CN108251432A - Radix Notoginseng class PR gene PnPRlike and application - Google Patents

Radix Notoginseng class PR gene PnPRlike and application Download PDF

Info

Publication number
CN108251432A
CN108251432A CN201810000431.6A CN201810000431A CN108251432A CN 108251432 A CN108251432 A CN 108251432A CN 201810000431 A CN201810000431 A CN 201810000431A CN 108251432 A CN108251432 A CN 108251432A
Authority
CN
China
Prior art keywords
pnprlike
gene
plant
tobacco
class
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810000431.6A
Other languages
Chinese (zh)
Other versions
CN108251432B (en
Inventor
刘迪秋
唐笔锋
崔秀明
杨晓艳
熊吟
王承潇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kunming University of Science and Technology
Original Assignee
Kunming University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kunming University of Science and Technology filed Critical Kunming University of Science and Technology
Priority to CN201810000431.6A priority Critical patent/CN108251432B/en
Publication of CN108251432A publication Critical patent/CN108251432A/en
Application granted granted Critical
Publication of CN108251432B publication Critical patent/CN108251432B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Botany (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses a kind of Radix Notoginseng class PR genesPnPRlikeAnd its application,PnPRlikeThe nucleotide sequence of gene such as SEQ ID NO：Shown in 1, class pathogenesis-related proteins are encoded；The present invention is confirmed by functional genomics relation technological researchingPnPRlikeGene has the function of to improve plant to disease fungus resistance, by anti-fungal gene of the present inventionPnPR likeIt is building up on plant expression vector and is transferred to overexpression in tobacco, transgenic tobacco plant has very strong extracorporeal antifungal activity, and experimental result is shown：PnPRlikeThe transgene tobacco of overexpression is respectively provided with apparent inhibiting effect to the growth of Fusarium solani, grape seat chamber bacterium and rice Tuber Melanosporum.

Description

Radix Notoginseng class PR genePnPRlikeAnd application
Technical field
The present invention relates to molecular biology and genetic engineering field the relevant technologies, particularly three with antifungal activity Seven class pathogenesis-related proteins (pathogen-related protein-like isoform) genePnPRlikeAnd application.
Background technology
Plant can be coerced in growth and development process by many biologies and abiotic component, and such as arid, cold, UV is penetrated Line, wound, pathogen（Fungi, bacterium, virus）It infects.Correspondingly, it is inverse to resist to go out series of defence mechanism for plant evolution Border is coerced, pathogenesis-related proteins（Pathogenesis-related proteins, PRs）Activation and accumulation be plant defense The important component of reaction（Singh A, Kirubakaran SI, Sakthivel N. Heterologous Expression of new antifungal chitinase from wheat. Protein Expr Purif, 2007,56 (1):100）.During by following pathogen challenge, plant is anti-to be made to pathogen and external stress by rapidly changing gene expression Should, recombining for some Special Proteins is induced, wherein most is pathogenesis-related proteins（Wen YJ, He HW, Huang QS, Liang S, Bin JH. Roles of pathogenesis-relative protein 10 in plant defense response. Plant Physiology Communications. 2008, 44: 585-592）.
PR albumen is encoded for polygenes, according to the similarity degree, serological relation and biological activity of amino acid sequence, mesh It is preceding that PR albumen is divided into 17 classes (PR1-PR17), PRs shown as in plant chitinase, class thaumatin T, protease inhibitors, (van Loon LC, Rep M, the Pieterse CM. Significance of such as endopeptidase and peroxidase inducible defense-related proteins in infected plants. Annu Rev Phytopathol. 2006, 44: 135-162).PRs genes are plant defense genes, with hypersensitivity（hypersensitive Response, HR）And systemic acquired resistance（Systematic acquire resistance, SAR）It is closely related, it The mark that induced expression is established frequently as SAR, while its gene encoding production is one of hot spot of Resistence research always.PRs phases Smaller to molecular mass, generally 10~40 kD, mostly acidic protein, half-life period are 40~70 h, thus can in intracellular and Intercellular preferably accumulates；PRs has stronger stability, can still keep soluble under low ph value.Using cell separation technology, it is immunized Fluorescence microscopy, immuno-gold labeling technology etc. research shows that, PRs is distributed mainly in plant cell gap and vacuole, point Cloth is related with isoelectric point and the compatibility of induction bacterium and plant.
The chitinase (chitinase) of PR3 gene families coding is concerned in plant disease-resistant defense response.Chitin Matter enzyme is the size distribution of a kind of hydrolyzable chitin in the glycosyl hydrolase of 20-90 kD（Bhattacharya D, Nagpure A, Gupta RK. Bacterialchitinases: properties and potential. Critical Reviews in Biotechnology, 2007, 27(1): 21-28.）.Wherein microorganism chitinase is mostly 20~60 KD, for plant chitinase in 20~45 kD, insect chitinase is 40~85kD.Plant chitinase is present in plant Stem, seed, Hua Zhong, there are tissue specificities for their expression.Plant hormone ethylene（ethylene, ETH）, jasmonic （jasmonic acid, JA）, salicylic acid（salicylic acid, SA）Also the expression of chitinase is induced.Ethephon-induction The accumulation of cucumber leaves space between cells chitinase, the effect and cucumber leaves of induction are direct to the impression of ethephon (CEPHA),2-(chloroethyl) phosphonic acid mass concentration It is related.Use methyl jasmonate（methyl jasmonate, MeJA）Processing ginseng (Panax ginseng C.A. Meyer), Chitinase activity significantly increases compared with the control in root system.Exogenous salicylic acid processing can induce banana (Musa paradisiacal) activity of chitinase and the up-regulated expression of chitinase gene.
Class thaumatin T in PR5 families（thaumatin-like proteins,TLPs）As PRs family member it One, it is a kind of Buchner's bodies being prevalent in higher plant, resists pathogen response ambient pressure in plant to adapt to not It plays a role in good environmental process（Datta K, Velazhahan R, Oliva N, et al. Over-expression of the cloned rice thaumatin-like protein (PR-5) gene in transgenic rice plants enhances environmental friendly resistance to Rhizoctonia solani causing sheath blight disease. Theoretical & Applied Genetics, 1999, 98(6-7): 1138-1145.）.At present in grape(Vitis vinifera), tomato (Lycopersicones culentum), barley （Hordeum vulgare）, wheat（Triticuma estivum）, oat（Avena sativa）Wait plants and part true The presence of TLPs has been had been found that in bacterium.Class thaumatin T amino acid sequence and African plant West Africa arrowroot（Thaumatococcus daniellii）Thaumatin T (thaumatin) very high homology, therefore referred to as class thaumatin T.The homology of two kinds of albumen is very high, but Its function is completely different, and thaumatin T has sweet taste without antifungal activity, and class thaumatin T has antifungal activity without sweet taste.
The molecular weight of albumen of PR10 codings belongs to intracellular PR eggs in 15~19 kD, isoelectric point slant acidity, no signal peptide sequence In vain（Intracellular pathogenesis-related proteins, IPR）.PR10 albumen is in plant defense fungi etc. Play important role during biotic and abiotic stress（Liu JJ, Ekramoddoullah AKM. The family 10 of plant pathogenesis-related proteins: their structure, regulation, and function in response to biotic and abiotic stresses. Physiological and Molecular Plant Pathology, 2006, 68(1): 3-13.）.PR10 albumen belongs to S-like RNase can have beyond body nucleic acid enzymatic activity and antibacterial activity with degradation of rna（Edreva A. Pathogenesis- related proteins: research progress in the last 15years. General and Applied Plant Physiology, 2005, 31(1-2):105-124.）
Radix Notoginseng for Araliaceae (Araliaceae) Panax (Panax) plant, it is China's tradition rare traditional Chinese medicine, main product is in Yunnan Mountain of papers area.Research shows that arasaponin is a variety of with antitumor, antiviral, reduction cholesterol and raising immunity of organisms etc. Bioactivity is the important drugs for preventing cardiovascular and cerebrovascular disease.The fungal disease getting worse of Radix Notoginseng in recent years, Yunnan mountain of papers three The fungal disease of seven main producing regions is mainly root rot, black spot, Northern leaf spot, phytophthora root rot and gray mold.The long-term incidence of root rot It is serious up to more than 70% or even total crop failure generally 5%~20%, and growth year is longer, disease is more serious（Yang Jianzhong, Cui Bright, the Chen Yujun of show, with waiting continuous croppings control effect specialty research of the soil treatment to notoginseng root rot, 2010,32 (2): 37.）.Disease problem has become the serious hindrance for limitation notoginseng planting industry development at present.The disease-resistant function base of separation clone Radix Notoginseng Cause studies the Molecular interaction mechanism of Radix Notoginseng and pathogen, and the resistant heredity breeding for Radix Notoginseng lays the foundation.
Invention content
It is related that the class course of disease of the coding with antifungal activity is obtained the object of the present invention is to provide a kind of clone from Radix Notoginseng Protein genePnPR like, class PR genePnPRlikeNucleotide sequence such as SEQ IDNO：Shown in 1, the gene CDNA full length sequences are 976bp, and 5 ' non-translational regions of open reading frame, 96bp comprising a 717bp, the 3 ' of 163bp non-are turned over Translate area, coding such as SEQ IDNO：The protein of amino acid sequence shown in 2.
Gene in the present inventionPnPRlikeCode area be sequence table SEQ IDNO：Nucleosides in 1 shown in 97-813 Acid sequence.
The global cDNA segment of an antimycotic related gene for present invention separation clone Radix Notoginseng, passes through Agrobacterium tumefaciems (Agrobacterium tumefaciens) target gene is transferred to overexpression in recipient plant tobacco by mediation, and by into Whether the one step experimental verification gene has antimycotic activity, is resisted for the later-stage utilization improvement of genes tobacco and other plant The ability of fungal disease lays the foundation.This unnamed gene is by inventorPnPRlike。
The present invention relates to separation to includePnPRlikeDNA fragmentation and identify its function.Wherein described DNA fragmentation such as sequence Shown in table, the sequence of the gene is analyzed, is shownPnPRlikeFull-length cDNA is 976bp, includes the opening of a 717bp Reading frame, 5 '-non-translational region (untranslated region, UTR) of 96bp and the 3 '-UTR of 163bp, wherein ORF codings One protein with 238 amino acid.BLASTp analysis showsPnPRlikeCoded protein sequence and carrot （Daucus carota）Class PR gene（XP_017223871.1）, morning glory（Ipomoea nil）Class disease Journey related protein gene（XP_019190454.1）, walnut（Juglans regia）Class PR gene（XP_ 018849219.1）And plum blossom（Prunus mume）Class PR gene（XP_008237645.1）Homology compared with Height, respectively 76%, 68%, 69% and 67%, this shows that it belongs to the class pathogenesis-related proteins in Radix Notoginseng.Overexpress sequence table SEQ ID NO：Sequence shown in 1 can enhance tobacco to Fusarium solani (Fusarium solani), grape seat chamber bacterium (Botryosphaeria dothidea) and rice Tuber Melanosporum (Nigrospora oryzae) resistance.
The present invention is by Radix Notoginseng class PR genePnPRlikeIt applies and is improving resistance of the tobacco to disease fungus In, concrete operations are as follows：
（1）Using the total serum IgE of guanidine isothiocyanate method extraction Panax notoginseng root, using the RNA of extraction as template, it is with oligo (dT) 18 Reverse transcription primer passes through reverse transcriptase chain reaction (reverse transcription-polymerase chain Reaction, RT-PCR) it amplifiesPnPRlikeCode area is subsequently attached on pGEM-T carriers, is had through sequencing The clone of purposeful gene；
（2）Use restriction enzymeBamHI andEcoRI digestions pGEM-T-PnPR like, recycle to obtain target gene by glue Segment, with same endonuclease digestion plant expression vector pCAMBIA2300s, carrier large fragment needed for glue recycling acquisition, then will It is obtainedPnPRlikeGenetic fragment is connect with pCAMBIA2300s segments, builds plant overexpression vector, later by constructed by Recombinant vector expressed by Agrobacterium tumefaciens mediated be transferred in tobacco；
（3）Transformant is screened, and pass through PCR and RT-PCR and detect to obtain with the resistance marker having on recombinant vector T-DNA Real transfer-gen plant, the inhibitory activity that analysis genetically modified plants albumen grows fungi, finally filters out to fungus resistant The transfer-gen plant being remarkably reinforced.
The present invention provides a kind of new method to improve the resistance of plant against fungal disease, is trained by genetic engineering means Traditional breeding method can be overcome the shortcomings of by educating disease-resistant plants, and not only breeding cycle shortens, but also easy to operate, is easy to get highly resistance material Material.From Radix Notoginseng in the present inventionPnPRlikeGene can enhance resistance of the plant to several disease fungus, by the channel genes In tobacco, new varieties and new material with fungus resistant can be generated.Resistance plant kind is cultivated using technique for gene engineering There is apparent advantage and the importance do not replaced with material.It can be not only large-scale production crop, flowers, medicinal material etc. It is convenient to provide, and reduces the use of chemical pesticide, can also be that agricultural production is cost-effective, reduces environmental pollution, therefore the present invention Have a vast market application prospect.
Description of the drawings
Fig. 1 is part in the present inventionPnPR likeThe PCR testing results of transgene tobacco genomic DNA, wherein Marker For DL2000 DNA Marker (Dalian precious biology), by 2,000 bp, 1,000 bp, 750 bp, 500 bp, 250 bp and 100 DNA fragmentations of bp six form；Positive control is plasmid pGEM-T-PnPRlikePCR for template reacts；WT turns base to be non- Because tobacco (wild type, wild type) total DNA is the PCR that template carries out；
Fig. 2 is some positive in the present inventionPnPRlikeIn transgene tobaccoPnPRlikeThe expression analysis result of transcriptional level Figure, wherein Marker are DL2000 DNA Marker (the precious biology in Dalian)；WT is non-transgenic tobacco total serum IgE reverse transcription cDNA PCR product for template；Positive control：Plasmid pGEM-T-PnPRlikePCR product for template；
Fig. 3 is in the present inventionPnPRlikeTransgene tobacco inhibits the design sketch that fungi grows in vitro；Wherein in a, b, c diagram Fungi is Fusarium solani, grape seat chamber bacterium and rice Tuber Melanosporum respectively；WT is the total protein of wild-type tobacco；Buffer is sky White control, i.e., without protein control (for extracting the buffer solution of albumen).
Specific embodiment
Below by drawings and examples, the present invention is further described, but the scope of the present invention is not limited in described Hold, method operating according to a conventional method unless otherwise specified in the present embodiment, the use of agents useful for same unless otherwise specified is normal Rule reagent or the reagent being configured according to a conventional method.
Embodiment 1：PnPRlikeFull length cDNA clone and sequence analysis
3 years raw sangqi ginseng blade extraction total serum IgEs are taken, with liquid nitrogen then sanchi leaf slice lapping is transferred in centrifuge tube, adopted into powder Total serum IgE is extracted with guanidine isothiocyanate method, then uses reverse transcriptase M-MLV (promega) using total serum IgE as templated synthesis cDNA First chain, reaction system and operating process are：5 μ g Total RNA are taken, sequentially add 50 ng oligo（dT）, 2 μ L dNTP（2.5 mM each）, DEPC water to reaction volume be 14.5 μ L；After mixing, exist rapidly after 70 DEG C of 5 min of heat denatured Then 5 min of cooled on ice sequentially adds 4 μ L 5 × First-stand buffer, 0.5 μ L RNasin（200 U）、1 μ L M-MLV（200 U）, mixing simultaneously centrifuges in short-term, 42 DEG C of 1.5 h of warm bath, and 70 DEG C of 10 min of heating, terminate reaction after taking-up. The synthesis of the first chains of cDNA is placed on -20 DEG C and saves backup.
Using the first chain cDNA of synthesis as template, amplifying target genesPnPRlike, upstream and downstream primer sequence difference used For 5 ' CCAAATAACAATACTCTCCACAC3 ' and 5 ' TTAAAGTTTGAGTTTGTTTTACATT3 '.Using AdvantageTM 2 PCR Enzyme（Clontech）Amplify target gene；PCR reaction conditions：95℃ 1 min；94 DEG C of 30 s, 53 DEG C 30 S, 72 DEG C of 1 min, 30 cycles；72℃ 5 min；Reaction system（10 μL）For 1 μ L cDNA, 1 μ L 10 × Advantage 2 PCR Buffer、0.5 μL 50×dNTP Mix （10 mM each）, 0.2 μ L forward primers（10 μ M）, 0.2 μ L reverse primers（10 μM）、0.2 μL Advantage 2 PCR Polymerase Mix、6.9 μL PCR- Grade water；After PCR, 5 μ L are taken for agarose gel electrophoresis, to detect the specificity of amplified production and big It is small.
Acquired PCR product only has a DNA band, directly carries out TA clones to PCR product, and the kit used is pGEM-T vector（Promega）, reaction system and operating process are：1.5 μ L PCR products are taken, sequentially add 1 μ L pGEM-T vector（50 ng/μL）With 2.5 μ L 2 × Ligation solution, mixing is placed on 16 DEG C of reaction overnights. Connection product is transferred in bacillus coli DH 5 alpha using heat-shock transformed method.Using containing ampicillin（Ampicillin, Amp） LB solid medium screening positive clones, select several single bacterium colonies, shake after bacterium with amplificationPnPRlikeSpecial primer mirror Make multiple cloning sites insertionPnPRlikeClone, and the positive is sequenced.Finally obtainPnPRlikeFull-length cDNA For 976bp, pass through NCBI ORF finder（http://www.ncbi.nlm.nih.gov/gorf/gorf.html）Analysis It was found that the opening code-reading frame it includes a 717bp（See sequence table）,PnPRlikeOne albumen containing 238 amino acid of coding Matter,PnPRlikeIts protein is about 26.64 kD, and isoelectric point (pI) is about 5.69, and it is acid egg to show the albumen In vain.Including 32 acidic amino acids（D, E）, 32 basic amino acids（K、R、H）.
Embodiment 2：Plant overexpression vector is built
Using a small amount of extraction agent boxes of SanPrep pillar Plasmid DNA（Give birth to work in Shanghai）Extraction is inserted intoPnPRlikeEscherichia coli Plasmid pGEM-T-PnPRlikeAnd the plasmid of plant expression vector pCAMBIA2300s, 1 μ L are taken for Ago-Gel electricity The integrality and concentration level of swimming extraction plasmid to detect；Use restriction enzymeBamHI（TaKaRa）WithEcoRI （TaKaRa）Respectively to plasmid pGEM-T-PnPRlikeDouble digestion is carried out with pCAMBIA2300s（100 μ L systems）, reactant System and operating process are：Take 20 μ L pGEM-T-PnPRlikeWith pCAMBIA2300s plasmids, sequentially add 10 10 × K of μ L buffer、4 μL BamHI、6 μL EcoRI、60 μL ddH2O centrifuges after mixing, is placed in 37 DEG C of reaction overnights in short-term；By institute There is digestion products point to carry out electrophoresis in Ago-Gel, it is then rightPnPRlikeSegment and pCAMBIA2300s carrier large fragments Glue recycling is carried out respectively；1 μ L recovery products is taken to detect the size and concentration of recycling segment by agarose gel electrophoresis, are put It is saved backup in -20 DEG C.
Utilize T4 DNA Ligase（TaKaRa）, by recyclingPnPRlike DNA fragmentation and pCAMBIA2300s carriers Segment connects, reaction system（20 μL）It is with operating process：Take 10 μ LPnPRlike DNA fragmentation sequentially adds 2 μ L PCAMBIA2300s carrier DNAs, 2 μ L 10 × T4 DNA Ligase Buffer, 1 μ L T4 DNA Ligase, 5 μ L ddH2O is centrifuged after mixing, then 16 DEG C of water-bath reaction overnights in short-term.Then connection product is transferred to greatly using heat-shock transformed method In enterobacteria DH5 α, with containing 50 mg/L kanamycins（Kanamycin, Km）Solid medium screening positive clone.It selects Single bacterium colony shakes bacterium, is expanded by template of bacterium solutionPnPRlikeSpecial primer carry out PCR, pick outPnPRlikeWith The clone that pCAMBIA2300s is successfully connected, the bacterial strain detected are placed in -80 DEG C and save backup if the positive, addition glycerine.
It extracts and purifies the pCAMBIA2300s- in above-mentioned Escherichia coliPnPRlikePlasmid.Then use frozen-thawed method By the plant expression vector pCAMBIA2300s- of above-mentioned structurePnPRlikeIt is transferred to agrobacterium tumefaciens lba4404 competent cell In.Operating procedure is：Take 1 μ g pCAMBIA2300s-PnPRlikePlasmid adds in the centrifugation containing 200 μ L competent cells Guan Zhong, gently 5 min of ice bath after mixing, then continues in liquid nitrogen and freezes 1 min, is then immediately placed in 37 DEG C of 5 min of water-bath, it 2 min of ice bath, 800 μ L LB Liquid Cultures of addition are based on 28 DEG C of 4 h of shaken cultivation immediately afterwards.Agrobacterium after activation is applied to On LB solid mediums containing 50 mg/L Km, 28 DEG C of static gas wave refrigerators.Picking individual colonies shake bacterium, then with amplificationPnPRlike's Specific primer carries out PCR, detects pCAMBIA2300s-PnPRlikeWhether it is transferred in Agrobacterium, for positive colony, adds in Glycerine is placed on -80 DEG C and saves backup.
Embodiment 3：Agriculture bacillus mediated Genetic Transformation in Higher Plants and genetically modified plants screening
The transgene receptor of this experiment is tobacco, tobacco seed is impregnated 30s with 75% alcohol, with being used after sterile water washing 0.1% HgCl2Impregnate 8 min, then again with sterile water washing several times, be seeded on 1/2 MS culture mediums, 28 DEG C of light cultures 6d goes to illumination box after germination（25 DEG C, 16h/d illumination）, it is later monthly primary with 1/2MS culture medium subcultures.
That preservation is taken out from -80 DEG C of refrigerators contains pCAMBIA2300s-PnPRlikeThe Agrobacterium LBA4404 bacterium of plasmid Kind, it is inoculated in the LB fluid nutrient mediums that 5 mL contain 50 mg/L Km and 20 mg/L rifampins, 28 DEG C of cultures are muddy to culture medium It is turbid.It draws on bacterium solution to the LB solid mediums containing 50mg/L Km of 1mL muddinesses, 28 DEG C of 48 h of culture；Then by LB solids Agrobacterium on culture medium scrapes to be inoculated in the MGL fluid nutrient mediums for the acetosyringone for being attached with 20 mg/L in right amount, 28 DEG C Shaken cultivation 2-3 h are to activate Agrobacterium.
Tobacco aseptic seedling leaf is taken to be cut into 1 cm2The leaf dish of left and right is completely soaked in the above-mentioned MGL containing activation Agrobacterium In fluid nutrient medium, immerged time is 15 min, and the bacterium solution of blade surface is blotted with aseptic filter paper, leaf dish is placed in co-cultivation base Upper carry out incubated at room temperature, the co-cultivation base of Transformation of tobacco is MS+0.02 mg/L 6-BA+2.1 mg/L NAA+30 g/L Sucrose+6 g/L agar is co-cultured 2 days under 22 DEG C of no light conditions.
Leaf dish after co-cultivation is gone into seedling differentiation in the MS screening and culturing mediums added with antibiotic, while screening transgenic Plant.Tobacco screening and culturing medium for MS+0.5 mg/L 6-BA+0.1 mg/L NAA+30 g/L sucrose+6 g/L agar+ 50 mg/L Km+200 mg/L cephalosporins（Cefotaxime sodium salt, Cef）；Culture bottle is turned during screening and culturing Move to illumination box culture（25 DEG C, 16h/d illumination, 8h/d dark）, use after tobacco length budding containing 50 mg/L Km and The MS culture medium squamous subcultures of 200 mg/L Cef.Tobacco regrowth, which is moved on the MS culture mediums containing 50 mg/L Km, makes it It takes root, finally selection is taken root, and preferable regrowth is further to be detected.
Using the genomic DNA of CTAB methods extraction transgenic tobacco plant blade, 1 μ L is taken to lead to the genomic DNA of extraction It crosses agarose gel electrophoresis and detects its integrality and concentration, expanded by template of the genomic DNA of transfer-gen plantPnPRlikeSpecial primer carry out PCR, after PCR, take 8 μ L products for agarose gel electrophoresis to detect positive turn Gene plant, the amplification of Partial Tobacco transfer-gen plant as shown in Figure 1,PnPRlikeTransgene tobacco screens 50 plants altogether Positive transgenic plant.
Embodiment 4：In transgene tobaccoPnPRlikeExpression analysis and transfer-gen plant antifungal activity analysis
Take positive transgenic single plant and non-transgenic tobacco（Wild type）Tender leaf extraction total serum IgE, reverse transcription generation cDNA the One chain, and expanded as templatePnPRlikeSpecial primer carry out PCR, according to each transgenosis single plant of PCR interpretations of result InPnPRlikeThe method of the expression of transcriptional level, Total RNAs extraction and RT-PCR are in the same manner as in Example 1, and PCR terminates it Afterwards, taking 5 μ L, the testing result of part single plant as shown in Fig. 2, detect 42 transgenosis lists altogether for agarose gel electrophoresis In strainPnPRlikeIn transcriptional level great expression, the number of these single plants is 1~41.
Several fungies that laboratory preserves are inoculated in PDA solid mediums（200 g/L potatos, 15 g/L agar, 20 G/L glucose）On, 28 DEG C of light cultures grow to when bacterium colony and albumen are added when diameter is about 2 ~ 3cm, analyze transfer-gen plant body Outer antifungal activity.The albumen that other living contaminants are extracted in order to prevent, entire vegetable protein extraction process are sterile behaviour Make, take 1 g transgene tobacco single plants first（Number is respectively 1,2,4）And wild-type leaves are put into mortar, add in 1mL albumen Extracting solution（1M NaCl, 0.1M sodium acetates, 1% PVP, pH6）, it is fully ground；It is transferred in 1.5 mL centrifuge tubes, 4 DEG C after mixing It stands overnight, 4 DEG C of 30 min of centrifugation（12,000 g/min）, supernatant is taken in 1.5 new mL centrifuge tubes, and is taken appropriate with purple Outer spectrophotometric determination total protein concentration.The total protein concentration of transgenosis and WT lines is adjusted to 1 μ g/ μ L, then 20 μ L drops are taken respectively on the aseptic filter paper of each fungi culture medium, in addition to adding different transgenosis on the tablet of each fungi The total protein of tobacco plant, while the total protein of parallel addition wild-type tobacco and blank control（It extracts used in albumen buffer）, the situation of each processing fungi growth is after a few days observed in 28 DEG C of cultures, and is evaluated accordinglyPnPRlikeTransgene tobacco Extracorporeal antifungal activity, the results are shown in Figure 3,PnPRlikeTransgene tobacco albumen to Fusarium solani, grape seat chamber bacterium, The growth of rice Tuber Melanosporum has very strong inhibiting effect.
Sequence table
<110>Kunming University of Science and Technology
<120>Radix Notoginseng class PR gene PnPRlike and application
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 976
<212> DNA
<213>Radix Notoginseng (Panax notoginseng)
<400> 1
cgtctgttag gtcacatttt tggttatata tatgatccct taaagggtat ttgtacatac 60
caaataacaa tactctccac acattgtctc acaaacatgg catctacagg atctaaggta 120
gaaaaataca ggtctttatt aggcgcagaa gatgtcaaag acgttcaatg gaggtttggt 180
gctcctccta actttgatgt tgtaaataag cttttcgaag aaggccgaac taagatatgg 240
cctgcaggtt cacttgaaga aaaagtgcag aaccttgtga aaacatggga aatggaaata 300
ttccacaaaa ctcgattaga agacttcaaa acacttgatc ccaagaagtt tactctaagc 360
cttaatggaa ggaaaggtgc gacaatggaa gaaataggaa agcttggtgg aggatacaat 420
gctatgctgc aaaccaaatt gccagaaaat tatcagtgct acaatccgac cgaggaatca 480
gctgattcgt cccatatcgt tttcaccaca gcgtttcccc gtggatttgc cctggaaatt 540
ctccaggttt attcagggcc accggtgatt gtgtacaagt ttaggcactg gggttatatg 600
gaaggccctt ttaaagggca tgctcctact ggagaaatga cagagtttta tgggattgcc 660
atttttgcgt tggatgaaga ttcgaagatt gtcaaggtgg agttctttta tgatagggga 720
gaacttctcg gaggtcttat gaagggtgga actactgata attctacaag tgaaatgtct 780
acaggctgcc ctgttttgaa aagcacagga tagctttgtc aagacattta ttagcattta 840
tcaagttcag tgttggataa atgtaaaaca aactcaaact ttaaactaat aattgcatct 900
aaataattcg gaattttttc tgttcagctg ttattgaaag tataaaaaaa aaaaaaaaaa 960
aaaaaaaaaa aaaaaa 976
<210> 2
<211> 238
<212> PRT
<213>Radix Notoginseng (Panax notoginseng)
<400> 2
Met Ala Ser Thr Gly Ser Lys Val Glu Lys Tyr Arg Ser Leu Leu Gly
1 5 10 15
Ala Glu Asp Val Lys Asp Val Gln Trp Arg Phe Gly Ala Pro Pro Asn
20 25 30
Phe Asp Val Val Asn Lys Leu Phe Glu Glu Gly Arg Thr Lys Ile Trp
35 40 45
Pro Ala Gly Ser Leu Glu Glu Lys Val Gln Asn Leu Val Lys Thr Trp
50 55 60
Glu Met Glu Ile Phe His Lys Thr Arg Leu Glu Asp Phe Lys Thr Leu
65 70 75 80
Asp Pro Lys Lys Phe Thr Leu Ser Leu Asn Gly Arg Lys Gly Ala Thr
85 90 95
Met Glu Glu Ile Gly Lys Leu Gly Gly Gly Tyr Asn Ala Met Leu Gln
100 105 110
Thr Lys Leu Pro Glu Asn Tyr Gln Cys Tyr Asn Pro Thr Glu Glu Ser
115 120 125
Ala Asp Ser Ser His Ile Val Phe Thr Thr Ala Phe Pro Arg Gly Phe
130 135 140
Ala Leu Glu Ile Leu Gln Val Tyr Ser Gly Pro Pro Val Ile Val Tyr
145 150 155 160
Lys Phe Arg His Trp Gly Tyr Met Glu Gly Pro Phe Lys Gly His Ala
165 170 175
Pro Thr Gly Glu Met Thr Glu Phe Tyr Gly Ile Ala Ile Phe Ala Leu
180 185 190
Asp Glu Asp Ser Lys Ile Val Lys Val Glu Phe Phe Tyr Asp Arg Gly
195 200 205
Glu Leu Leu Gly Gly Leu Met Lys Gly Gly Thr Thr Asp Asn Ser Thr
210 215 220
Ser Glu Met Ser Thr Gly Cys Pro Val Leu Lys Ser Thr Gly
225 230 235
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence (Artificial)
<400> 3
ccaaataaca atactctcca cac 23
<210> 4
<211> 25
<212> DNA
<213>Artificial sequence (Artificial)
<400> 4
ttaaagtttg agtttgtttt acatt 25

Claims (2)

1. a kind of Radix Notoginseng class PR genePnPRlike, it is characterised in that：Nucleotide sequence such as SEQ ID NO：1 institute Show, coding such as SEQ ID NO：The protein of amino acid sequence shown in 2.
2. Radix Notoginseng class PR gene described in claim 1PnPRlikeTobacco is being improved to Fusarium solani (Fusarium solani), grape seat chamber bacterium (Botryosphaeria dothidea), rice Tuber Melanosporum (Nigrospora oryzae) application in resistance.
CN201810000431.6A 2018-01-02 2018-01-02 Notoginseng disease course related protein genePnPRlikeAnd applications Active CN108251432B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810000431.6A CN108251432B (en) 2018-01-02 2018-01-02 Notoginseng disease course related protein genePnPRlikeAnd applications

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810000431.6A CN108251432B (en) 2018-01-02 2018-01-02 Notoginseng disease course related protein genePnPRlikeAnd applications

Publications (2)

Publication Number Publication Date
CN108251432A true CN108251432A (en) 2018-07-06
CN108251432B CN108251432B (en) 2021-01-05

Family

ID=62725880

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810000431.6A Active CN108251432B (en) 2018-01-02 2018-01-02 Notoginseng disease course related protein genePnPRlikeAnd applications

Country Status (1)

Country Link
CN (1) CN108251432B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109234284A (en) * 2018-09-14 2019-01-18 昆明理工大学 A kind of Radix Notoginseng class sweet protein gene PnTLP5 and application
CN109295068A (en) * 2018-09-14 2019-02-01 昆明理工大学 A kind of Radix Notoginseng class sweet protein gene PnTLP2 and application
CN112521443A (en) * 2021-01-13 2021-03-19 昆明理工大学 Preparation method and application of pseudo-ginseng flower protein
CN116103315A (en) * 2023-02-07 2023-05-12 云南农业大学 Pseudo-ginseng disease course protein gene PnPR4 and application thereof
CN116606361A (en) * 2023-04-25 2023-08-18 华中农业大学 LjPRP1 protein for regulating and controlling nitrogen fixation efficiency of plant root nodule and/or regulating and controlling plant yield and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101701038A (en) * 2009-10-29 2010-05-05 中国农业科学院作物科学研究所 Plant low temperature growth associated protein, code genes and application thereof
CN103224555A (en) * 2013-05-27 2013-07-31 中国农业科学院棉花研究所 Plant-development-related protein GhSOC1, and coding gene and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101701038A (en) * 2009-10-29 2010-05-05 中国农业科学院作物科学研究所 Plant low temperature growth associated protein, code genes and application thereof
CN103224555A (en) * 2013-05-27 2013-07-31 中国农业科学院棉花研究所 Plant-development-related protein GhSOC1, and coding gene and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
杨丹等: "三七病程相关蛋白PR10-2 基因的克隆、表达及功能初步分析", 《中国中药杂志》 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109234284A (en) * 2018-09-14 2019-01-18 昆明理工大学 A kind of Radix Notoginseng class sweet protein gene PnTLP5 and application
CN109295068A (en) * 2018-09-14 2019-02-01 昆明理工大学 A kind of Radix Notoginseng class sweet protein gene PnTLP2 and application
CN109234284B (en) * 2018-09-14 2021-04-09 昆明理工大学 Pseudo-ginseng sweet protein gene PnTLP5 and application
CN109295068B (en) * 2018-09-14 2021-04-09 昆明理工大学 Pseudo-ginseng sweet protein gene PnTLP2 and application
CN112521443A (en) * 2021-01-13 2021-03-19 昆明理工大学 Preparation method and application of pseudo-ginseng flower protein
CN112521443B (en) * 2021-01-13 2024-03-26 昆明理工大学 Preparation method and application of pseudo-ginseng flower protein
CN116103315A (en) * 2023-02-07 2023-05-12 云南农业大学 Pseudo-ginseng disease course protein gene PnPR4 and application thereof
CN116606361A (en) * 2023-04-25 2023-08-18 华中农业大学 LjPRP1 protein for regulating and controlling nitrogen fixation efficiency of plant root nodule and/or regulating and controlling plant yield and application thereof
CN116606361B (en) * 2023-04-25 2024-04-23 华中农业大学 LjPRP1 protein for regulating nitrogen fixation efficiency of plant root nodule and/or regulating plant yield and application thereof

Also Published As

Publication number Publication date
CN108251432B (en) 2021-01-05

Similar Documents

Publication Publication Date Title
CN108251432A (en) Radix Notoginseng class PR gene PnPRlike and application
CN105441460B (en) A kind of Ming River lily WRKY transcription factor genes LrWRKY1 and application
CN105861517B (en) A kind of Radix Notoginseng antibacterial peptide gene PnSN1 and its application
CN111235165B (en) Lily susceptible fungal gene LrWRKY-S1 and application thereof
CN112831505B (en) Pseudo-ginseng WRKY transcription factor gene PnWRKY15 and application thereof
CN106244599B (en) A kind of 1 family gene PnPR1-2 of Radix Notoginseng pathogenesis-related proteins and application
CN110734482A (en) Lilium regale WRKY transcription factor gene LrWRKY4 and application thereof
CN107267526B (en) Radix Notoginseng myb transcription factor gene PnMYB2 and its application
CN104878028B (en) Yangbi bulla walnut chitinase gene JsCHI1 and application
CN104878019B (en) Yangbi bulla walnut class sprouts fibroin gene JsGLP1 and application
CN106244598B (en) Radix Notoginseng Dirigent albuminoid gene PnDIR1 and application
CN117286150A (en) Notoginseng disease course related protein 1 gene PnPR1-3 and its application
CN104878041B (en) Yangbi bulla walnut transcription factor gene JsWRKY1 application
CN103320448B (en) Lilium regle bZIP transcription factor LrbZIP1 and application
CN107904238B (en) Thick boisiana is with high salt, drought-inducible promoter IpLEA-PRO and its application
CN107365794B (en) Application of panax notoginseng chitinase gene PnCHI1
CN107267525B (en) Application of panax notoginseng polygalacturonase inhibitor protein gene PnPGIP
CN111304220B (en) Cymbidium CgWRKY3 gene and application thereof
AU758346B2 (en) Nucleic acid comprising the sequence of a promoter inductible by stress and a gene sequence coding for stilbene synthase
CN109295068B (en) Pseudo-ginseng sweet protein gene PnTLP2 and application
CN107988222B (en) Thick boisiana is with high salt, dehydration inducible promoter IpDHN-PRO and its application
CN106480038B (en) It is a kind of by the specific inducible promoter DNA sequence dna of Salt treatment and application
CN112391406A (en) Method for promoting growth of strawberries and biological material used by same
CN104774847A (en) Julans sigillata Dode proline-enriched protein gene JsPRP1 and applications thereof
CN113980986B (en) Application of CRK22 gene and encoding protein thereof in potato stress-resistant breeding

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant