CN110818783A - Lilium regale WRKY transcription factor gene LrWRKY2 and application thereof - Google Patents

Abstract

The invention discloses a Lilium regale WRKY transcription factor geneLrWRKY2The nucleotide sequence is shown as SEQ ID NO:1, encoding the polypeptide shown as SEQ ID NO:2, the invention is proved by related technical research of functional genomicsLrWRKY2The gene has the function of improving the antifungal effect of plants, and the invention is antifungalLrWRKY2The gene is constructed on a plant expression vector and is transferred into tobacco for over-expression, and the transgenic tobacco plant has strong true resistanceThe bacteria infection ability and the experimental result show that the over-expression is realizedLrWRKY2The transgenic tobacco has high-level resistance to infection of nigrospora oryzae, fusarium solani, fusarium verticillium, botrytis cinerea and alternaria ginseng.

Description

Lilium regale WRKY transcription factor geneLrWRKY2And applications

Technical Field

The invention relates to the field of research of related technologies of molecular biology and genetic engineering, in particular to a Lilium regale WRKY transcription factor gene with antifungal infection capacityLrWRKY2And application thereof.

Background

The WRKY transcription factor is a regulatory protein gene family in a Plant defense reaction related transcription factor network, is mainly involved in a Plant immune system to deal with various biological and abiotic stresses (PandeY SP, Somsich IE. of role of WRKY transcription factors in Plant immunity mechanism, 2009, 150 zinc finger (4): 1648 + E +.

Promoter regions of target genes regulated by WRKY mostly contain W-box (TTGACC/T), wherein TGAC is the core sequence of W-box and is highly conserved, and once a certain nucleotide is changed, the WRKY protein is reduced or even lost in binding capacity (Schwann, Wangjun, Chengjin, etc.. Plant WRKY transcription factor and biological function research progress. Chinese agricultural science and technology guide, 2016, 18(3): 46-54.). WRKY domain is composed of four β folds, conserved KYGQK residues correspond to β folds (strand β -1) at the N-terminal, can enter into DNA groove and interact with W cassettes on DNA (Ciolkowski I, WanD, Birkenbihl RP, et al. Studies on DNA-binding of selection genes) (strain 92, 2008-insert 92).

The WRKY transcription factor is reprogrammed to deal with the invasion of different pathogens by regulating a plant transcriptome, and the transcriptional regulation of the WRKY transcription factor on genes related to disease resistance response is a key component of the defense response of plants to pathogens and plays an important role in the defense response of plants. The WRKY gene family in plants contains many members that regulate plant growth and development and various stress responses (Wu ZJ, Li XH, Liu ZW, et alCamellia sinensisWRKY transformation factors in stress to temperature stress MolGenomics, 2016, 291(1): 255-69.). Overexpression in Populus diversifoliaPtrWRKY18 andPtrWRKY35can enhance the activity of rust fungus: (Melampsora) Simultaneously increasing the resistance in transgenic plantsPRExpression of The Gene (Jiang Y, Guo L, Ma X, et al, The WRKY transcription factors PtrWRKY18 and PtrWRKY35 promoterMelampsoraresistance inPopulusTree Physiol, 2017, 37(5): 665-. Strawberry FaWRKY1 regulating fruit pair Colletotrichum gloeosporioides negatively ((B))Colletotrichum acutatum) Resistance of (1) (Higura JJ, Garrido-Gala J, Lekhbou A, et al, The strain face WRKY1 transformation effects regulation resistance toColletotrichum acutatumin fruit uponInfection. Front Plant Sci, 2019, 10: 480.)。PtWRKY14Tobacco can be enhanced by overexpressionNicotiana tabacum) Resistance to TMV infection (wang xing, forest branches.PtWRKY14Research on the influence of gene transformation on tobacco and resistance to TMV, Guangdong agricultural science, 2014, 41(7): 130-. In addition, Salicylic Acid (SA) -mediated Reactive Oxygen Species (ROS) signaling enhancesJcWRKYResistance of transgenic tobacco to pathogenic bacteria of alfalfa carbon rot (Agarwal P, Patel K, Agarwal PK. Ectopic expression ofJcWRKYconfers enhanced resistancein transgenic tobacco againstMacrophomina phaseolina. DNA Cell Biol, 2018,37(4): 298-307.)。

The Bulbus Lilii is Liliaceae (Liliaceae) Lilium (Lilium)Lilium) The plant is a general term of perennial root flower. During the processes of seed ball propagation and fresh cut flower production, lily is vulnerable to various pathogenic bacteria such as fungi, viruses and bacteria. At present, the methodThe lily diseases found are more than dozens, among which, the lily is of the genus Fusarium (A)Fusariumspp.) blight caused by fungi (also known as basal rot, stem rot) is the most serious disease in lily production. After the fusarium infects the lily seed balls, the basal disc is necrotic, the scales are rotted and fall off, and the quality of the seed balls is reduced; after the plants are infected by fusarium, the leaves turn yellow and droop wilting, and the plants die in advance, so that the yield and the quality of the cut lily flowers are seriously influenced. Wherein Fusarium oxysporum (F.), (F. oxysporum) The pathogenicity is strongest, the separation frequency is highest, and the lily is the main pathogenic bacterium of lily wilt. Lilium regale (Lilium regale)L. regaleWilson) is a unique species in China, is only distributed in rock cracks from valleys with the altitude of 800-2700 m in Minjiang river basin to the mountains, has strong blight resistance, and is an important germplasm resource for modern lily breeding. WRKYs participate in responding to various biotic and abiotic stresses and are an important component of a plant defense system, so that important research and application values of the WRKY transcription factor gene in Lilium regale are provided.

Disclosure of Invention

The invention aims to provide a Lilium regale WRKY transcription factor geneLrWRKY2And application thereof, namely improving the effect of tobacco on the black sporotrichum oryzae (B)Nigrospora oryzae) Fusarium solani (F.solani) (II)Fusarium solani) Fusarium verticillatum (A)Fusarium verticillioides) Staphylococus viticola (A. vinifera)Botryosphaeria dothidea) Ginseng, alternaria alternata (Alternaria panax) Use in resistance.

The invention relates to a full-length gene of a WRKY transcription factor with antifungal activity, which is cloned from Lilium regaleLrWRKY2The nucleotide sequence is shown as SEQ ID NO. 1, the gene cDNA full length sequence is 1302bp, comprises a 1032 bp open reading frame, a 45 bp 5 'untranslated region and a 225 bp 3' untranslated region, and encodes protein of amino acid sequence shown as SEQ ID NO. 2.

In the inventionLrWRKY2The coding region of the gene is a nucleotide sequence shown in 46 th-1077 th sites in a sequence table SEQ ID NO. 1.

The invention separates and clones an antibody of Lilium regaleThe complete cDNA fragment of a fungus-related gene using Agrobacterium tumefaciens (A. tumefaciens) (A. tumefaciens)Agrobacterium tumefaciens) The target gene is transferred into a receptor plant and is overexpressed, whether the gene has antifungal activity is verified through further experiments, a foundation is laid for the capability of improving tobacco and other plants to resist fungal diseases by utilizing the gene in the later period, and the inventor names the gene asLrWRKY2。

As described aboveLrWRKY2The gene can be applied to improving the antifungal property of tobacco, and the specific operation is as follows:

(1) using amplificationLrWRKY2The specific primer is used for extracting total RNA from the root of Lilium regale after inoculating fusarium oxysporum and amplifying the total RNA by reverse transcription-polymerase chain reaction (RT-PCR)LrWRKY2Then connecting the full-length coding region to a pGEM-T vector, and obtaining a clone with a target gene through sequencing;

(2) using restriction endonucleasesBamHI andXbai enzyme digestion pGEM-T-LrWRKY2Recovering the carrier by glue to obtain target gene segment, using the same endonuclease to enzyme-cut plant expression carrier pCAMBIA2300s, recovering the glue to obtain the required carrier large segment, and recovering the obtained carrier large segmentLrWRKY2Connecting the gene fragment with the pCAMBIA2300s fragment to construct a plant overexpression vector, and then transferring the constructed recombinant vector into tobacco to express through the mediation of agrobacterium tumefaciens;

(3) screening transformants by using a resistance marker on the recombinant vector T-DNA, obtaining a real transgenic plant through PCR and RT-PCR detection, analyzing the capability of the transgenic plant leaf against fungal infection, and finally screening out the transgenic plant with obviously enhanced fungal resistance.

The invention provides a new method for improving the resistance of plants to fungal diseases, the defects of traditional breeding can be overcome by cultivating disease-resistant plants by means of genetic engineering, the breeding period is shortened, the operation is simple, and high-resistance materials are easy to obtain. The invention is derived from Lilium regaleLrWRKY2The gene can enhance the resistance of plants to fungi, and can be introduced into tobacco to produce new varieties and new materials with fungal resistance.The cultivation of resistant plant varieties and materials by utilizing the genetic engineering technology has obvious advantages and irreplaceable importance; the invention not only can provide convenience for large-scale production of crops, medicinal materials, horticultural plants and the like, greatly reduces the use of chemical pesticides, but also can save the cost for agricultural production and reduce the environmental pollution, thereby having wide market application prospect.

Drawings

FIG. 1 is a drawing of the present inventionLrWRKY2PCR detection result graph of transgenic tobacco genome DNA, in the graph: the Marker is DL2000 DNA Marker (Dalibao biology); the positive control is plasmid pGEM-T-LrWRKY2PCR products as templates; WT is the product of PCR using total DNA of non-transgenic tobacco (wild type) as template;

FIG. 2 shows the positivity of the present inventionLrWRKY2In transgenic tobaccoLrWRKY2A graph of the results of expression analysis at the transcriptional level; in the figure: marker is DL2000 DNA Marker (Dalibao biology); WT is a PCR product with non-transgenic tobacco total RNA reverse transcription cDNA as a template; the positive control was plasmid pGEM-T-LrWRKY2A PCR product as a template;

FIG. 3 is a drawing of the present inventionLrWRKY2A result graph of transgenic tobacco resistance identification; in the figure, a, b, c, d and e are respectively inoculated with Fusarium oxysporum, Fusarium verticillarum, Staphylotrichum botrytis, Fusarium solani and alternaria ginsengLrWRKY2Transgenic tobacco leaf; WT is leaf of wild tobacco, 1, 8, 17, 27 areLrWRKY2Leaves of transgenic tobacco.

Detailed Description

The present invention is further illustrated by the following figures and examples, but the scope of the present invention is not limited to the above description, and the examples are conventional methods unless otherwise specified, and reagents used are conventional commercially available reagents or reagents formulated according to conventional methods unless otherwise specified.

Example 1:LrWRKY2full-Length Gene cloning and sequence analysis

Inoculating fusarium oxysporum to Lilium regale, extracting total RNA from roots inoculated for 24 hours, grinding the inoculated Lilium regale roots into powder by using liquid nitrogen, transferring the powder into a centrifuge tube, extracting the total RNA by using a guanidine isothiocyanate method, synthesizing a cDNA first chain by using reverse transcriptase M-MLV (promega) and using the total RNA as a template, wherein a reaction system and an operation process are as follows: taking 5 μ g of Total RNA, adding 50 ng oligo (dT), 2 μ L dNTP (2.5 mM each) and DEPC water in sequence to the reaction volume of 14.5 μ L; after uniformly mixing, heating and denaturing at 70 ℃ for 5min, then rapidly cooling on ice for 5min, then sequentially adding 4 mu L of 5 XFirst-standby buffer, 0.5 mu L of RNase (200U) and 1 mu L M-MLV (200U), uniformly mixing and centrifuging for a short time, carrying out warm bath at 42 ℃ for 1.5 h, taking out, heating at 70 ℃ for 10 min, and stopping reaction; the first strand cDNA is synthesized and stored at-20 deg.C for further use.

Amplifying target gene using synthesized first strand cDNA as templateLrWRKY2The sequences of the upstream and downstream primers used were 5 'CTACAAGGTTCATCCTGCTAGACAT 3' and 5 'TTTGCTTTCCATCCACTAGATAACA 3', respectively. Advantage is taken^TM2 PCR Enzyme (Clontech) amplifies the target gene; and (3) PCR reaction conditions: 5min at 94 ℃; 30s at 94 ℃, 30s at 60 ℃, 1 min at 72 ℃ and 32 cycles; 7 min at 72 ℃; the reaction system (20. mu.L) was 0.5. mu.L of cDNA, 2. mu.L of 10 × Advantage 2 PCR Buffer, 0.4. mu.L of 50 × dNTP Mix (10 mM each), 0.4. mu.L of forward primer (10. mu.M), 0.4. mu.L of reverse primer (10. mu.M), 0.4. mu.L of Advantage 2 PCR Polymerase Mix, 15.9. mu.L of LPCR-Grade water; after the PCR was completed, 5. mu.L of the resulting mixture was subjected to agarose gel electrophoresis to examine the specificity and size of the amplified product.

TA cloning of PCR product with pGEM-T easy Vector System I (Promega, USA) as reagent kit, and the reaction System and operation process includes taking 1.5 microliter of PCR product, adding 1 microliter of pGEM-T Vector (50 ng/microliter) and 2.5 microliter of 2 × Ligation solution I, mixing, reacting at 16 deg.C overnight, transferring the Ligation product into Escherichia coli DH5 α by heat shock transformation, screening positive clones with LB solid culture medium containing ampicillin (ampicilin, Amp), selecting several single colonies, shaking, amplifying, and cloningLrWRKY2Identifying the multiple cloning site insertionLrWRKY2The clones identified are sequenced and finally obtainedLrWRKY2The full-length cDNA was 1302bp, and was obtained by NCBI ORF finder (http:// www.ncbi.nlm.nih.gov/gorf/g)Html) analysis found that it contained a 1032 bp open reading frame (see sequence listing),LrWRKY2encodes a 343 amino acid protein with molecular weight of about 37.91 KDa, isoelectric point of about 5.88, and 4 cysteine residues. LrWRKY2 has 1 WRKYGQK conserved domain followed by a C2H2 (C-X4-C-X22/23-H-X1-H) type zinc finger motif. It is clear that,LrWRKY2the encoded protein belongs to class II WRKY transcription factors.

Example 2: construction of plant overexpression vectors

The insertion is extracted by adopting a SanPrep column type plasmid DNA small extraction kit (Shanghai worker)LrWRKY2The E.coli plasmid pGEM-T-LrWRKY2And the plasmid of the plant expression vector pCAMBIA2300s, taking 1 microliter to be used for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmid; using restriction endonucleasesBamHI (TaKaRa) andXbai (TaKaRa) to plasmid pGEM-T-LrWRKY2And pCAMBIA2300s (100 mu L system), wherein the reaction system and the operation process are as follows: taking 20. mu.L of pGEM-T-LrWRKY2And pCAMBIA2300s plasmid, 10. mu.L 10 XK buffer, and 4. mu.LBamHI、6 μLXbaI、60 μL ddH₂O, mixing uniformly, centrifuging for a short time, and reacting at 37 ℃ overnight; all the products of the digestion are spotted in agarose gel for electrophoresis, and thenLrWRKY2The fragments and the pCAMBIA2300s vector large fragment are respectively subjected to gel recovery, and a SanPrep column type DNA gel recovery kit (Shanghai's engineering) is used in the whole process; taking 1 microliter of the recovered product, detecting the size and concentration of the recovered fragment by agarose gel electrophoresis, and storing at-20 ℃ for later use.

The recovered DNA was purified by using T4 DNA Ligase (TaKaRa)LrWRKY2The DNA fragment and the pCAMBIA2300s vector fragment were ligated, and the reaction system (20. mu.L) and the procedure were as follows: taking 10 μ LLrWRKY2The DNA fragment was added with 2. mu.L of vector DNA of AMBIA2300s, 2. mu.L of 10 XT 4 DNA Ligase Buffer, 1. mu. L T4 DNA Ligase, and 5. mu.L of ddH in this order₂O, mixing, centrifuging for a short time, reacting in water bath at 16 deg.C overnight, transferring the ligation product into E.coli DH5 α by heat shock transformation with a solution containing 50mg/L kanamycin (kanam)Cin, Km) was screened for positive clones. Selecting single colony shake bacteria, taking bacteria liquid as template for amplificationLrWRKY2The specific primers of (1) are subjected to PCR, and selectedLrWRKY2If the detected strain is positive, the clone successfully connected with pCAMBIA2300s is added with glycerol and stored at-80 ℃ for later use.

Extracting and purifying pCAMBIA2300s-LrWRKY2A plasmid. Then the plant expression vector pCAMBIA2300s constructed above is frozen and thawed by liquid nitrogenLrWRKY2Transferred into Agrobacterium tumefaciens LBA4404 competent cells. The operation steps are as follows: taking 2 μ g of pCAMBIA2300s-LrWRKY2The plasmid is added into a centrifuge tube containing 200 mu L of competent cells, the mixture is gently mixed and then is subjected to ice bath for 5min, then the mixture is transferred into liquid nitrogen to be frozen for 1 min, then the mixture is rapidly placed in a water bath at 37 ℃ for 5min, then is subjected to ice bath for 2 min immediately, and is added with 800 mu L of LB liquid culture medium to be subjected to shaking culture at 28 ℃ for 4 h. The activated agrobacterium is smeared on LB solid culture medium containing 50mg/L Km and is statically cultured at 28 ℃. Selecting single colony shake bacteria, and amplifyingLrWRKY2The specific primer of (2) is used for PCR to detect pCAMBIA2300s-LrWRKY2If the positive clone is transferred into agrobacterium, adding glycerol into the positive clone, and storing the positive clone at-80 ℃ for later use.

Example 3: agrobacterium-mediated genetic transformation of plants and transgenic plant screens

The transgenic recipient in this experiment was tobacco, tobacco seeds were soaked in 75% ethanol for 30s, washed with sterile water and then washed with 0.1% HgCl₂Soaking for 8 min, washing with sterile water for several times, sowing on 1/2MS culture medium, dark culturing at 28 deg.C for 6d, germinating, transferring to light incubator (25 deg.C, 16 h/d light), and subculturing with 1/2MS culture medium once a month.

The preserved liquid containing pCAMBIA2300s was taken out from the-80 ℃ refrigeratorLrWRKY2Agrobacterium LBA4404 strain of plasmid was inoculated into 5 mL LB liquid medium containing 50mg/L Km and 20 mg/L rifampicin, and cultured at 28 ℃ until the medium became turbid. Sucking 1 mL of turbid bacterial liquid to an LB solid culture medium containing 50mg/L Km, and culturing for 48 h at 28 ℃; then appropriate amount of Agrobacterium on LB solid medium was scraped off and inoculated on the mediumIn MGL liquid medium containing 20 mg/L acetosyringone, the Agrobacterium is activated by shaking culture at 28 ℃ for 2-3 h.

Cutting sterile tobacco seedling leaf into 1 cm²And completely soaking the left and right leaf discs in the MGL liquid culture medium containing the activated agrobacterium for 15 min, sucking bacterial liquid on the surfaces of the leaves by using sterile filter paper, placing the leaf discs on a co-culture medium for room temperature culture, wherein the co-culture medium for tobacco transformation is MS +0.02 mg/L6-BA +2.1 mg/L NAA +30 g/Lsucrose +6g/L agar, and co-culturing for 2 days at 22 ℃ in the absence of light.

Transferring the co-cultured leaf discs to an MS screening culture medium added with antibiotics to be divided into seedlings, and screening transgenic plants. The tobacco screening culture medium is MS +0.5 mg/L6-BA +0.1mg/L NAA +30g/L sucrose +6g/L agar +50mg/L Km +200 mg/L cephamycin (cefixime sodium salt, Cef); during screening culture, the culture bottle is transferred to an illumination culture box for culture (25 ℃, 16 h/d illumination and 8 h/d darkness), after the tobacco grows out of buds, the MS culture medium containing 50mg/L Km and 200mg/L Cef is used for subculture, the regeneration plant needs to be further screened because the callus differentiation rate of the tobacco is higher, the tobacco regeneration seedling is transferred to the MS culture medium containing 50mg/L Km to root the tobacco regeneration seedling, and finally the regeneration seedling with better rooting is selected for further detection.

Extracting genome DNA of transgenic tobacco plant leaf by CTAB method, collecting 1 μ L of the extracted genome DNA, detecting its integrity and concentration by agarose gel electrophoresis, and amplifying with the genome DNA of transgenic plant as templateLrWRKY2After the PCR is finished, 8 mu L of the product is used for agarose gel electrophoresis to detect positive transgenic plants, the amplification result of part of tobacco transgenic plants is shown in figure 1,LrWRKY2and co-screening 51 positive transgenic plants from the transgenic tobacco.

Example 4: in transgenic tobaccoLrWRKY2Expression analysis and functional analysis of transgenic plants against fungal infection

Taking positive transgenic single plant and tender leaf of non-transgenic tobacco (wild type) to extract total RNA, reverse transcribing to generate first strand cDNA, and using it as template to make amplificationLrWRKY2Is a special rule ofCarrying out PCR by the primers, and analyzing each transgenic individual plant according to the PCR resultLrWRKY2The expression of transcription level, total RNA extraction and RT-PCR were performed in the same manner as in example 1, after PCR was completed, 8. mu.L of the DNA was subjected to agarose gel electrophoresis, and the results of detection of some individuals were shown in FIG. 2, and 47 transgenic individuals were detected in totalLrWRKY2The expression was carried out at the transcriptional level, and the numbers of these individuals were 1 to 47.

Several kinds of pathogenic fungi stored in a laboratory were inoculated on PDA solid medium (200 g/L potato, 15g/L agar, 20 g/L glucose) and cultured in the dark at 28 ℃ for 7 d. Selecting well-growing, uniformly sized and fully extended wild type tobacco in greenhouse andLrWRKY2transgenic tobacco leaves were removed from the petioles using surgical scissors. And forming wounds with the same size at the same positions of the blades by using a sterile plastic gun head, and respectively inoculating fungal hypha blocks with the same size. Placing the treated leaves in a flat plate paved with sterile water-soaked filter paper, culturing in a light incubator at 28 ℃, and adding water every day for moisturizing. After 7d of culture, the leaves were collected and observed for the onset of disease in each line. As shown in FIG. 3, after inoculation of five pathogenic fungi, i.e., Fusarium graminearum, Fusarium verticillium, Staphylocoma botrytis, Fusarium solani and Alternaria ginseng, the leaves of the wild type tobacco form large scabs, and the leaves of the wild type tobacco are yellowed and rotted, while the symptoms of the leaves of the transgenic tobacco are slight, and the formed scabs are much smaller in area than those of the wild type tobacco. It is clear that,LrWRKY2the transgenic tobacco has strong resistance to pathogenic fungi such as nigrospora oryzae, fusarium verticillioides, botrytis cinerea, fusarium solani and alternaria ginseng.

Sequence listing

<110> university of Kunming science

<120> Lilium regale WRKY transcription factor gene LrWRKY2 and application

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>1302

<212>DNA

<213> Lilium regale Wilson

<400>1

ctcccctctc cctctctcac ccctacaagg ttcatcctgc tagacatgtg tgatctcttc 60

tggcaaagaa tggaaggcga gcttgccgac atcgtccgca ccagcggcct caccagccat 120

ccgcccatct ccgactttgc tgattgggat ctaccttccg accccataac cttctcccct 180

tcatcccaag acaacttcgg cgacccattc atcaacttgc cagatccatt gcttcatgaa 240

tcaccggcca ccaatatcgc tccagtctct gactccgaca accatgaaat aggtgtgcca 300

cttgctcaga ggatgatagc agcgagcgag gagctgaaga ggcctaacaa catattctca 360

cggatgctgc agatctcccc aagggagcta aaagctactc aaatgatatc gaccagtgat 420

ttgatgaaga cgagcaacag tggctcgaca ggcgccgtgc agatttcctc tccaaggggt 480

cttggaatca agaggaggaa aagccaggca aagaaggtgg tgtgcatccc agcaccagca 540

gctacaacca gcaggagcag tggagaggtt gttccagctg atctttgggc ttggaggaag 600

tatggacaga aacccatcaa aggttctcct catccaaggg gctactatag atgcagcagc 660

tcaaaaggat gctcagcaag gaagcaagtc gagaggagcc gaactgatcc aaacatgcta 720

gtcatcactt acacatccga gcacaaccat ccctggccga cacagaggaa cgctctcgct 780

ggatcgacaa gatcgtcaca cccggctaag aacatctctt ccgcggcatc caagatctcc 840

ccacctgcaa atttgaagga agaagaaccc aaggaggagg taatctcaac cattgtgcca 900

gtgaaggaag aaatggcagg aaatgatcat caagaattcc aagaccaagt gttgcagcat 960

acttacaagc caatgatacc agactcgaat caatccgatg atttctttga tgagttggga 1020

gaattgggga ctgattctat ggattcattt aacatgtttg aatgggccgg gaaataatct 1080

ggagtcatag atttcgaata aaaagttgtt atctagtgga tggaaagcaa aaactattga 1140

ggtttgaagc acatacattt tcacatactt gatttaacca aaatatgaat taaatcctta 1200

gtgtcctataagtgaaaatg tattgtgcat ggattctgtt ttatggattg ctacatatat 1260

ttgtgttttg gactatctga ccaatgactg gttaacttat aa 1302

<210>2

<211>343

<212>PRT

<213> Lilium regale Wilson

<400>2

Met Cys Asp Leu Phe Trp Gln Arg Met Glu Gly Glu Leu Ala Asp Ile

1 5 10 15

Val Arg Thr Ser Gly Leu Thr Ser His Pro Pro Ile Ser Asp Phe Ala

20 25 30

Asp Trp Asp Leu Pro Ser Asp Pro Ile Thr Phe Ser Pro Ser Ser Gln

35 40 45

Asp Asn Phe Gly Asp Pro Phe Ile Asn Leu Pro Asp Pro Leu Leu His

50 55 60

Glu Ser Pro Ala Thr Asn Ile Ala Pro Val Ser Asp Ser Asp Asn His

65 70 75 80

Glu Ile Gly Val Pro Leu Ala Gln Arg Met Ile Ala Ala Ser Glu Glu

85 90 95

Leu Lys Arg Pro Asn Asn Ile Phe Ser Arg Met Leu Gln Ile Ser Pro

100 105 110

Arg Glu Leu Lys Ala Thr Gln Met Ile Ser Thr Ser Asp Leu Met Lys

115 120 125

Thr Ser Asn Ser Gly Ser Thr Gly Ala Val Gln Ile Ser Ser Pro Arg

130 135 140

Gly Leu Gly Ile Lys Arg Arg Lys Ser Gln Ala Lys Lys Val Val Cys

145 150 155 160

Ile Pro Ala Pro Ala Ala Thr Thr Ser Arg Ser Ser Gly Glu Val Val

165 170 175

Pro Ala Asp Leu Trp Ala Trp Arg Lys Tyr Gly Gln Lys Pro Ile Lys

180 185 190

Gly Ser Pro His Pro Arg Gly Tyr Tyr Arg Cys Ser Ser Ser Lys Gly

195 200 205

Cys Ser Ala Arg Lys Gln Val Glu Arg Ser Arg Thr Asp Pro Asn Met

210 215 220

Leu Val Ile Thr Tyr Thr Ser Glu His Asn His Pro Trp Pro Thr Gln

225 230 235 240

Arg Asn Ala Leu Ala Gly Ser Thr Arg Ser Ser His Pro Ala Lys Asn

245 250 255

Ile Ser Ser Ala Ala Ser Lys Ile Ser Pro Pro Ala Asn Leu Lys Glu

260 265 270

Glu Glu Pro Lys Glu Glu Val Ile Ser Thr Ile Val Pro Val Lys Glu

275 280 285

Glu Met Ala Gly Asn Asp His Gln Glu Phe Gln Asp Gln Val Leu Gln

290 295 300

His Thr Tyr Lys Pro Met Ile Pro Asp Ser Asn Gln Ser Asp Asp Phe

305 310 315 320

Phe Asp Glu Leu Gly Glu Leu Gly Thr Asp Ser Met Asp Ser Phe Asn

325 330 335

Met Phe Glu Trp Ala Gly Lys

340

<210>3

<211>25

<212>DNA

<213> Artificial sequence (Artificial)

<400>3

ctacaaggtt catcctgcta gacat 25

<210>4

<211>25

<212>DNA

<213> Artificial sequence (Artificial)

<400>4

tttgctttcc atccactaga taaca 25

Claims (2)

1. Lilium regale WRKY transcription factor geneLrWRKY2The method is characterized in that: the nucleotide sequence is shown as SEQ ID NO. 1, and the protein of the amino acid sequence shown as SEQ ID NO. 2 is coded.

2. Lilium regale WRKY transcription factor gene as claimed in claim 1LrWRKY2In improving tobacco to Nicotiana oryzae (Nigrospora oryzae) Fusarium solani (F.solani) (II)Fusarium solani) Fusarium verticillatum (A)Fusarium verticillioides) Staphylococus viticola (A. vinifera)Botryosphaeria dothidea) Ginseng, alternaria alternata (Alternaria panax) Use in resistance.

Images