CN107988222B - Thick boisiana is with high salt, dehydration inducible promoter IpDHN-PRO and its application - Google Patents
Thick boisiana is with high salt, dehydration inducible promoter IpDHN-PRO and its application Download PDFInfo
- Publication number
- CN107988222B CN107988222B CN201711192142.2A CN201711192142A CN107988222B CN 107988222 B CN107988222 B CN 107988222B CN 201711192142 A CN201711192142 A CN 201711192142A CN 107988222 B CN107988222 B CN 107988222B
- Authority
- CN
- China
- Prior art keywords
- high salt
- gene
- promoter
- plant
- ipdhn
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of promoters (being abbreviated as IpDHN-PRO) of thick boisiana dehydrin protein Dehydrin gene, with nucleotide sequence shown in SEQ ID No.1.The present invention provides through the expressions of results of detection GUS to prove, the polynucleotides have the activity of promoter, and enhanced by with high salt and drought stress induced activity, this show the effects that the thick boisiana dehydrin protein Dehydrin gene responds with high salt/dehydration adverse circumstance in thick boisiana.The present invention is further to study the expression of resistant gene of salt related to applied to thick boisiana is regulated and controled, and the salt tolerance of raising and improvement thick boisiana and other plant is expressed salt/relevant target protein of drought stress using plant as bioreactor and provides theoretical basis.
Description
Technical field
The invention belongs to plant genetic engineering fields, and in particular to a thick boisiana is with high salt, dehydration and ABA inducible promoter
And its application.
Background technique
It is with high salt and it is arid be the most common environment stress in growing process, it will usually cause plant dehydration, cause thin
Water balance intracellular is unbalance, and then influences the growth and development of plant.For crops, due to agriculture caused by with high salt and arid
Plant growth is bad, in turn results in crop production reduction and quality decline is the FAQs in agricultural production process.Therefore, it cultivates
It is the effective way for guaranteeing stable crop yield high yield with the anti-adversity for promoting with high salt/Drought Stress.Utilize the degeneration-resistant of plant itself
Gene can cultivate degeneration-resistant new varieties by conventional cross-breeding and molecular mark method, however, traditional breeding
Method would generally have certain limitation, and the genetic improvement technology based on transgenic technology then can be by directly drawing
Enter external source functional gene, and break through species limitation, opens up a new approach for crop breeding for stress tolerance.
Currently, plant transgenic technology, which mainly passes through, targetedly introduces foreign gene, certain characteristic of plant is improved,
The genetic improvement plant of human demand can more preferably be met with its acquisition.In common transgenic technology, the spy of introduced plant is needed
The expression for determining functional gene is generated under constitutive promoter driving.The constitutive expression of this gene is to plant
Growth exert a certain influence.For the growth retardation phenomenon for overcoming genetically modified plants to occur, people start with induction
Type promoter or tissue-specific promoter replace constitutive promoter.Promoter (promoter) is to be located at structural gene
One section of noncoding DNA sequence of the end 5'- upstream can be identified by RNA polymerase, be combined, and accurately control transcription (gene table
Up to) initial time and expression intensity, be the center of gene transcription regulation.The expression of gene and the close phase of the structure of promoter
It closes, the type of cis-acting elements determines allelic expression in gene promoter.When special suitable containing certain in promoter
When formula functional element, the expression of the gene may be influenced by associated factor.Promoter is according to its function and effect side
Formula is roughly divided into constitutive promoter, tissue-specific promoter and inducible promoter three types.Constitutive promoter tune
Control gene expression is not influenced by external environmental condition, high can almost express in the different tissues of all plants, typically have
Cauliflower mosaic virus CaMV (cauliflower mosaic virus) 35S promoter, maize ubiquitin Ubiquitin promoter
With rice actin Actin promoter.Such promoter activity is high, but since it causes foreign gene in genetically modified plants
The long-term overexpression of all sites of entire growth period affects the growth and development and normal physiological metabolism of plant, some
Toxic action may be generated, is unfavorable for quality and yield raising, results even in Plant death.Currently, being directed to organizing specific
The developmental research of type promoter and inducible promoter is also among continuous carry out.
Thick boisiana (Ipomoea pes-caprae L.) is the perennial sprawling herbs plant that crawls of Convolvulaceae Ipomoea, complete
The sand beach of world's tropical and subtropical zone or island area have widely distributed.Thick boisiana resistance is extremely strong, and salt tolerant and drought resistance
It is especially pronounced.It can be seen that thick boisiana can be used as the research pair of a kind of research plant stress-resistance molecule mechanism, the degeneration-resistant genetic resources of excavation
As being furtherd investigate.
Dehydrins (dehydrin) belong to late embryo occur Abundant protein II family protein (Late EmbryogensisAII family of bundant proteins II, LEA-), it can be a large amount of under Embryos Development of Plant later period and dehydration environment stress
Expression, is widely present in plant kingdom.Plant dehydration element has extensive biological function, the table of the dehydrin gene of many plants
Up to all being influenced by Water deficits such as with high salt/arids, and the expression by improving dehydrin gene improve plant to it is with high salt/
The resistance of drought stress.This phenomenon that being improved gene expression amount by environment stress referred to as gene inducing expression, by
The starting subcharacter decision of gene, in the present invention, the Dehydrins IpDHN gene promoter of our prepared and announcement thick boisianas
It is a kind of with high salt, drought-inducible promoter, has in for high salt, the relevant environment stress of arid genetic improvement important
Application potential.
Summary of the invention
With high salt with plant, desiccation stress induction type promoter that the purpose of the present invention is to provide a kind of.
Another object of the present invention is to provide the promoters, in prepare transgenosis plant and are directed to raising plant to height
The application in the negative effect of foreign gene overexpression is reduced when salt and dehydration resistance.
Realize that the technical solution of above-mentioned purpose is as follows.
A kind of with high salt, dehydration inducible promoter DNA, the promoter DNA are to contain core shown in SEQ ID No.1
Nucleotide sequence；Or for containing have one or several nucleotide in sequence shown in SEQ ID No.1 and sequence replacement, missing or
Increase, but nucleotide sequence with the same function；Or the nucleotide sequence to be matched with SEQ ID NO.1 complete complementary；Or
To pass through the nucleotides sequence that chromosome walking clonal expansion obtains by SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4
Column.
The present invention also provides above-mentioned preparation methods with high salt, dehydration inducible promoter DNA sequence, with wild thick boisiana
Genomic DNA is template, is obtained by SEQ ID No.2, SEQ ID No.3 by chromosome walking clonal expansion.
The present invention also provides a kind of plant expression vectors, contain above-mentioned with high salt, dehydration inducible promoter DNA.
Preferably, the plant expression vector lures to connect with high salt, dehydration described in claim 1 after BamHI digestion
The pBI101.2 carrier of conductivity type promoter DNA sequence.
The present invention also provides above-mentioned with high salt, dehydration inducible promoter DNA sequence or above-mentioned plant expression vectors
Application in regulation gene expression in plants.
The present invention also provides above-mentioned with high salt, dehydration inducible promoter DNA sequence or above-mentioned plant expression vectors
Application in plant transgene breeding with high salt, desiccation stress.
Preferably, the plant is arabidopsis or crops.
A kind of method the present invention also provides raising arabidopsis or crops to dehydration adverse circumstance adaptability with high salt, the party
Method includes being transformed into arabidopsis by above-mentioned with high salt, dehydration inducible promoter DNA sequence, or by above-mentioned plant expression vector
Or in crops.
Preferably, by GV3101 agrobacterium mediation converted arabidopsis or crops, arabidopsis or crops are obtained
Transgenic seed.
The invention discloses the with high salt/dehydration inducible genes thick boisiana Dehydrins IpDHN gene promoter IpDHN-PRO of one kind
Preparation method and its application in plant genetic engineering, find its in addition to containing core promoter element TATA-BOX it
Outside, also contain the cis-acting elements of multiple response environment stresses, including abscisic acid response element ABRE, drought-induced and stress
Relevant Myb factor binding site MBS, and the relevant repetition motif TC-rich repeat rich in TC of stress.In addition, should
Endosperm is also found in promoter sequence and expresses required cis-acting elements Skn-1_Motif.These cis-acting elements
Identification further implys that the biological function of the promoter.In present disclosure, the promoter is in thick boisiana and intends
In southern mustard can inducing expression with controlling gene by with high salt/desiccation stress, which can be applied to for high salt/dehydration
The plant transgene breeding of stress, for culture and improvement it is with high salt/genetically modified plants of dehydration anti-adversity ability, while reducing normal training
The expression of foreign gene under the conditions of supporting, to reduce foreign gene to the negative effect of growth of transgenic plants and development.
The advantages of the present invention are as follows:
Promoter of the invention is with high salt and desiccation stress inducible promoter, can be used for changing in plant genetic engineering and plant
Object is to high salt and dehydration response mode and adjusts foreign gene expression way under normal growing conditions in genetically modified plants, gram
It has taken common using composition type expression promoter (such as 35S promoter, maize ubiquitin promoter, rice actin promoters
Deng) negative effect in transgenosis work is carried out, improve that Plant Tolerance is with high salt and/or what desiccation stress required turns to obtain to meet
Gene plant new varieties.In particular, the IpDHN-PRO promoter fragment is in heterologous plant, such as arabidopsis, it may have
The feature that induction exogenous gene is expressed under the conditions of with high salt and desiccation stress, while reducing the table of foreign gene under regular culture conditions
It reaches, to reduce foreign gene to the negative effect of growth of transgenic plants and development.
Detailed description of the invention
Method of the Fig. 1 according to Genome Walking Kit, the promoter of electrophoresis detection thick boisiana Dehydrins IpDHN gene
The PCR fragment of IpDHN-PRO amplification.M shows DNA molecular amount standard, and No. 1 swimming lane shows first round nested PCR electrophoresis as a result, No. 2 swimming
Road shows the second wheel nested PCR electrophoresis result.
The promoter IpDHN-PRO sequential structure figure of Fig. 2 thick boisiana dehydrin gene.ATG shows the translation initiation of IpDHN gene
Codon, remaining special marking are different cis-acting elements.
Fig. 3 Real time RT-PCR detects thick boisiana Dehydrins IpDHN gene in the expression feelings of thick boisiana plant different parts
Condition.
Fig. 4 Real time RT-PCR detect thick boisiana Dehydrins IpDHN gene in thick boisiana body in expression by with high salt
With the induction of drought stress.
Fig. 5 thick boisiana promoter IpDHN-PRO is inserted into the physical map of plant transgene binary expression vector pBI101.2,
Carrier resistance screening gene containing kanamycin, promoter are fused to 5 ' end regions of gus gene.
Fig. 6 thick boisiana promoter IpDHN-PRO starts gus gene in transgenic arabidopsis and expresses schematic diagram.
Specific embodiment
It to facilitate the understanding of the present invention, below will be to invention is more fully described.The present invention can many differences
Form realize, however it is not limited to implementation example described herein.On the contrary, providing the purpose that these implement examples is to make pair
The understanding of the disclosure is more thorough and comprehensive.
In the following examples, the experimental methods for specific conditions are not specified, usually according to normal condition, such as Sambrook etc.
People, molecular cloning: institute in laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989)
The condition stated, or according to the normal condition proposed by manufacturer.Used various common chemical reagent, are commercially available in embodiment
Product.
Unless otherwise defined, all technical and scientific terms used in the present invention and belong to technical field of the invention
The normally understood meaning of technical staff it is identical.Term used in the description of the invention is intended merely to describe specific reality
The purpose for applying example is not used in the limitation present invention.Term "and/or" used in the present invention includes one or more relevant listed
Any and all combinations of project.
The method that the present invention passes through Genome Walking Kit (TaKaRa Code:D316) first, using slot type PCR
Technology, by carrying out PCR amplification (electrophoresis detection result is as shown in Figure 1) to thick boisiana genome, after PCR fragment recycling, connection
In on pGEM T (Promega Code:A 1360) carrier, sequencing analysis obtains the DNA sequence dna of one section of 974 base, this section of sequence
Position on thick boisiana genome abuts the upstream of the reading frame translation initiation codon ATG of thick boisiana dehydrin gene IpDHN, is
The promoter of thick boisiana dehydrin gene IpDHN, is named as IpDHN-PRO.
The nucleotide sequence of promoter of the present invention is as shown in SEQ.ID.NO1,974 bases of sequence.It is suitable according to plant
Formula controlling element database (PlantCARE, http://bioinformatics.psb.ugent.be/webtools/
Plantcare/html/ search), promoter region provided by the present invention remove containing TATABox necessary to promoter,
Except CAAT Box, also contain the cis-acting elements of multiple environment stresses induction, thus it is speculated that the gene is that the promoter is adverse circumstance
Stress induced promoter.
The present invention has detected the expression of IpDHN gene in thick boisiana plant, Realtime RT-PCR analysis knot for the first time
Fruit shows that under conditions of normal growth, IpDHN gene has wide expression, but its in thick boisiana different parts and developmental stage
For expression quantity for reference gene IpUBQ, expression quantity is lower.Under with high salt or drought stress treatment conditions, thick boisiana
The expression of IpDHN gene is induced, and is shown in thick boisiana body, and the promoter of IpDHN gene is a with high salt/desiccation stress
Promoter.
Later, using the DNA fragmentation of chromosome walking method PCR amplification IpDHN-PRO, In-Fusion technology is then used
(In-Fusion HD CloningKit, TaKaRa Code:PT5162-1), is inserted into plant transgene for the segment DNA sequence
On binary expression vector pBI101.2, by the transgenic method of mediated by agriculture bacillus, transgenosis work, detection are carried out to arabidopsis
IpDHN-PRO regulates and controls the expression of gus gene in heterologous plant arabidopsis, shows that the promoter can open in arabidopsis
Dynamic foreign gene gus gene expression.The processing of with high salt and drought stress is carried out to transgenic arabidopsis, is detected in the quasi- south of transgenosis
In mustard plant, the expression of gus gene is also induced, and shows the promoter fragment in heterologous plant arabidopsis, it may have
The feature that induction exogenous gene is expressed under the conditions of with high salt and desiccation stress.
SEQ ID NO.1
>IpDHN promoter(IpDHN-PRO)
GCAGTGGGGCTTCTTCTCCTTATACTCCACCCCATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAA
GCGGATGCCGGGAGCGGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC
GGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACC
GCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGC
CAGCTGGCGAAAGGGGGGTGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAA
AACGACGGCCAGTGCCAAGCTCTCGAGAAGCTTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCT
ATTGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACATCATCAA
AAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTGTCGTTCAAGATGCCT
CTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACAAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCT
TCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCCCCAAGC
TTGGGCCCAAGCTTGGGTCGCGCCCCACGGATGGTATAAGAATAAAGGCATTCCGCGTGCAGGATTCACCCGTTCGC
CTCTCACCTTTTCGCTGTACTCTCTCGCCACACACACCCCCTCTCCAGCTCCGTTGGAGCTCCGGACAGCAGCAGGC
GCGGGGCGGTCACGTAGTAAGCAGCTCTCGGCTCCCTCTCCCCTTGCTCCGTGGATCC
Invention technician should understand that the nucleotide sequence according to shown in SEQ ID No.1, it is replaced, lack or
Increase one or several nucleotide, obtain nucleotide sequence with the same function, for example, in non-response element or effect member
Part replaces one or several bases.Therefore, of the present invention further includes nucleotide sequence shown in SEQ ID No.1 through replacing
One or several nucleotide, and nucleotide sequence with the same function are changed, lack or increase, this segment DNA sequence can be energy
It is hard to bear to be induced to high salt and desiccation stress, enhance gene expression.
Embodiment 1: the Cloning and sequence analysis of the promoter IpDHN-PRO of thick boisiana Dehydrins IpDHN gene
Thick boisiana material used in the present invention is the thick boisiana seedling that this laboratory is sprouted, and seed collection is in (22 ° of Zhuhai seabeach
16′25.37″N,113°34′18.00″E).The full thick boisiana seed for taking 100 or so is impregnated 12 hours using 10% sulfuric acid,
It is cleaned 20 times with tap water later, thick boisiana seed (28 DEG C, daily 16 hours illumination/8 hour dark) is sprouted using vermiculite, about one
Grow up to seedling after a month.The small seedling leaf 0.1g of the thick boisiana of healthy growth is taken, is put into mortar and liquid nitrogen grinding is added to powder, use
The plant genome DNA extracts kit One-Tube Plant DNAOUT (goods of Beijing day bounties Gene Tech. Company Limited
Number: 60705) extract the genomic DNA of thick boisiana blade.Thick boisiana is detected using electrophoresis detection and with the method for ultraviolet specrophotometer
The purity and concentration of genomic DNA, and use ddH2O adjusts the concentration of DNA to 100ng/ μ L.
Design two specific primer SP1:5 '-TCCTTATACTCCACCCCATG-3 ' (SEQ ID NO.2) and SP2:
5′-GCAGTGGGGCTTCTTCTCCT-3′(SEQ ID NO.3)。
Using above-mentioned thick boisiana genomic DNA as template, with SP1, SP2 homologue step move the 1st, 2 wheel random primers into
Row chromosome walking cloned promoter.After two-wheeled PCR, is detected, selected bright with 1% agarose gel electrophoresis
Band PCR product (as shown in Figure 1) carries out agarose according to Magen company HiPure Gel Pure DNA Kits specification
Gel electrophoresis recycling, and be connected in the pGEM carrier T of Promega company.Method to specifications converts reaction product
E. coli jm109 competence bacterial strain.Picking monoclonal extracts plasmid, send biotech firm to be sequenced, and save correct plasmid
(being named as IpDHN-PRO-pGEMT) is spare.The thick boisiana dehydrin gene promoter IpDHN-PRO overall length that sequencing display is cloned into
Sequence is 974 bases, is labeled as SEQ ID NO.1.
Promoter IpDHN-PRO sequence is analyzed, has found that it is likely that existing TATA-box, CAAT-box and other can
Cis-acting elements existing for energy (as shown in Figure 2).
Embodiment 2: induction of the expression of thick boisiana Dehydrins IpDHN gene by with high salt/desiccation stress
The present invention discloses intracorporal in thick boisiana under own promoter regulation by thick boisiana Dehydrins IpDHN gene for the first time
Expression, the detection method used is Real time RT-PCR technology.The IpDHN gene obtained by this laboratory clone
CDNA sequence and website NCBI (http://www.dtd.nlm.nih.gov/) Photographing On-line Real time RT-PCR draw
Object.Primer for detecting IpDHN gene expression pattern is IpDHN-RTF:5 '-CCTGGGTACCACCCAAAGAC-3 ' (SEQ
ID NO.4) and IpDHN-RTR:5 '-GCACATAAAGTACTTCACAGCAAACC-3 ' (SEQ ID NO.5).Reference gene is
Thick boisiana ubiquitin protein gene IpUBQ, primer IpUBQ-RTF:5 '-TCGACAATGTGAAGGCAAAG-3 ' (SEQ ID NO.6)
And IpUBQ-RTR:5 '-CTTGATCTTCTTCGGCTTGG-3 ' (SEQ ID NO.7).With reference to BIO-RAD company iTaqTM
The specification of Universal SYBR Green Supermix prepares real time RT-PCR reaction system (operating on ice).
It is detected using Roche quantitative fluorescent PCR LightCycler480 application method.
All detections are all made of two biological samples and repeat, and each biological sample carries out repeating detection reaction three times.
Addition program Stage3 detects solubility curve when primer uses for the first time, confirms the specificity of primer.
Thick boisiana seedling is chosen respectively from South China Botanical Garden greenhouse and garden and adult is bloomed the different tissues position of plant, inspection
Expression under the conditions of thickness measuring rattan Dehydrins IpDHN gene is not affected by stress from outside under own promoter regulation.Such as Fig. 3 institute
Show, under conditions of normal growth, IpDHN gene has expression in the different parts of thick boisiana, but expression quantity is relative to composing type
Under promoter regulation for IpUBQ gene, expression quantity is lower, and maximum expression quantity (in adult plants root) is only IpUBQ base
Because of 0.9 times of expression quantity, show under regular culture conditions, thick boisiana Dehydrins IpDHN promoter is low expression level promoter.
Healthy growth one month thick boisiana seedling after taking seed to sprout, by thick boisiana seedling transfer 1/2MS fluid nutrient medium after
Continuous culture 3 days.Then with 1/ containing NaCl (300mM simulates high-salt stress) and mannitol (300mM, Drought stress simulation)
2MS fluid nutrient medium handles thick boisiana seedling, collects Stress treatment 0h (control), 2 hours and thick boisiana spire and children after 24 hours
Each 0.5g of root, for extracting total serum IgE.The extraction of RNA is said according to Magen company HiPure Plant RNA Kits (R4151's)
Bright book carries out.Use two-step method using total serum IgE as template reverse transcription cDNA.The synthesis of cDNA chain is according to Quan Shi King Company
The specification of TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix carries out.
As shown in figure 4, under 300mM NaCl Stress treatment, no matter in the root of thick boisiana seedling, rattan or leaf, IpDHN base
All by the induced strong of salt stress, maximum inducing amount can reach 40 times or more for the expression of cause.And in arid, (300mM's is sweet
Dew alcohol processing can result in plant dehydration) under Stress treatment, no matter in the root of thick boisiana seedling, rattan or leaf, the table of IpDHN gene
Up to also by induced strong, maximum inducing amount can reach 15 times or more.It is one that disclosure above, which shows IpDHN gene,
A with high salt and desiccation stress induced gene, gene promoter IpDHN-PRO have starting target gene thick boisiana Dehydrins in salt
Drought coerces lower inducing expression, improves thick boisiana to the ability of desiccation stress adaptability with high salt.
Embodiment 3: the quasi- south of GUS transgenosis under the promoter IpDHN-PRO regulation of building thick boisiana Dehydrins IpDHN gene
The building of mustard material
Using the IpDHN-PRO-pGEMT Plasmid DNA inserted with thick boisiana IpDHN gene promoter as template, following draw is designed
Object IpDHNProF:5 '-CGACTCTAGAGGATCCCAGTGGGGCTTCTTCTCCT-3 ' (SEQ ID NO.8) and
IpDHNProR:5 '-ACCTACCCGGGGATCCGCTCCTCCGCAGGCTTCTG-3 ' (SEQ ID NO.9) is to thick boisiana Dehydrins
The promoter IpDHN-PRO of IpDHN gene carries out PCR amplification.PCR product is according to Magen company HiPure Gel Pure DNA
Kits specification carries out agarose gel electrophoresis recycling.Simultaneously using the processing arabidopsis transgenosis double base expression of BamHI single endonuclease digestion
Carrier pBI101.2 recycles linearization plasmid.IpDHN-PRO promoter PCR fragment after the recovery and linearisation pBI101.2 matter
Grain measures concentration through Nanodrop company ultraviolet specrophotometer, using the In- of TaKaRa (Clontech) companyHD
Cloning Kit carries out DNA fragmentation and connects with the homologous recombination of carrier.Reaction product is converted large intestine by method to specifications
Bacillus JM109 competence bacterial strain.Picking monoclonal extracts plasmid, after sequencing is accredited as correct positive colony, is named as
It is spare to save plasmid by IpDHN-PRO-pBI101.2 (structural schematic diagram is as shown in Figure 5).After sequencing analysis is correct, IpDHN-
PRO-pBI101.2 recombinant plasmid is transferred in GV3101 Agrobacterium using freeze-thaw method, is added 50% glycerol to put -80 DEG C and is saved backup.
Using Clombia wildtype Arabidopsis thaliana as transgenic line, the method infected using inflorescence, by what is built
IpDHN-PRO-pBI101.2 plant expression vector passes through GV3101 agrobacterium mediation converted arabidopsis.By arabidopsis obtained
Transgenosis T3 is put on the MS culture medium containing 50ug/mL kanamycins for seed and is screened.
It takes the transgenic arabidopsis T3 of growth 10 days for plant, is placed in GUS staining reaction liquid and handles 3 hours, using group
Weave chemistry method is detected, and is taken pictures after being faded 48 hours with 95% ethyl alcohol later using LEICA DM2500 Stereo microscope.
As shown in fig. 6, there is blue spot in the true leaf of transgenic arabidopsis seedling, it is positive to show that GUS staining reaction occurs, it was demonstrated that
Gus gene begins transcription under the regulation of thick boisiana Dehydrins promoter IpDHN-PRO, shows thick boisiana Dehydrins of the present invention
Promoter sequence (SEQ ID NO.1) has the function that in heterologous plant (arabidopsis) promotor gene is transcribed, be one can be
The promoter applied in plant transgene work.
Expression of the gus gene in arabidopsis under embodiment 4:IpDHN-PRO regulation is lured by with high salt and desiccation stress
It leads
After the seed of the transgenic positive plant arabidopsis of acquisition is sprouted, it is placed in 1/2MS culture medium flat plate in 22
Culture obtains Arabidopsis thaliana Seedlings fortnight under the condition of culture of DEG C (16 hours illumination/8 hour dark), carries out later with high salt
(NaCl of 300mM) and simulating drought (mannitol of 300mM) Stress treatment, processing method is with example 2 is implemented, in the processing time
For for 24 hours when harvest Arabidopsis thaliana Seedlings, using untreated Arabidopsis thaliana Seedlings as control.Real time RT-PCR skill is carried out later
Art detects expression of the gus gene in arabidopsis body under by the regulation of thick boisiana promoter IpDHN-PRO.The extraction of RNA and
The program of reverse transcription is referring to embodiment 2.Reference gene in arabidopsis uses arabidopsis ubiquitin gene AtUBQ10
(At4g05320), the primer sequence of design is respectively as follows: AtUBQF:5 '-GATCTTTGCCGGAAAACAATTGGAGGATGGT-3 '
(SEQ ID NO.10) and AtUBQR:5 '-CGACTTGTCATTAGAAAGAAAGAGATAACAGG-3 ' (SEQ ID NO.11).
The special primer of gus gene detection is as follows: GUS-F:5 '-ATGTTACGTCCTGTAGAAAGGAAG-3 ' (SEQ ID NO.12)
With GUS-R:5 '-TCATTGTTTGCCTCCCTGCTGC-3 ' (SEQ ID NO.13).With reference to BIO-RAD company iTaqTM
The specification of Universal SYBR Green Supermix prepares real time RT-PCR reaction system (operating on ice).
It is detected using Roche quantitative fluorescent PCR LightCycler480 application method.
All detections are all made of two biological samples and repeat, and each biological sample carries out repeating detection reaction three times.
Addition program Stage3 detects solubility curve when primer uses for the first time, confirms the specificity of primer.
Our testing result shows the gus gene of transgenic arabidopsis in thick boisiana dehydrin gene promoter IpDHN-
Under the regulation of PRO, either under salt stress (NaCl of 300mM) processing, or in simulating drought (mannitol of the 300mM) side of body
Under compeling, expression of the gus gene in arabidopsis is induced, and shows the thick boisiana dehydrin gene promoter that the present invention announces
IpDHN-PRO is dehydration inducible promoter with high salt in heterologous plant (arabidopsis) Transgenic studies really.
The present embodiment only discloses in arabidopsis external source gus gene by promoter IpDHN-PRO in drought stress with high salt
Lower inducing expression, the present invention also may extend to other function gene, and be applied to cope with the arid side of body with high salt in plant genetic engineering
The inducing expression of target gene under the conditions of compeling.Due to the expression of promoter promotor gene under the conditions of plant normal growth
It is lower, therefore, it may can be dropped under normal operation for plant growth and development have the gene of genotoxic potential for certain
The low transgenosis work potential side effect of foreign gene, to cultivate the modified form transgenosis that specificity adapts to Drought Stress with high salt
Plant.It is can also be applied to transformation is adapted to the plant bioreactor of Drought Stress with high salt, to obtain with high salt dry
The genetically modified plants bioreactor of target protein high yield under non-irrigated stress conditions.
The embodiments described above only express several embodiments of the present invention, and the description thereof is more specific and detailed, but simultaneously
Limitations on the scope of the patent of the present invention therefore cannot be interpreted as.It should be pointed out that for those of ordinary skill in the art
For, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to guarantor of the invention
Protect range.Therefore, the scope of protection of the patent of the invention shall be subject to the appended claims.
Sequence table
<110>South China Botanical Garden Chinese Academy of Sciences
<120>thick boisiana is with high salt, dehydration inducible promoter IpDHN-PRO and its application
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 974
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gcagtggggc ttcttctcct tatactccac cccatgcagc tcccggagac ggtcacagct 60
tgtctgtaag cggatgccgg gagcggacaa gcccgtcagg gcgcgtcagc gggtgttggc 120
gggtgtcggg gctggcttaa ctatgcggca tcagagcaga ttgtactgag agtgcaccat 180
atgcggtgtg aaataccgca cagatgcgta aggagaaaat accgcatcag gcgccattcg 240
ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc gggcctcttc gctattacgc 300
cagctggcga aaggggggtg tgctgcaagg cgattaagtt gggtaacgcc agggttttcc 360
cagtcacgac gttgtaaaac gacggccagt gccaagctct cgagaagctt actccaagaa 420
tatcaaagat acagtctcag aagaccaaag ggctattgag acttttcaac aaagggtaat 480
atcgggaaac ctcctcggat tccattgccc agctatctgt cacatcatca aaaggacagt 540
agaaaaggaa ggtggcacct acaaatgcca tcattgcgat aaaggaaagg ctgtcgttca 600
agatgcctct gccgacagtg gtcccaaaga tggaccccca cccacaagga gcatcgtgga 660
aaaagaagac gttccaacca cgtcttcaaa gcaagtggat tgatgtgata tctccactga 720
cgtaagggat gacgcacaat cccactatcc ttcgccccaa gcttgggccc aagcttgggt 780
cgcgccccac ggatggtata agaataaagg cattccgcgt gcaggattca cccgttcgcc 840
tctcaccttt tcgctgtact ctctcgccac acacaccccc tctccagctc cgttggagct 900
ccggacagca gcaggcgcgg ggcggtcacg tagtaagcag ctctcggctc cctctcccct 960
tgctccgtgg atcc 974
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tccttatact ccaccccatg 20
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gcagtggggc ttcttctcct 20
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cctgggtacc acccaaagac 20
<210> 5
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gcacataaag tacttcacag caaacc 26
<210> 6
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
tcgacaatgt gaaggcaaag 20
<210> 7
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
cttgatcttc ttcggcttgg 20
<210> 8
<211> 35
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
cgactctaga ggatcccagt ggggcttctt ctcct 35
<210> 9
<211> 35
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
acctacccgg ggatccgctc ctccgcaggc ttctg 35
<210> 10
<211> 31
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
gatctttgcc ggaaaacaat tggaggatgg t 31
<210> 11
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
cgacttgtca ttagaaagaa agagataaca gg 32
<210> 12
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
atgttacgtc ctgtagaaag gaag 24
<210> 13
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
tcattgtttg cctccctgct gc 22
Claims (9)
1. a kind of with high salt, dehydration inducible promoter, it is characterised in that: the promoter is core shown in SEQ ID No.1
Nucleotide sequence.
2. one kind described in claim 1 is with high salt, the preparation method of dehydration inducible promoter, it is characterised in that: with wild thickness
The genomic DNA of rattan is template, is obtained by SEQ ID No.2, SEQ ID No.3 by chromosome walking clonal expansion.
3. a kind of plant expression vector, it is characterised in that: contain with high salt, dehydration inducible promoter described in claim 1.
4. plant expression vector according to claim 3, it is characterised in that: the plant expression vector is BamHI enzyme
With high salt, dehydration inducible promoter pBI101.2 carrier described in claim 1 is connected after cutting.
5. with high salt, dehydration inducible promoter described in claim 1 or plant expression vector as claimed in claim 3 are being adjusted
Control the application in gene expression in plants.
6. with high salt, dehydration inducible promoter described in claim 1 or plant expression vector as claimed in claim 3 are in height
Salt, desiccation stress plant transgene breeding in application.
7. application according to claim 5 or 6, the plant is arabidopsis or crops.
8. a kind of improve arabidopsis or crops to the method for dehydration adverse circumstance adaptability with high salt, which is characterized in that including by right
It is required that with high salt described in 1, dehydration inducible promoter, or plant expression vector described in claim 3 or 4 is transformed into quasi- south
In mustard or crops.
9. according to the method described in claim 8, it is characterized in that, passing through GV3101 agrobacterium mediation converted arabidopsis or farming
In object, the transgenic seed of arabidopsis or crops is obtained.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711192142.2A CN107988222B (en) | 2017-11-24 | 2017-11-24 | Thick boisiana is with high salt, dehydration inducible promoter IpDHN-PRO and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711192142.2A CN107988222B (en) | 2017-11-24 | 2017-11-24 | Thick boisiana is with high salt, dehydration inducible promoter IpDHN-PRO and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107988222A CN107988222A (en) | 2018-05-04 |
| CN107988222B true CN107988222B (en) | 2019-01-29 |
Family
ID=62032951
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711192142.2A Active CN107988222B (en) | 2017-11-24 | 2017-11-24 | Thick boisiana is with high salt, dehydration inducible promoter IpDHN-PRO and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107988222B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114875025B (en) * | 2022-03-25 | 2023-09-19 | 广东省科学院南繁种业研究所 | Drought and ABA inducible promoter P SCBV-YZ2060 And applications thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107266542A (en) * | 2017-08-04 | 2017-10-20 | 中国科学院华南植物园 | Thick boisiana IpLEA genes and its encoding proteins and application |
-
2017
- 2017-11-24 CN CN201711192142.2A patent/CN107988222B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107266542A (en) * | 2017-08-04 | 2017-10-20 | 中国科学院华南植物园 | Thick boisiana IpLEA genes and its encoding proteins and application |
Non-Patent Citations (2)
| Title |
|---|
| Low cost material enhanced the in vitro regeneration and micro propagation of medicinal sand dune plant species ipomoea pes-caprae(L.)R.Br.;P.Thirunavukkarasu et al.;《American journal of plant physiology》;20141231;第9卷(第1期);第16-23页 * |
| 厚藤 cDNA 文库的构建和重金属镉耐受相关基因的筛选;郭艳等;《植物科学学报》;20170802;第35卷(第3期);第372-378页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107988222A (en) | 2018-05-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9809827B2 (en) | Transgenic maize | |
| Chen et al. | Expression of an alfalfa (Medicago sativa L.) ethylene response factor gene MsERF8 in tobacco plants enhances resistance to salinity | |
| CN110818782B (en) | Lilium regale WRKY transcription factor gene LrWRKY3 and application thereof | |
| CN110734482B (en) | Lilium regale WRKY transcription factor gene LrWRKY4 and application thereof | |
| CN108251432B (en) | Notoginseng disease course related protein genePnPRlikeAnd applications | |
| CN101519441B (en) | Protein related to plant blossom time, a coding gene and applications thereof | |
| Wang et al. | Overexpression of a tomato AP2/ERF transcription factor SlERF. B1 increases sensitivity to salt and drought stresses | |
| CN103451228A (en) | Method for regulating size and grain weight of rice seeds | |
| Chen et al. | Enhance sucrose accumulation in strawberry fruits by eliminating the translational repression of FabZIPs1. 1 | |
| Yu et al. | Cloning and functional identification of PeWRKY41 from Populus× euramericana | |
| CN107904238B (en) | Thick boisiana is with high salt, drought-inducible promoter IpLEA-PRO and its application | |
| CN113004382B (en) | Application of EmBP1 gene or protein thereof | |
| CN102747099A (en) | Application of rice gene OsbZIP46 in heat resistance and cold resistance regulation | |
| CN107988222B (en) | Thick boisiana is with high salt, dehydration inducible promoter IpDHN-PRO and its application | |
| Ray et al. | Analysis of transcriptional and upstream regulatory sequence activity of two environmental stress-inducible genes, NBS-Str1 and BLEC-Str8, of rice | |
| CN104017061B (en) | Transcription factor ZmbZIP17 and encoding gene and its application in response adverse circumstance | |
| CN113929758B (en) | Potassium ion transporter protein HbRSAR1 and application thereof in regulating potassium transport of plants | |
| CN111073905B (en) | Application of soybean mitogen-activated protein kinase GmMMK1 coding gene | |
| CN106480038B (en) | It is a kind of by the specific inducible promoter DNA sequence dna of Salt treatment and application | |
| CN111378021A (en) | Protein IbEGF and related biological material and application thereof | |
| Bo Li et al. | Simultaneous overexpression of the HhERF2 and PeDREB2a genes enhanced tolerances to salt and drought in transgenic cotton | |
| CN113773374B (en) | Transcription factor ZmbZIPa6 and coding gene and application thereof | |
| CN112961230B (en) | OsFLP protein related to plant salt tolerance, related biological material and application thereof | |
| CN114645057B (en) | Caragana microphylla drought-tolerant gene Chr8.229 and application thereof in preparation of drought-tolerant transgenic plants | |
| CN116218877B (en) | Application of pseudo-ginseng WRKY transcription factor PnWRKY12 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |