CN112029775B

CN112029775B - Cabbage mustard BoWRKY33 gene and application thereof

Info

Publication number: CN112029775B
Application number: CN202010830938.1A
Authority: CN
Inventors: 汪俏梅; 陶晗; 陈莉莉; 王梦雨; 夏楚楚; 曾围; 苗慧莹
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2020-08-18
Filing date: 2020-08-18
Publication date: 2022-07-19
Anticipated expiration: 2040-08-18
Also published as: CN112029775A

Abstract

The invention relates to the technical field of biology, in particular to a cabbage mustard BoWRKY33 gene and application thereof in resistance to Alternaria brasiliensis (Alternaria brassicola) induced melasma. Specifically, the invention discloses a gene BoWRKY33 for improving resistance of cabbage alternaria brassicae in cabbage mustard, a protein coded by the gene, a gene overexpression vector 35Spro, BoWRKY33-YFP and a gene silencing VIGS vector BoWRKY 33-PTY.

Description

Cabbage mustard BoWRKY33 gene and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a cabbage mustard BoWRKY33 gene and application thereof in resistance to Alternaria brasiliensis (Alternaria brassicola) caused melasma.

Background

Brassica vegetables are the vegetables with the largest cultivation area, the highest total yield and the largest consumption in China, and the production of brassica vegetables plays an immeasurable important role in the vegetable supply of Asia and other areas in the world. Alternaria brassicae is a dead body nutritional type of fungus, and black spot caused by alternaria brassicae has serious harm to brassica crops in cruciferae. The cabbage mustard belonging to brassica is a Chinese special vegetable, is easily infected by alternaria brassicae in the production process, influences the yield and the quality and safety of products, excavates resistance genes of the cabbage mustard against the alternaria brassicae, and has important biological significance and economic value in analyzing the functions and action mechanisms of the resistance genes.

Alternaria alternata belongs to the kingdom of fungi, subdivision Deuteromycotina, class of Hyphomycetes, order of Hyphomycetales, and genus Alternaria. Alternaria brassicae belongs to one of alternaria alternata, is a saprophytic fungus, is mainly parasitic in brassica plants, and has serious influence on the appearance and yield of brassica vegetables. Alternaria brassicae is also a main fungus causing plant black spot, the diseased spots are mostly round or nearly round, the diseased spots are often ring spots, dark mildew layers exist, the diseased spots have serious influence on roots, stems, leaves and flowers of brassica plants, and the growth of the plants is inhibited. The damage of the black spot to cruciferous vegetables is second to virus diseases, soft rot and downy mildew. Taking Chinese cabbage as an example, black spot disease is epidemic outbreak in northeast, northwest and northeast China, the incidence rate of serious areas even reaches 100%, which causes serious economic loss, and the black spot disease of various cabbage vegetables also seriously affects the yield and commodity of product organs, which causes great economic loss.

Glucosinolates and their degradation products also play a crucial role in the invasion of pathogenic bacteria. The defense response of plants against pathogens or insects is similar to the innate immune defenses of animals, and the process is often accompanied by the formation of callose, which is associated with the phytohormone ethylene and the plant metabolite indole glucosinolates. Indole glucosinolates and degradation products thereof are very important secondary metabolites in brassica plants and play an important role in the resistance of plants to biotic stress. The kale contains abundant glucosinolates.

The previous research shows that in Arabidopsis, WRKY33 participates in immune reactions of plants against biotic stress and the like, and has broad-spectrum resistance to pathogenic bacteria, and in the process, WRKY33 plays an important role by regulating and controlling a plant hormone signal pathway and a metabolic pathway of plant secondary metabolites.

Disclosure of Invention

The invention aims to solve the technical problem of providing a gene and a protein for improving resistance of cabbage mustard to alternaria brassicae.

In order to solve the technical problem, the invention provides a gene BoWRKY33 for regulating and controlling resistance of alternaria brassicae, which has the nucleotide sequence shown in SEQ ID NO: 1.

The invention also provides a protein coded by the gene, which has the amino acid sequence shown in SEQ ID NO: 2.

The invention also provides a plasmid containing the gene and a plant expression vector containing the gene; comprises a gene overexpression vector 35Spro, BoWRKY33-YFP and a gene silencing VIGS vector BoWRKY 33-PTY.

The invention also provides a host cell which is an escherichia coli cell and an agrobacterium cell.

The invention also provides the application of the gene: the transgenic cabbage mustard is used for constructing the transgenic cabbage mustard, and the transgenic cabbage mustard can improve the resistance to alternaria brassicae.

The gene BoWRKY33 is a key transcription factor related to resistance of cabbage mustard and belongs to class I WRKY transcription factors. The research of the invention shows that the transcription factor BoWRKY33, which is the resistant gene of alternaria brassicae from cabbage mustard, plays an important role in resisting alternaria brassicae by regulating the atypical degradation of indole glucosinolates.

Alternaria brassicae is not compatible with arabidopsis wild types and has slight harm to arabidopsis, and for brassica vegetables including cabbage mustard, melasma caused by alternaria brassicae can cause necrosis and rot of vegetable leaves, stems, flowers and pods, thus seriously affecting the appearance and yield of the brassica vegetables. The invention discovers a resistance gene BoWRKY33 for resisting the alternaria alternata in cabbage mustard for the first time, verifies that the resistance gene BoWRKY33 can positively regulate and control the resistance of the cabbage mustard to the alternaria alternata black spot, and provides technical basis and theoretical support for molecular breeding and genetic engineering improvement of resistance quality of brassica vegetables.

According to the invention, the cabbage mustard material is constructed through cloning of BoWRKY33 genes, a transgenic technology and gene silencing, and the application prospect is good in the aspect of improving the resistance of cabbage mustard and other brassica vegetables to black spot caused by alternaria brassicae.

In conclusion, the invention firstly constructs a cabbage mustard BoWRKY33 VIGS gene silencing plant and a heterologous overexpression 35 Spro-BoWRKY 33-YFP Arabidopsis material, and performs function research. Through an alternaria brassicae inoculation experiment, the fact that glucosinolate regulated by the BoWRKY33 gene plays a positive regulation role in resisting alternaria brassicae black spot diseases in cabbage mustard.

Drawings

In order to make the objects, technical solutions and advantages of the present invention more apparent, the following detailed description of the embodiments of the present invention is provided with reference to the accompanying drawings.

FIG. 1 shows the relative expression levels of BoWRKY33 in different tissue regions of cabbage mustard.

FIG. 2 shows the expression level of BoWRKY33 gene and the expression level of glucosinolate-related gene in a heterologous overexpression strain of BoWRKY33 gene;

wherein, the left picture is the expression quantity of BoWRKY33 genes in the BoWRKY33 gene heterologous overexpression strain; WT represents wild type, and BoWRKY33OX-1, BoWRKY33OX-3 and BoWRKY33OX-4 represent different heterologous BoWRKY33 overexpression Arabidopsis strains;

the right graph shows the expression level of the glucosinolate related genes in the heterologous overexpression strain of the BoWRKY33 gene; MYB51 represents a glucosinolate transcription factor, CYP83B1, CYP81F2, IGMT1 and IGMT2 represent synthetic genes for glucosinolates, and PEN2 represents a degradation gene for glucosinolates.

FIG. 3 shows the expression level of BoWRKY33 gene and the content of glucosinolate-related genes in a strain of cabbage mustard in which BoWRKY33 VIGS gene silences the gene;

wherein PTY represents a control group, PTY-2 and PTY-3 represent different BoWRKY33 VIGS gene silencing Brassica juncea strains. BoMYB51.1 is glucosinolate transcription factor in cabbage mustard, BoCYP81F2.1, BoIGMT1 and BoIGMT2 represent synthetic genes of glucosinolate in cabbage mustard, and BoPEN2 represents degradation genes of glucosinolate in cabbage mustard.

FIG. 4 is statistics of resistance phenotype and plaque area of plants to alternaria brassicae in a BoWRKY33 gene heterologous overexpression strain;

wherein, 35S: BoWRKY33 shows a plant with heterologous overexpression of the BoWRKY33 gene.

FIG. 5 is statistics of resistance phenotype and plaque area of plants to alternaria brassicae in BoWRKY33 VIGS gene silencing lines;

wherein PTY is an inoculated no-load control group, WRKY33-PTY is a BoWRKY33 VIGS gene silencing plant.

Detailed Description

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

firstly, obtaining a full-length sequence of a cabbage mustard BoWRKY33 gene:

the NCBI primer design tool was used to design a whole gene amplification primer, referred to as CDS sequence of Brassica oleracea (Brassica oleracea) in Brassica Database (BRAD, http:// brassicacdb. org). Taking leaf cDNA of cabbage mustard 'four seasons thick strips' planted in a culture room of an agricultural ring in university of Zhejiang as a template (the extraction mode of the cDNA is conventional technology, for example, refer to CN 104561025A), designing a specific primer, and amplifying a BoWRKY33 fragment by PrimerSTAR high fidelity enzyme PCR.

The primer sequence is as follows: SmaI-BoWRKY33-F: TCTAGACCCGGGATGGCTGCTTCTTCCCTCCT

BamHI-BoWRKY33-R:AGTGGATCCCGACAAGAACGAATCAAAAAACGA

PCR amplification reaction System: 2xPrimerSTAR buffer 25ul, dNTP mix 5ul, PrimerSTAR DNA polymerase 1ul, ddH₂O16 ul, cDNA1ul, and upstream and downstream primers each 1ul, for a total of 50 ul. The PCR reaction program is: pre-denaturation at 94 ℃ for 90 seconds; denaturation at 94 ℃ for 30 seconds, annealing at 57 ℃ for 45 seconds, extension at 72 ℃ for 1 min 30 seconds, and 35 cycles; and finally, final extension is carried out for 5 minutes at 72 ℃, the obtained PCR product is identified by 1% agarose gel electrophoresis, then the amplified band is recovered and purified by an Axygen DNA gel kit, the recovered product is constructed on a pCambia1300-YFP vector, and the recombinant plasmid is sent to the engine company for sequencing confirmation.

The nucleotide sequence of the obtained gene BoWRKY33 is shown as SEQ ID NO: 1 is shown in the specification; the amino acid sequence of the protein coded by the gene is shown as SEQ ID NO: 2, respectively.

Second, construction of over-expression vector of BoWRKY33 gene

Construction of BoWRKY33 overexpression vector, pCambia1300-YFP (CAMBIA corporation) is used as a final vector to construct 35Spro: BoWRKY33 vector with CaMV35S recombinant overexpression promoter. The fragment of BoWRKY33 amplified in the first step and the vector pCambia1300-YFP were cleaved with SmaI and BamHI (37 ℃ C., 1 hour), and then the fragment was ligated to the cleaved pCambia1300-YFP by T4 DNA Ligase (Takara, Japan) at 16 ℃ for 14 hours to obtain a recombinant plasmid 35Spro: BoWRKY 33.

After the reaction, 35Spro, BoWRKY33 plasmid was transformed into E.coli competent DH5 α. Screening by using an LB solid medium with kanamycin (kan) resistance, screening a recombinant plasmid with a target fragment (meeting a band with the size of 1473bp, namely a 35Spro: BoWRKY33 recombinant plasmid) by using colony PCR, and sequencing and identifying. The sequencing results were analyzed using DNAMAN software. The correct transformant was named 35Spro: BoWRKY 33.

Construction of BoWRKY33 VIGS gene silencing vector

In BoWRKY33 SEQ ID NO: 1, searching 40bp oligonucleotide sequence with NTAG, NTAA or NTGA at the 5' end, adding the reverse complementary sequence to the sequence to form a custom oligonucleotide sequence with the length of 80bp as a target fragment, and carrying out enzyme digestion and connection on the target fragment and a vector PTY. The 80bp fragment was:

TTGATTCCCCTGCTTTTGTTGCCTCCTCTGCTAACGTTCTAGAACGTTAGCAGAGGAGGCAACAAAAGCAGGGGAATCAA。

the method comprises the following specific steps:

the PTY plasmid was digested with SnaBI restriction enzymes (Methods in Molecular Biology, 2013, vol.975, 197-210), the digestion products were subjected to agarose gel electrophoresis overnight (12-14 h) in a metal bath at 37 ℃ and a linear fragment of 10045bp in size was recovered. Treating the digested PTY plasmid with alkaline phosphatase, purifying and recovering by using a purification kit, and determining the concentration. The oligonucleotide sequence (80bp) was treated with phosphokinase, left in a metal bath at 37 ℃ for 30 minutes, and then taken out and purified and recovered by using a purification kit. The PTY plasmid recovered after the alkaline phosphatase treatment was ligated with the annealed 80bp oligonucleotide according to the instructions for use of T4 ligase, the ligation product was transformed into E.coli DH 5. alpha. and ampicillin (Amp) resistance was selected. And selecting positive clones to perform bacterial liquid PCR verification and sequencing verification. Positive clones with correct sequencing result can obtain about 560b fragments (SEQ ID NO: 3) if the positive clones are positive clones, and the sequencing correct vector is named as BoWRKY 33-PTY.

Construction of heterologous overexpression arabidopsis thaliana and BoWRKY33 VIGS gene silencing cabbage mustard of BoWRKY33 gene

Agrobacterium GV3101 containing recombinant plasmid 35Spro: BoWRKY33 was inoculated into 200mL of LB liquid culture medium and shake-cultured at 28 ℃ and 200rpm until late logarithmic growth (OD600 of about 1). The cells were centrifuged at 4000rpm for 10 minutes, and 200mL of a staining solution (sucrose 50 g.L-1, MS salt 2.2 g.L-1, Silwet 100. mu.L.L-1, 6-BA 10. mu.L.L-1) was added to suspend the cells. Arabidopsis thaliana Col-0 plants in full-bloom stage were placed horizontally, and the inflorescences were allowed to soak in the suspension for 10 minutes. The dip-transfected and transformed Arabidopsis plants were kept flat and moisturized, placed in a 22 ℃ culture room for dark culture overnight, and then cultured upright and normally. After the seeds were matured and dried, the seeds were collected and sown on 1/2MS resistance selection medium to identify positive transformed plants. After the T1 generation seed individual plant is harvested, the seeds of each individual plant are respectively sown on a hygromycin culture medium, and the separation condition of the T2 generation is observed until a stable homozygous transgenic plant line, namely, the BoWRKY33 gene heterogeneously expresses the Arabidopsis thaliana is obtained.

Sowing cabbage mustard seeds in a nutrition pot, irradiating for 16 hours, and keeping the environment at 25 ℃ and the relative humidity of the environment at about 60% in darkness for 8 hours. When three leaves are in one heart, the leaves of the plant are infected. And (4) watering the plants for 16-24h before infection. Approximately 3. mu.g of BoWRKY33-PTY plasmid was used per plant at the time of infection, and empty PTY plasmid was inoculated per plant in the control group. Before infection, a small amount of green silicon carbide is uniformly scattered on two leaves of a plant, then a proper amount of plasmid solution is absorbed by a pipette and dropped on the plant leaves, the plant leaves are rubbed gently back and forth for 3 to 4 times, after 1 to 2 minutes, the rubbed place is washed by purified water for 15 seconds, and the excessive water is completely absorbed by absorbent paper. Plants were returned to normal growth conditions after 12 hours of growth in the dark following inoculation.

Remarks explain: the separation ratio of long side roots to non-long side roots on the culture medium of hygromycin (50mg/L) of the seeds meets 3: 1. and the gene expression quantity is increased by more than two times, belonging to the over-expression condition; VIGS gene silencing which meets the condition that the expression quantity of the seed gene is reduced by more than 50 percent. 3 over-expression strains BoWRKY33OX-1, BoWRKY33OX-3 and BoWRKY33OX-4 with higher gene transcription level and 2 gene-silenced strains PTY-2 and PTY-3 with lower transcription level are selected as research objects.

Fifth, extraction and expression analysis of RNA

RNA was extracted using Trizol extraction (Takara, Japan) with minor modifications. First, the plant material was frozen with liquid nitrogen, ground into powder in a grinder (60 Hz, 60 sec), added with 1mL of the extract, shaken vigorously for 2min, and allowed to stand at room temperature for 5 min. Then 200. mu.L of chloroform was added, shaken vigorously for 2min, centrifuged at 12000rpm at 4 ℃ for 15 min, the uppermost aqueous phase was transferred to a new centrifuge tube from which RNA degrading enzymes were removed, and the procedure was repeated once. Next, an equal volume of isopropanol was added, allowed to stand at room temperature for 10min, and centrifuged at 12000rpm at 4 ℃ for 10 min. The supernatant was discarded, 1mL of 75% ethanol was added to wash the precipitate, the precipitate was centrifuged at 12000rpm at 4 ℃ for 5min, the procedure was repeated once, the precipitate was dried at room temperature for 10min, and the precipitate was dissolved in 30. mu.L of EPC water. The concentration was measured with Nanodrop, followed by reverse transcription of RNA to cDNA using Prime Script RT Master Mix (Takara, Japan). Real-Time quantitative PCR (Real-Time qPCR) the reagent used was SYBR Green PCR Master Mix (Takara, Japan) and the instrument was Applied Biosystems Step One Real-Time PCR Systems (Applied Biosystems, USA). The arabidopsis AtACIN7 and Chinese kale BoACTIN7 are used as internal reference genes, and the relative expression quantity of the genes adopts 2 ^-ΔΔCTAnd (5) analyzing and calculating the method.

RT-BoACTIN7-F：GATCGAGCACGGTATTGTAAGC

RT-BoACTIN7-R：CCCACTAGCGTAGAGAGAAAG

RT-BoWRKY33-F:CAACCATCGGTTGTCCAGTG

RT-BoWRKY33-R:TTGCACCTGTCTGTTTGTGG

RT-MYB51-F：CTACAAGTGTTTCCGTTGACTCTGAA

RT-MYB51-R：ACGAAATTATCGCAGTACATTAGAGGA

RT-CYP83B1-F:GGCAACAAACCATGTCGTATCAAG

RT-CYP83B1-R:CGTTGACACTCTTCTTCTCTAACCG

RT-CYP81F2-F:TGGCTATGCGTAAACTCGTG

RT-CYP81F2-R:CCGGTAAACTTCAAAATGGTG

RT-IGMT1-F：GAGCCGATTTGCAGGTTCTT

RT-IGMT1-R：ACGCATCTCCTCCTTCTAGC

RT-IGMT2-F：GCTAGAAGGAGGAGATGCGT

RT-IGMT2-R：ACCTCCCACATCAACCAACA

RT-PEN2-F：CGAGTGGAACAGTGGATATGG

RT-PEN2-R：CATTTTCGGGTATCGTCTAAGC

RT-BoMYB51.1-F：TTCGGAGTTAACGGTGACACTTG

RT-BoMYB51.1-R：GTTCTTAAACAGAGTAGCTAATAGGTTC

RT-BoCYP81F2.1-F:TCTAACAAACAGGCCGCACT

RT-BoCYP81F2.1-R:TACGAACGGAGAGGAACCCT

RT-BoIGMT1-F：TTGATGGCCGTGAGACTAGC

RT-BoIGMT1-R：GCATCCGGTCCAACAAAACC

RT-BoIGMT2-F：GACCGACGAAGACTGCGTTA

RT-BoIGMT2-R：CTCGGCTCGTGACCTTTCTT

RT-BoPEN2-F：AGCGAAACAAGGAGGGTCAG

RT-BoPEN2-R：AATGGCGTGGATGTGTCCTT

As shown in FIG. 1, the relative expression level of BoWRKY33 was the highest in root (root) and leaf (leaf) of Brassica juncea, and the expression level was the lowest in silique. The relative expression level of BoWRKY33 in roots was 111 times that in siliques, and the relative expression level in leaves was 91 times that of siliques. The relative expression of BoWRKY33 in canola (flower) and seed (seed) was at an intermediate level, 8 and 24 times that of siliques, respectively. The relative expression level of the BoWRKY33 in the leaf of cabbage mustard is very high, which means that the influence on the nutritional quality and the resistance quality of the cabbage mustard is large.

According to the figure 2, the expression levels of the heterologous BoWRKY33 over-expressed Arabidopsis BoWRKY33OX-1, BoWRKY33OX-3 and BoWRKY33OX-4 in different strains are increased to different degrees, the expression levels of the glucosinolate transcription factor MYB51, the glucosinolate synthesis genes CYP83B1, CYP81F2, IGMT1 and IGMT2 are increased, and the expression levels of the glucosinolate degradation gene 2 in the heterologous BoWRPEN KY33 over-expressed Arabidopsis are increased compared with that of the wild type WT.

According to the figure 3, in the BoWRKY33 VIGS gene silencing Brassica juncea PTY-2 and PTY-3 of different strains, the gene expression level of BoWRKY33 is reduced to about 20% of that of the control group, the glucosinolate transcription factor BoMYB51.1 in Brassica juncea, the synthetic genes BoCYP81F2.1, BoIGMT1 and BoIGMT2 of glucosinolate in Brassica juncea and the degradation gene BoPEN2 of glucosinolate in Brassica juncea are reduced to different degrees compared with the PTY of the control group.

The results of gene expression levels shown in FIGS. 2 and 3 show that: cabbage mustard BoWRKY33 positively regulates the expression of glucosinolate-related genes.

Six, study of alternaria brassicae black spot disease

The alternaria brassicae is cultured by adopting a PDA (potato dextrose agar) culture medium, the activated alternaria brassicae is streaked on the PDA culture medium by using a sterilized pipetting tip, a culture dish is sealed by using a sealing film, the culture dish is cultured for 8-10 days at the temperature of 20-25 ℃, and then spores are collected. Eluting conidia with sterile water, filtering with 4 layers of gauze, counting with a hemocytometer, and making conidia into 5 × 10⁵one/mL. After arabidopsis grows for four weeks, sucking 5 mu L of drip liquid at the center of the leaf by using a liquid transfer machine, sealing the drip liquid by using a sealing film, culturing at 22 ℃, preserving moisture for 3-4 days, observing the disease occurrence condition and counting the size of a disease spot, and repeating each group of experiments at least for 3 times.

The inoculation step of Alternaria brassicae of Brassica juncea is similar to that of Arabidopsis thaliana, leaf of Brassica juncea with similar growth state is taken, and conidium concentration is 5 × 10⁵Spores per mL were inoculated by pipetting 100. mu.L of the spot into the center of the leaf and observing the size of the plaque area after 4 to 5 days. After uniform photographing of the plaque area, measurement and statistics are carried out by using Image J software.

From fig. 4 it can be seen that: overexpression of 35S: the disease condition of the plant of the BoWRKY33 strain is light; from fig. 5 it can be seen that: the gene silencing strain WRKY33-PTY cabbage mustard has serious disease.

Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by the person skilled in the art from the present disclosure are to be considered within the scope of the present invention.

Sequence listing

<110> Zhejiang university

<120> cabbage mustard BoWRKY33 gene and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1473

<212> DNA

<213> cabbage mustard (Brassica oleracea var. alboglabra Bailey)

<400> 1

atggctgctt cttccctcct tcctatagac aataacacaa ccagacaaaa catgagtggt 60

tctgctaact ggtcacgaag atcatcagca tctttggaag atcttgagat cccaaacttt 120

agatcttttg ctccttcttc agtctcaatc tctccttcaa cttgtttcag tccctctgtt 180

ttccttgatt cccctgcttt tgttgcctcc tctgctaacg ttcttgcttc tccaaccaca 240

ggagctctta ttacaaacga aaggaatcag aaaaatgtaa cgaaggaaga gaagaacaac 300

aacaacaaca ttaacttctt cgatttctca tttcagacac aatcatcagc actttctgca 360

ccaacaacaa cagcaacaaa cagttctatc tttcagtcac aggaacaaga gaggaagaac 420

cagtcagatc aatggagcca aactctaaac aacagcaaca atcaacaagc tggttcttac 480

aatggaaggg agcaaaggaa aggagaggat ggttacaact ggagaaagta cggtcagaaa 540

caggtgaaag ggagcgagaa tcctcggagt tattacaagt gtactttccc aagctgtccg 600

acaaagaaga aagtcgagag atctttggaa ggtcagatca cagagattgt ctataaggga 660

agccataacc atcccaagcc tcagtccact agaagatcat catcttcttc ttcatcgaca 720

tttcattcag ctgtgttcaa tgccagcctt gataatagtt tcagtcactc tgattccctt 780

gcaatccaac aagatgataa cactacttct ggttctgttg gagacgatga gtttgaacga 840

ggctcatcgg ttgtcagcag agaagaagaa tgtgggagtg aacctgaagc aaagaaatgg 900

aaaggagaaa gtgaaacaaa cggtgggaat ggtaatggaa gcaagacagt gagagagcca 960

agaattgttg tgcagacaac aagtgatatc gacattcttg acgacggtta cagatggaga 1020

aaatacggcc aaaaagtcgt taaaggaaac ccaaatccaa gaagctacta caagtgcaca 1080

accatcggtt gtccagtgag aaaacacgtt gagagagcat cacaagatct gagagcagta 1140

atcacaacct acgaagggaa acataaccac gacgtacctg cagctcgtgg tagcggttac 1200

gccacaaaca ggcaggtgca agacccttct tcagccccaa ttagaccagc tgctatagct 1260

ggtcacacca actacactac ttctcgacca ccatatacgc tccagatgct tcaaaacaac 1320

aacaacacta atgcagggcg ttttggttac gctatgaaca gtcacaacaa cattcaaacg 1380

caacaaaacg agtttgttgg tggtggattc tctagagcaa aagaagaacc aaacgatgag 1440

tcctcctcgt tttttgattc gttcttgtcg tga 1473

<210> 2

<211> 490

<212> PRT

<213> cabbage mustard (Brassica oleracea var. alboglabra Bailey)

<400> 2

Met Ala Ala Ser Ser Leu Leu Pro Ile Asp Asn Asn Thr Thr Arg Gln

1 5 10 15

Asn Met Ser Gly Ser Ala Asn Trp Ser Arg Arg Ser Ser Ala Ser Leu

20 25 30

Glu Asp Leu Glu Ile Pro Asn Phe Arg Ser Phe Ala Pro Ser Ser Val

35 40 45

Ser Ile Ser Pro Ser Thr Cys Phe Ser Pro Ser Val Phe Leu Asp Ser

50 55 60

Pro Ala Phe Val Ala Ser Ser Ala Asn Val Leu Ala Ser Pro Thr Thr

65 70 75 80

Gly Ala Leu Ile Thr Asn Glu Arg Asn Gln Lys Asn Val Thr Lys Glu

85 90 95

Glu Lys Asn Asn Asn Asn Asn Ile Asn Phe Phe Asp Phe Ser Phe Gln

100 105 110

Thr Gln Ser Ser Ala Leu Ser Ala Pro Thr Thr Thr Ala Thr Asn Ser

115 120 125

Ser Ile Phe Gln Ser Gln Glu Gln Glu Arg Lys Asn Gln Ser Asp Gln

130 135 140

Trp Ser Gln Thr Leu Asn Asn Ser Asn Asn Gln Gln Ala Gly Ser Tyr

145 150 155 160

Asn Gly Arg Glu Gln Arg Lys Gly Glu Asp Gly Tyr Asn Trp Arg Lys

165 170 175

Tyr Gly Gln Lys Gln Val Lys Gly Ser Glu Asn Pro Arg Ser Tyr Tyr

180 185 190

Lys Cys Thr Phe Pro Ser Cys Pro Thr Lys Lys Lys Val Glu Arg Ser

195 200 205

Leu Glu Gly Gln Ile Thr Glu Ile Val Tyr Lys Gly Ser His Asn His

210 215 220

Pro Lys Pro Gln Ser Thr Arg Arg Ser Ser Ser Ser Ser Ser Ser Thr

225 230 235 240

Phe His Ser Ala Val Phe Asn Ala Ser Leu Asp Asn Ser Phe Ser His

245 250 255

Ser Asp Ser Leu Ala Ile Gln Gln Asp Asp Asn Thr Thr Ser Gly Ser

260 265 270

Val Gly Asp Asp Glu Phe Glu Arg Gly Ser Ser Val Val Ser Arg Glu

275 280 285

Glu Glu Cys Gly Ser Glu Pro Glu Ala Lys Lys Trp Lys Gly Glu Ser

290 295 300

Glu Thr Asn Gly Gly Asn Gly Asn Gly Ser Lys Thr Val Arg Glu Pro

305 310 315 320

Arg Ile Val Val Gln Thr Thr Ser Asp Ile Asp Ile Leu Asp Asp Gly

325 330 335

Tyr Arg Trp Arg Lys Tyr Gly Gln Lys Val Val Lys Gly Asn Pro Asn

340 345 350

Pro Arg Ser Tyr Tyr Lys Cys Thr Thr Ile Gly Cys Pro Val Arg Lys

355 360 365

His Val Glu Arg Ala Ser Gln Asp Leu Arg Ala Val Ile Thr Thr Tyr

370 375 380

Glu Gly Lys His Asn His Asp Val Pro Ala Ala Arg Gly Ser Gly Tyr

385 390 395 400

Ala Thr Asn Arg Gln Val Gln Asp Pro Ser Ser Ala Pro Ile Arg Pro

405 410 415

Ala Ala Ile Ala Gly His Thr Asn Tyr Thr Thr Ser Arg Pro Pro Tyr

420 425 430

Thr Leu Gln Met Leu Gln Asn Asn Asn Asn Thr Asn Ala Gly Arg Phe

435 440 445

Gly Tyr Ala Met Asn Ser His Asn Asn Ile Gln Thr Gln Gln Asn Glu

450 455 460

Phe Val Gly Gly Gly Phe Ser Arg Ala Lys Glu Glu Pro Asn Asp Glu

465 470 475 480

Ser Ser Ser Phe Phe Asp Ser Phe Leu Ser

485 490

<210> 3

<211> 560

<212> DNA

<213> cabbage mustard (Brassica oleracea var. alboglabra Bailey)

<400> 3

ttacggtgaa cccaactctc cccgaccaag gacccgaaac aagactcgac acccactttc 60

tcccaccgtc tcggctccct ctccatttcg atctcccacc ggctatcacc ccacccccgg 120

tttccacaag cgtcgacccg ccacaagcga aagctagccc cgtctaccca ggcgagttct 180

tcgattctct ggcggcgttc ttcttaccag cacacgaccc atcaacaagg gaaatactcc 240

acaaagatca atctagcaac cagttcccct ggttcgaccg acccttcagc ctgtcctgcc 300

agccctcaag tctgatttcc gccaagcatg cacccaacca tgatccgacc cttctaccgg 360

cctccatcaa caaacgcttg cgattcagac ccagtgactc accgcaccaa atcaccgcgg 420

acgacgtggt cctaggcttg attccctgct tttgttgcct cctctgctaa cgttctaaac 480

gttacgagga ggcaacaaaa gcaggggaat caagtaagtt ctcgatcttc aaaatcgtta 540

gctcgccagt tagcgaggtc 560

Claims

1. The application of the gene BoWRKY33 is characterized in that: BoWRKY33 positively regulates expression of glucosinolate-related genes; the nucleotide sequence of the gene BoWRKY33 is shown as SEQ ID NO: 1 is shown in the specification;

related genes for glucosinolates are: glucosinolate transcription factorMYB51Synthetic genes for glucosinolatesCYP83B1、 CYP81F2、IGMT1AndIGMT2glucosinolate degradation genesPEN2。

2. The use of the gene BoWRKY33 as claimed in claim 1, wherein: glucosinolate transcription factor when over-expressing BoWRKY33 MYB51Synthetic genes for glucosinolatesCYP83B1、CYP81F2、IGMT1AndIGMT2glucosinolate degradation genesPEN2Is raised.

3. Use of the gene BoWRKY33 according to claim 2, wherein: the overexpression vector is35Spro:: BoWRKY33-YFP。

4. Use of the gene BoWRKY33 as claimed in any one of claims 1-3, wherein: improving the resistance of the cabbage mustard to alternaria alternata.