶树HbMVK启动子的克隆与缺失表达分析;胡进 等;《热带生物学报》;20180331;第9卷(第1期);第21-28页 * |
| 登录号：KJ540219;Deng X 等;《GenBank》;20150901;第1-584位 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110184268A (en) | 2019-08-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110144353B (en) | Rubber tree U6 gene promoter proHbU6.6 and cloning and application thereof | |
| CN110184268B (en) | Rubber tree U6 gene promoter proHbU6.2 and cloning and application thereof | |
| CN110144354B (en) | Rubber tree U6 gene promoter proHbU6.3 and cloning and application thereof | |
| Tang et al. | Plant prime editors enable precise gene editing in rice cells | |
| CN110157709B (en) | Rubber tree U6 gene promoter proHbU6.8 and cloning and application thereof | |
| Nandy et al. | Heat‐shock‐inducible CRISPR/Cas9 system generates heritable mutations in rice | |
| CN105112435B (en) | The building and application of plant polygenes knockout carrier | |
| CN109943586B (en) | Plant circRNA overexpression vector and construction method thereof | |
| CN110747187B (en) | Cas12a protein for identifying TTTV and TTV double-PAM sites, plant genome directed editing vector and method | |
| CN110144355B (en) | Rubber tree U6 gene promoter proHbU6.1 and cloning and application thereof | |
| EP4180460A1 (en) | System and method for editing nucleic acid | |
| CN111718954B (en) | Genome editing tool and application thereof | |
| CN112980847B (en) | Rubber tree ubiquitin gene promoter proHbUBI3 and cloning and application thereof | |
| CN113025616B (en) | Rubber tree ubiquitin gene promoter proHbUBI2 and cloning and application thereof | |
| US20220315938A1 (en) | AUGMENTED sgRNAS AND METHODS FOR THEIR USE TO ENHANCE SOMATIC AND GERMLINE PLANT GENOME ENGINEERING | |
| CN112522307A (en) | BSMV (human cytomegalovirus) viral vector-mediated CRISPR (clustered regularly interspaced short palindromic repeats)/Cas 9 recombinant vector and application thereof | |
| CN114540356B (en) | Rhodosporidium toruloides promoter and application thereof | |
| CN105543195A (en) | Plant Cas9 variant protein VQR as well as encoding gene and application thereof | |
| US20060147961A1 (en) | Methods for ligation independent cloning of DNA | |
| CN111019946B (en) | Short small nuclear RNA promoter, construction method thereof and application thereof in genome editing | |
| CN112689678B (en) | Virus-based replicon for editing genome without inserting replicon in genome of plant and use thereof | |
| CN111909956A (en) | Method for improving drought resistance of rice by blocking or weakening gene expression of OsNAC092 of rice | |
| KR20190122595A (en) | Gene Construct for Base Editing in Plant, Vector Comprising the Same and Method for Base Editing Using the Same | |
| CN112481259B (en) | Cloning and application of two sweet potato U6 gene promoters IbU6 | |
| WO2021079759A1 (en) | Method for producing dna-edited plant cell, and kit to be used therein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |