CN105755000A

CN105755000A - Functional identification and application of lychee leaf characteristic expressed gene LcFKBP16-2 promoter

Info

Publication number: CN105755000A
Application number: CN201610164254.6A
Authority: CN
Inventors: 孙进华; 孙琴; 王树军; 李焕苓; 王家保
Original assignee: CATAS Environment and Plant Protection Institute
Current assignee: CATAS Environment and Plant Protection Institute
Priority date: 2016-03-20
Filing date: 2016-03-20
Publication date: 2016-07-13
Anticipated expiration: 2036-03-20
Also published as: CN105755000B

Abstract

The invention discloses functional identification and an application of a lychee leaf characteristic expressed gene LcFKBP16-2 promoter. The invention provides a DNA fragment which is a DNA molecule as the following 1) or 2) or 3): 1) a DNA molecule shown in sequence 1 in a sequence table; 2) a DNA molecule which is hybridized with the DNA sequence defined in 1) under the strict condition and has a promoter function; 3) a molecule which has 70% similarity or above with the DNA sequence defined in 1) and has the promoter function. Experiments prove that the promoter which realizes lychee leaf specific expression promotion, is proved to drive expression of target genes in lychees and is proved to be tissue specific expression is cloned from lychees.

Description

The Function Identification of a kind of Litchi Leaves characteristic expressing gene LcFKBP16-2 promoter and application thereof

Technical field

The present invention relates to biological technical field, be specifically related to a kind of Litchi Leaves characteristic expressing gene LcFKBP16-2 promoter Function Identification and Its application.

Background technology

Fructus Litchi (Litchi chinensis Sonn.) originates in SOUTHERN CHINA and North Vietnam, is the important characteristic fruit in China subtropical and tropical zones. In China, the cultivated area of Fructus Litchi accounts for the 6% of the fruit tree gross area, is the fifth-largest fruit.

On producing, litchi sickness Pests Damage is huge, serious storing and the export trade affecting the yield of Fructus Litchi, quality and fresh fruit.Cultivate excellent Resistant variety is the fundamental way of controlling disease.And owing to endogenous resistance is by controlled by multiple genes, long by the method for the conventional breeding not only cycle and anti- Property with high yield negative correlation, resistance breeding difficulty is bigger.

The nineties in 20th century, the first genetically modified food (fresh-keeping prolong ripe type Fructus Lycopersici esculenti) lists in the U.S. in the world, formally opens genetically modified food Enter the epoch of people's life.By transgenic method, the Bt protein gene of bacillus thuringiensis is imported Semen Maydis and obtain Resistant kind, be anti- Property breeding provides new thinking.But the metabolism expressing possible change plant self of exogenous gene, thus bring current lost potential wind Danger, the safety of transgenic plant is always focus of concern.

The promoter of gene comprises a series of cis acting element, transcriptional level participates in gene expression and regulation.Research to promoter helps In expression pattern and the regulatory mechanism thereof of understanding gene, and it is applied in genetic engineering improve or improve the expression of external source genes of interest.Plant tissue Specificity promoter is that a class can controlling gene expressible dna fragment in some specific organ or tissue.Studies have found that, tissue specificity Promoter is the allelotaxis of plant, and the transport of nutrient substance, the aspect such as opposing biotic and plant and microbial interaction plays a significant role. Along with the development of Protocols in Molecular Biology, plant gene engineering technology is that Fructus Litchi breeding provides due to features such as its tool directional transformation character, cycle are short New approach and thinking, the gene the most relevant with Fructus Litchi economic characters is the most constantly realized and separates.Relevant to pericarp tissue Water Transportation Fructus Litchi aquaporin gene LcPIP, the Litchi Embryo relevant to aborted embryo loses more difference expression gene, the Fructus Litchi MAD-box relevant to flower development Gene, the Litchi Ripening induced gene relevant to fruit development, the Fructus Litchi ACO gene etc. coming off relevant to Fructus Litchi young fruit, all can be by turning Genetic method the most quickly and directionally improves bad character or as breeding new resources.

Along with transgenic technology breeding is more and more universal, food-safety problem is the most of great interest.For greater safety, efficient prevention and elimination of disease and pests With the photosynthesis etc. of raising blade, exogenous gene expression is reduced to minimum to the impact of plant and environment, uses blade special in transgene carrier The promoter of different expressing gene replaces the expression of composing type CaMV35S promoters driven genes of interest, and some character being possible not only to improve blade is (anti- Property, color, photosynthesis characteristics etc.), and the potential food safety risk that can be brought by exogenous gene expression is preferably minimized.

Summary of the invention

It is an object of the invention to provide a kind of Litchi Leaves specific expressing promoter, the expression the strongest for Ye Zhongyou that this promoter has at Fructus Litchi is lived Property, and low expression in sarcocarp.

Promoter provided by the present invention, derives from Sapindaceae Fructus Litchi (L.chinensis Sonn) cv. Feizixiao kind, can be following nucleotides sequence One of row:

1) DNA sequence of sequence 1 in sequence table；

2) under strict conditions with 1) the DNA sequence hybridization that limits and the DNA molecular with promoter function；

3) with 1) DNA sequence that limits has more than 70% similarity and has the DNA molecular of promoter function.

Above-mentioned stringent condition is at 0.1 × SSPE (or 0.1 × SSC), in the solution of 0.1%SDS, hybridizes and wash film at 65 DEG C.

In sequence table, sequence 1 is made up of 1560 Deoxydization nucleotides.

Recombinant vector containing promoter of the present invention, host strain, expression cassette, transgenic cell line or transfer-gen plant containing carrier belong to Protection scope of the present invention.

The present invention is analyzed by Real-Time Fluorescent Quantitative PCR Technique, finds LcFKBP16-2 gene specificity overexpression in Litchi Leaves, clone The promoter of this gene, its sequence is as shown in sequence 1 in sequence table.

In order to verify the promoter function of the present invention, construct GUS fusion expression vector, and the promoter of the present invention is carried out transient transfection transgenic Analyze, determine that this promoter is that blade specific expresses promoter.

The promoter of the present invention has blade specific high expressed, the characteristic of the low expression of sarcocarp, can be applicable to transgenic breeding field.Contained by structure There is the plant expression vector of this startup, be transformed into plant, such as, in the genome of dicotyledon Fructus Litchi etc., drive genes of interest in plant leaf blade Specificity overexpression, can be used for cultivating new breeding material.

Accompanying drawing explanation

Fig. 1 LcFKBP16-2 gene quantitative PCR in Fructus Litchi different tissues is expressed；

Fig. 2 LcFKBP16-2 gene promoter expression vector illustrates；

Fig. 3 pCAMBIA1304-LcFKBP16-2-LcTPL expression vector is at the expression activity of Fructus Litchi different tissues.

Detailed description of the invention

Below by embodiment, the present invention is described in further detail.Method in embodiment, if no special instructions, is conventional method.

The acquisition of embodiment 1. Litchi Leaves different expression gene Lc FKBP16-2 promoter sequence

Winning ripe functional leaf and just open flower without pest and disease damage in the middle part of bearing basal shoot, transport laboratory in 3h back, sterile water wash is clean, Blotting excessive moisture, liquid nitrogen flash freezer ,-76 DEG C of ultra cold storage freezers save backup.Laboratory is transported back in plucking medium well " cv. Feizixiao " fruit and 3h, Selecting the healthy fruit without pest and disease damage, aquesterilisa rinses for several times, blots excessive moisture, strips peel, seed and sarcocarp, liquid nitrogen flash freezer, and-76 DEG C surpass Cryogenic refrigerator saves backup." cv. Feizixiao " mature seed cultivates healthy seedling in nursery plug, after 3 months, takes root, and aseptic water washing is clean, inhales Dry excessive moisture, liquid nitrogen flash freezer ,-76 DEG C of ultra cold storage freezers save backup.Above material CHMC's ocean polysaccharide polyphenol plant RNA extraction test kit carries Take total serum IgE.

With oligodT primer, mRNA reverse transcription being become cDNA, concrete operations are as follows: 30.5 μ L total serum IgE, 12 μ L 5 × RT Buffer, 10 μ L 2.5mmol/L dNTPs, 6 μ L 0.1mmol/L DTT, 1 μ L 0.1mmol/L Oligo (dT)₁₅, 0.5 μ L RNase, 1 μ L MMLV reverse Record enzyme, system softly mixes, brief centrifugation, is incubated 1 hour 42.

Show from each tissue of early stage Fructus Litchi (root, leaf, flower, peel, sarcocarp, pit) transcript profile data analysis, Fructus Litchi LcFKBP16-2 gene At the expression activity that Ye Zhongyou is the strongest, and expression is the lowest in sarcocarp.According to Fructus Litchi transcript profile splicing sequence and genome sequential design for The special primer (LcFKBP16-2-F/R) of LcFKBP16-2 gene.Its sequence is LcFKBP16-2-F: AACTGCAGAAAATCGTAATAATGAAAATGAAGT (underscore is Pst I restriction enzyme site)；LcFKBP16-2-R: CGGAATTCTTGCTGGGTTGAAGGAAA (underscore is EcoR I restriction enzyme site).With Litchi Varieties cv. Feizixiao blade as material, use Ai De The DNA Mini Kit of Lay company extracts genomic DNA, agarose gel electrophoresis and its concentration of trace UV spectrophotometer measuring and pure Degree.With its DNA as template, LcFKBP16-2-F/R is that primer carries out PCR.Response procedures is: 94 DEG C of denaturations 4min；94 DEG C of degeneration 30s； 56 DEG C of annealing 30s；72 DEG C extend 2min, after circulating 35 times；72 DEG C extend 8min.Agarose gel electrophoresis detection rear cutout glue reclaims purpose bar Band.PCR reclaims product and connects PMD18-T carrier, converts E. coli competent.After blue white macula screening, picking positive colony list bacterium colony is used for shaking Bacterium, extracts plasmid.Screening have amplification purpose fragment monoclonal, after send Beijing Hua Da technique for gene engineering Services Co., Ltd to check order.Order-checking obtains Obtain LcFKBP16-2 gene coding region and upstream sequence, by obtained purpose fragment sequence and the obtained sequence alignment analysis of early stage, two sequences base composition Unanimously.Choose translation initiation site upstream 1560bp to study as promoter sequence, the sequence 1 that its nucleotides sequence is classified as in sequence table.

Example 2. Fructus Litchi LcFKBP16-2 gene is investigated at the expression pattern of different tissues

Owing to Fructus Litchi actin (actin) gene is basically identical at the expression of each tissue of Fructus Litchi, so the relative expression quantity of detection Fructus Litchi gene Generally use actin as reference gene, use following primer that each cDNA organized is expanded: Act_F: CAACTGGTATTGTCTTGGATTCTG；Act_R:TCATCAAGGCATCGGTTAGA.Use following primer amplification LcFKBP16-2 gene CDNA:LcFKBP16-2_F:TTCAACCCAGCAATCGTCT；LcFKBP16-2_R:CGGAGCGAGCAAAAGTGA.Reaction system is as follows: 5μL 2×SYCR Premix Ex Taq^TMII, 1 μ L cDNA template, 0.4 μ L forward primer (LcFKBP16-2_F, 10 μMs) and 0.4 μ L are anti- To primer (LcFKBP16-2_R, 10 μMs), 0.2 μ L 50 × ROX Reference Dye II, 3 μ L ddH₂O.Reaction condition is: 95 DEG C of denaturations 30s；94 DEG C of degeneration 5s；60 DEG C of annealing 34s；Circulate 40 times.

Quantitative PCR analysis result shows, LcFKBP16-2 gene is at Litchi Leaves high expressed, and in remaining 5 tissues, expression is relatively low, especially In sarcocarp, expression is minimum.The promoter of confirmation LcFKBP16-2 gene is Litchi Leaves specific expressing promoter.

The structure of example 3. plant LcFKBP16-2 gene promoter expression vector

Extract plant expression vector pCAMBIA1304 plasmid, use restricted enzyme Pst I, Spe I double digestion to remove CaMV35S promoter, Cut glue and reclaim large fragment.By checking order, correct LcFKBP16-2 gene promoter cloning vehicle carries out Pst I, EcoR I double digestion, LcTLP (the sweet egg of class In vain) gene clone carrier carries out EcoR I, Spe I double digestion, cuts glue and reclaims acquisition LcFKBP16-2 promoter gene fragment and LcTLP gene respectively Fragment.Then T4 ligase is used to connect LcFKBP16-2 gene promoter, LcTLP gene and remove the pCAMBIA1304 of CaMV35S promoter Basal expression carrier.Concrete linked system (25 μ L) is: 10 × T4DNA Ligase Buffer 2.5 μ L, LcFKBP16-2 gene promoter DNA Fragment (85ng/ μ L) 3.6 μ L, LcTLP gene DNA fragment (58.1ng/ μ L) 1.17 μ L, remove the pCAMBIA1304 of CaMV35S promoter Plasmid vector (98.5ng/ μ L) 0.5 μ L, T4DNA ligase 1 μ L, ddH₂O 16.23 μ L, 16 DEG C connect overnight.Connect product and convert DH5 α E. coli competent, is coated on the LB screening flat board adding 50 μ g/mL kanamycin, and picking positive colony list bacterium colony is used for shaking bacterium, carries Take plasmid, send Beijing Hua Da technique for gene engineering Services Co., Ltd to check order after PCR detection and enzyme action are identified.Sequencing result confirms different fragments Insertion sequence is consistent with the sequence of sequence in sequence 1 with insertion LcFKBP16-2 gene promoter, and the plant expression vector of structure is PCAMBIA1304-LcFKBP16-2-LcTLP, carrier is as shown in Figure 2.

Example 4. via Particle Bombardment Transformation verifies promoter function with gus gene transient expression

Winning ripe functional leaf and just open flower without pest and disease damage in the middle part of bearing basal shoot, transport laboratory in 3h back, sterile water wash is clean, Blot excessive moisture.Transport laboratory back in plucking medium well " cv. Feizixiao " fruit and 3h, select the healthy fruit without pest and disease damage, 0.1%HgCl₂Disappear After poison 1min, aquesterilisa rinses for several times, after drying, strips peel, seed and sarcocarp." cv. Feizixiao " mature seed is cultivated strong in nursery plug Kang Youmiao, after 3 months, takes the elongation zone of root tissue, meristematic zone and root cap, and aseptic water washing is clean, blots excessive moisture.Above material stands I.e. test for via Particle Bombardment Transformation.

Prepared by micro-missile-borne body

1) weigh 10mg tungsten powder, be placed in the centrifuge tube of 1.5mL；

2) adding the ethanol solution of 1mL 70% (concentration expressed in percentage by volume), abundant vortex 5min, room temperature stands 15min, 1500rpm and is centrifuged 5 min；

3) carefully removing supernatant, add 1mL sterilized water, abundant vortex 5min, room temperature stands 15min, 1500rpm and is centrifuged 5min；With Sterilized water repeats to flush three times.

4) remove supernatant, add the sterile glycerol of 50% (concentration expressed in percentage by volume), make the final concentration of 60mg/mL of tungsten powder；

5) take that 50 μ L are above-mentioned to be prepared and proceed in another aseptic 1.5mL centrifuge tube with the tungsten powder of abundant vortex；

6) 5 μ L plasmid (pCAMBIA1304-LcFKBP16-2-LcTLP), the 50 μ aseptic CaCl of L 2.5M it are sequentially added into₂Solution and 20 μ L The spermidine (now with the current, filtration sterilization) of 0.1M；

7) by abundant for mixture vortex 10min, room temperature stands 15min, 12000rpm and is centrifuged 3min；

8) abandoning supernatant, add the ethanol solution of 70% (concentration expressed in percentage by volume) of 140 μ L, vortex, 12000rpm is centrifuged 30sec；

9) abandon supernatant, add 140 μ L 100% ethanol, vortex, 12000rpm is centrifuged 30sec；

10) abandon supernatant, add 48 μ L 100% ethanol, Eddy diffusion granule, and centrifuge tube is immersed 3sec in ultrasonic cleaner, point Scattered seed, every rifle loading 10 μ L, each loading can bombard 3 times.

Transformation receptor material

1) open superclean bench sterilizing, after sterilizing, open draft switch；

2) with the ethanol solution of 75% (concentration expressed in percentage by volume), particle gun is carried out disinfection, disk can be broken and stop that net is in 121 DEG C of autoclavings 20 min；

3) connect particle gun and high pressure helium gas cylinder, disk can be split with aseptic nipper and stop that net installs, and screwing；

4) take 10 μ L and be coated the tungsten powder particles dehydrated alcohol suspension of DNA, be spread evenly across in cartridge clip；

5) cartridge clip being loaded with micro-bullet is loaded in micro-bullet discharger；

6) helium pressure is transferred to 1100 kPas of high pressure, presses trigger bombardment receptor material

7) take out can row disk and stop net, change cartridge clip, repeat 4～6 steps, bombardment convert other acceptor materials；

8) respectively with pCAMBIA1304 plasmid as positive control, tungsten powder is negative control, and pCAMBIA1304-LcFKBP16-2-LcTLP plasmid bangs Hit above-mentioned Fructus Litchi different tissues material.The Fructus Litchi material bombarded is placed in 28 DEG C of light culture 24h.

GUS histochemical stain

1) by converting the acceptor material after cultivating, with sterile water wash sample for several times, with filter paper, sample surfaces water is blotted；

2) Fructus Litchi is stripped out, and with aseptic operation cutter by the peel of biolistic bombardment, seed and blade, be cut into small pieces；

3) sample cut is gone in the sterile centrifugation tube of 10mL, pipe often adds the fixative (component: 1% (concentration expressed in percentage by volume) of 5mL Formaldehyde, 0.05M sodium phosphate buffer, 0.05% (mass percentage concentration) Triton-100), it is put into 200rpm gentleness shake 30min on shaking table；

4) fixative is removed, by 0.05M sodium phosphate buffer washing sample three times, often shake 10min inferior to 200rpm gentleness；Remove and use The buffer crossed；

5) often pipe adds the existing preparation of 600 μ L GUS dyeing liquor (formula: 50mM sodium phosphate buffer pH7.0, the 0.1M potassium ferricyanide, 0.1M potassium ferrocyanide, 10mM EDTA, 0.1%Triton-100,20% formaldehyde, 0.5mM X-gluc) submergence converting material, in 37 DEG C of water Bath insulation 1h；

6) material is taken out, with the ethanol rinse 20min of 75%；

7) successively 20min is respectively soaked with 20% ethanol, 50% ethanol；

8) examine under a microscope the coloration result of the GUS of converting material and take pictures.

Analysis coloration result find, pCAMBIA1304 plasmid (positive control) in a organized way in all occur in that blue spot, show CaMV35S Promoter can regulate and control the gus gene in pCAMBIA1304 plasmid and express.Tungsten powder (negative control) bombardment does not all occur indigo plant in all material Mottle point, shows that tungsten powder bombardment is not result in that blue spot occurs in Fructus Litchi tissue, makes experimental result false positive occur.The plant expression vector built PCAMBIA1304-FKBP16-2-LcTLP expresses strongly in blade, all has faint expression in root, flower, peel and seed simultaneously, but Sarcocarp does not occur, illustrates that the plant expression vector pCAMBIA1304-FKBP16-2-LcTLP built can regulate and control the gus gene leaf at Fructus Litchi Specificity overexpression in sheet, but can not be regulated and controled it and express in sarcocarp.

Claims

1. a DNA fragmentation, for following 1) or 2) or 3) DNA molecular:

1) DNA molecular shown in sequence 1 in sequence table；

2. contain the recombinant vector of DNA fragmentation described in claim 1, the host strain containing described recombinant vector, expression cassette, transgenic cell System or transfer-gen plant.

3. DNA fragmentation primer described in an amplification claim 1 is to it is characterized in that: described primer is to by the strand shown in sequence in sequence table 2 Single strand dna composition shown in sequence 3 in DNA molecular and sequence table.

DNA fragmentation application in starting destination gene expression the most according to claim 1.

DNA fragmentation the most according to claim 1 is applied in cultivating new variety of plant.

Application the most according to claim 5, it is characterised in that: described destination gene expression is tissue specific expression.

Application the most according to claim 6, it is characterised in that be organized as the blade of plant described in:.

8. according to described application arbitrary in claim 5-7, it is characterised in that: described plant is dicotyledon.

Application according to any one of the most according to Claim 8, it is characterised in that: described dicotyledon is Fructus Litchi.

Application the most according to claim 6, it is characterised in that: described is organized as the sarcocarp of plant, flower, peel and/or seed.