CN107354166B - Panax notoginseng β -1,3 glucanase gene PnGlu1 and application thereof - Google Patents

Abstract

The invention discloses a panax notoginseng β -1,3 glucanase gene PnGlu1 and application thereof, and discloses a panax notoginseng disease course related protein 2 family genePnGlu1The nucleotide sequence is shown in SEQ ID NO: 1, codes β -1,3 glucanase, and is proved by related technical research of functional genomicsPnGlu1The gene has the function of improving the plant antifungal property, and the invention is used for resisting the fungiPnGlu1The gene is constructed on a plant expression vector and is transferred into tobacco for over-expression, and the transgenic tobacco plant has strong in-vitro antifungal activity and over-expressionPnGlu1The transgenic tobacco has obvious inhibition effect on the growth of four fungi, such as staphylococcus, fusarium verticillium, fusarium solani, colletotrichum gloeosporioides and the like.

Description

Panax notoginseng β -1,3 glucanase genePnGlu1And uses thereof

Technical Field

The invention relates to the field of molecular biology and related technical research of genetic engineering, in particular to a panax notoginseng β -1,3 glucanase genePnGlu1And applications thereof.

Background

The plant pathogenic fungi refer to fungi which parasitize plants and cause diseases, and the recorded plant pathogenic fungi can cause more than 8000 kinds of plant diseases, account for 70-80% of the total number of the plant diseases and belong to a first main pathogen. The fungal diseases of crops are controlled in the following modes: breeding and adopting resistant crop varieties; the use of chemical fungicides; rotation is adopted, and the propagation of bacteria-bearing soil and pathogenic plant materials is avoided. However, a lot of manpower, material resources and time are needed to screen out the resistant crop varieties; the chemical bactericide has higher cost, can cause plant pathogenic fungi to generate drug resistance, and the residual toxicity of the chemical bactericide can pollute the environment; the crop rotation can not solve the problem of the harm of plant pathogenic fungi fundamentally. In recent years, with the continuous development of molecular biology theory and technology, people can not only deeply understand the interaction mechanism of plants and pathogens from the molecular level, but also can quickly and efficiently culture new varieties of disease-resistant crops through genetic engineering, and the method is a novel method for improving the disease resistance of plants.

β -1,3-glucanase disease course related proteins second family members (van LOON L C, van STRIEN EA. The family of microorganisms related proteins, The hair activities, and The mixed complex an analysis of PR1 type proteins. physical Mol Plant Pathol, 1999,55: 85-97.), β -1,3-glucanase are widely distributed in higher plants, including pollen tube wall, seminal cell wall, sieve end wall, etc., which play an important role in normal Plant growth and development, furthermore, β -1,3-glucanase plays an important role in The disease resistance process of plants (Europe, Hamburg. β -1,3-glucanase and its genes. Chinese bioengineering, 2002, 22(6): 18-23.). 18-23. in The disease resistance process of plants, 357. in The resistance process of Plant pathogens, including alkaline glucanase, Escherichia coli resistance, 2- β, and more than three types of alkaline glucanase, including The resistance to bacterial pathogens, alkaline glucanase, The resistance process of bacterial cell wall, The alkaline glucanase, The resistance process of Plant 351-3- β, The three types of bacterial genes, including The resistance to bacterial pathogen, The alkaline glucanase, The resistance process of bacterial resistance to hydrolysis, The alkaline glucanase, The resistance of Plant, The resistance of bacterial cell wall, The alkaline glucanase, The resistance of Plant, The resistance of The alkaline glucanase, The resistance of The alkaline glucanase, The resistance of The.

The known β -1,3 glucanases all belong to the seventeenth family of glycosyl hydrolases, the members of which have the common sequence structure (LIVM) 2X 2 (LIVMFYW) 32 (STAG) 2E 2(ST) 2G 2W 2P 2(ST) 2X 2G, e.g. VNVVVSESGWPSDG in the pea β -1,3 glucanase (Chang M, Culley D E, Hadwiger L A. nucleic acid sequence of a pea (a) hydrolasePisum sativumL.) β -1,3 glucanase gene plant Physiol, 1993, 101: 1121) 1122) in which several conserved glutamic and aspartic acid residues in the amino acid sequence may be involved in the hydrolysis of glycosidic bonds catalyzed by β -1,3 glucanaseAlkaline β -1,3 glucanase generally has a vacuolar localized carboxy-Terminal Polypeptide (CTPP) structure, which often contains glycosylation sites and CTPP cleavage signal amino acid structures, the absence of CTPP making the glucanase secreted extracellularly the presence of phenylalanine-glycine dipeptide in CTPP may be a signal for CTPP cleavage, therefore, the presence or absence of CTPP becomes an important basis for the classification of β -1,3 glucanase, furthermore, the β -1,3 glucanase mature peptide contains several relatively conserved segments, in particular a highly conserved catalytic site.

The structural core of the Fungal cell wall is a complex formed by β -1,3 branched β -1,3 glucans and chitin (Adams DJ. Fungal cell walls microorganisms, 2004.150: 2029-Phytophthora capsici) The growth of hyphae is inhibited (Kim Y J, Hwang B K. Isolation of a basic 34 kloDalton β -1,3-glucanase with inhibition activity againstPhytophthora capsicifrom pepper stems. Physiological&Molecular Plant Pathology, 1997,50(2): 103-. In the soybeans (Glycine max) In particular, it has been found that the Glucan Elicitor Binding Protein GEBP (GEBP), localized on the plasma membrane of soybean root cells, is capable of specifically Binding to the oligosaccharide elicitors released during the degradation of β -1,3 Glucan and inducing a defence response in plants (Ham K S, Wu S C, Darvill A G, et al. Fungal pathogens seed an inhibitor Protein differentiation enzymes of plants of Plant pathogenesis-related end- β -1,3-glucanases Plant journal ofThe bacteriostatic effect is more obvious when the glucanase β -1,3 and chitinase act together, and the oligosaccharide released from the fungal cell wall can be used as an exciting factor of various disease-resistant reactions of plants in the hydrolysis process to induce the comprehensive disease-resistant reaction of the plants (Klarzynski O, Plese B, Joubert JM, et al. Linear beta-1,3 glucans ore oligonucleotides of Plant responses endobocco. Plant Physiol, 2000.124 (3): 1027-.

Notoginseng (radix Notoginseng)Panax notoginseng) Mainly produced in inkstone county, marshall, western domain, guannan, mahonia kuaiensis slope, funing, qibei, etc. of Yunnan wenshan mountain, and planted in shanyang, Jingxi, Tiandong, debao, etc. of Guangxi province. Panax notoginseng (Burk.) F.H. Chen has long history, high yield and good quality, and is known as "Wen Notoginseng" and "Tianqi" as famous genuine herbs. The diseases and insect pests of the pseudo-ginseng are serious when the pseudo-ginseng grows in a shady and shaded environment all the year round, and according to statistics, the diseases and insect pests of the pseudo-ginseng are about more than 20. Wherein, the main diseases are root rot, black spot, round spot, epidemic disease, powdery mildew, slug, cutworm, aphid, scale insect, inchworm and the like, and the panax notoginseng causes serious loss due to the harm of diseases and insects every year. Strengthening the prevention and control of diseases and insect pests of the panax notoginseng is a main measure for ensuring the yield and the quality of the panax notoginseng. In addition, it is very important to know the molecular mechanism of disease-resistant defense reaction of panax notoginseng and clone and apply the related disease-resistant genes.

Disclosure of Invention

The invention aims to clone β -1,3 glucanase full-length gene with antifungal activity from panax notoginsengPnGlu1Notoginseng β -1,3 glucanase genePnGlu1The nucleotide sequence is shown as SEQ ID NO: 1, the gene cDNA full-length sequence is 1417bp, comprises an open reading frame of 1140bp, a 5 'untranslated region of 63bp and a 3' untranslated region of 214bp, and codes as SEQ ID NO: 2 in the sequence table 2.

The present invention separates and clones complete cDNA segment of antifungal related gene of notoginseng and utilizes Agrobacterium tumefaciens (A. tumefaciens)Agrobacterium tumefaciens) The target gene is transferred into a receptor plant by a mediation method and is over-expressed, and whether the gene has antifungal property or not is verified by further experimentsThe activity lays a foundation for the later-stage utilization of the gene to improve the capability of tobacco and other plants to resist fungal diseases. The inventors named this genePnGlu1。

The plant β -1,3 glucanase can be induced by pathogens, herbivores and other biological or non-biological inducers, mechanical treatment or stimulation, chitin and β -1,3 glucan are used as main components of the cell wall of the fungus, β -1,3 glucan covers the outermost layer of the cell wall, and the glucanase has hydrolysis effect on exposed polysaccharides, β -1,3 glucanase hydrolyzes the cell wall of the fungus, thins the cell wall at the top end of the hypha of the pathogens, further causes imbalance between turgor pressure and cell wall tension, and further causes the top end of the hypha to swell/break and finally die.

The invention relates to the separation ofPnGlu1The DNA fragment of (4) and the function thereof were identified, and sequence homology analysis was conducted on the gene to find outPnGlu1Encoded protein sequence and walnut: (Juglans regia) Cocoa (c)Theobroma cacao) Capsicum annuum (A) and (B)Capsicum annuum) The dextranase protein similarity of (a) was 67%, 66% and 63%, respectively.PnGlu1The gene encodes a protein consisting of 379 amino acid residues, the molecular mass of the protein is 41.8KD, and the isoelectric point (pI) of the protein is 7.75. The protein sequence comprises 29 acidic amino acids (D, E) and 34 basic amino acids (K, R, H). The over-expression sequence shown in SEQ ID of the sequence table can enhance the effect of tobacco on staphylococcus (Botryosphaeria dothidea) Fusarium verticillatum (A)Fusarium verticillioide) Fusarium solani (F.solani) (II)F. solani) Colletotrichum gloeosporioides (B) ((B))Colletotrichum gloeosporioides) Resistance of (2).

The invention relates to a panax notoginseng β -1,3 glucanase genePnGlu1The method is applied to improving the resistance of tobacco to the botrytis cinerea, fusarium verticillioides, fusarium solani and colletotrichum gloeosporioides, and specifically comprises the following steps:

(1) inoculating Fusarium solani to radix Notoginseng, collecting radix Notoginseng 24 hr after inoculation, extracting total RNA to obtain extractAmplifying total RNA as a template by reverse transcription-polymerase chain reaction (RT-PCR) with oligo (dT)18 as a reverse transcription primerPnGlu1Then connecting the coding region to a pMD-18T vector, and obtaining a clone with a target gene through sequencing;

(2) using restriction endonucleasesBamHI andEcoRI enzyme digestion pMD-18T-PnGlu1Obtaining target gene fragment by glue recovery, using the same restriction enzyme to enzyme-cut plant expression vector pCAMBIA2300s, obtaining required vector large fragment by glue recovery, and obtaining the obtained vector large fragmentPnGlu1Connecting the gene fragment with the pCAMBIA2300s fragment to construct a plant overexpression vector, and then transferring the constructed recombinant vector into tobacco to express through the mediation of agrobacterium tumefaciens;

(3) screening transformants by using a resistance marker on the recombinant vector T-DNA, obtaining a real transgenic plant through PCR and RT-PCR detection, analyzing the inhibition activity of the transgenic plant protein on the growth of fungi, and finally screening the transgenic plant with obviously enhanced resistance to the fungi.

The invention provides a new method for improving the resistance of plants to fungal diseases, the defects of traditional breeding can be overcome by cultivating disease-resistant plants by means of genetic engineering, the breeding period is shortened, the operation is simple, and high-resistance materials are easy to obtain. The invention is derived from notoginsengPnGlu1The gene can enhance the resistance of plants to fungi, and can be introduced into tobacco to produce new varieties and new materials with fungal resistance. The use of genetic engineering techniques to reduce diseases brought by fungi has obvious advantages and irreplaceable importance. The invention can provide convenience for large-scale production of crops, flowers and the like, greatly reduce the use of chemical pesticides, save the cost for agricultural production, reduce environmental pollution and improve the management level, thereby having wide market application prospect.

Drawings

FIG. 1 is a drawing of the present inventionPnGlu1Schematic diagram of PCR detection result of transgenic tobacco genome DNA, in which: the Marker is DL2000 DNA Marker (Dalibao biology); the positive control is plasmid pMD-18T-PnGlu1Is a diePCR products of the plate; WT is the product of PCR using total DNA of non-transgenic tobacco (wild type) as template;

FIG. 2 shows the positivity of the present inventionPnGlu1In transgenic tobaccoPnGlu1A graph of the results of expression analysis at the transcriptional level; in the figure: marker is DL2000 DNA Marker (Dalibao biology); WT is a PCR product with non-transgenic tobacco total RNA reverse transcription cDNA as a template; the positive control was plasmid pMD-18T-PnGlu1A PCR product as a template;

FIG. 3 is a drawing of the present inventionPnGlu1The in vitro bacteriostatic activity effect graph of the transgenic tobacco; in the figure, a, b, c and d are respectively the bacillus mucilaginosus, the fusarium verticillioides, the botrytis cinerea and the fusarium solani; WT is the total protein of wild type tobacco; buffer is a blank control, i.e. a no protein control (Buffer used for protein extraction).

Detailed Description

The present invention is further illustrated by the following figures and examples, but the scope of the present invention is not limited to the above description, and the examples are conventional methods unless otherwise specified, and reagents used are conventional commercially available reagents or reagents formulated according to conventional methods unless otherwise specified.

Example 1:PnGlu1full-Length Gene cloning and sequence analysis

Preparing conidium suspension of Fusarium solani, dipping root to inoculate annual Notoginseng radix for 30min, and extracting total RNA from Notoginseng radix root 24 h after inoculation. Grinding pseudo-ginseng roots into powder by using liquid nitrogen, then transferring the powder into a centrifuge tube, extracting total RNA by adopting a guanidinium isothiocyanate method, and synthesizing a first cDNA chain by adopting reverse transcriptase M-MLV (promega) and taking the total RNA as a template, wherein a reaction system and an operation process are as follows: taking 5 μ g of Total RNA, adding 50 ng oligo (dT), 2 μ L dNTP (2.5 mM each) and DEPC water in turn to make the reaction volume be 14.5 μ L; after mixing, heating and denaturation at 70 ℃ for 5 min, then rapidly cooling on ice for 5 min, then adding 4 μ L of 5 XFirst-stand buffer, 0.5 μ L of RNase (200U) and 1 μ L M-MLV (200U) in sequence, mixing and centrifuging for a short time, bathing at 42 ℃ for 1.5 h, taking out, heating at 70 ℃ for 10 min, and terminating the reaction. The first strand cDNA is synthesized and stored at-20 deg.C for further use.

By the first strand of the synthesisAmplification of the target Gene Using cDNA as templatePnGlu1The sequences of the upstream and downstream primers used were 5 'TCATCAGTACGTAGTTCTCTTACTTC 3' and 5 'AGCTAAGCTAGTTACATGTCACTCT 3', respectively. Advantage is taken^TM2 PCR Enzyme (Clontech) amplifies the target gene; and (3) PCR reaction conditions: 4 min at 95 ℃; 30 cycles of 95 ℃ for 30s, 54 ℃ for 30s, 72 ℃ for 80 s; 10 min at 72 ℃; the reaction system (20. mu.L) was 1. mu.L of cDNA, 2. mu.L of 10 × Advantage2 PCR Buffer, 1.8. mu.L of 50 × dNTP Mix (10 mM each), 0.2. mu.L of forward primer (10. mu.M), 0.2. mu.L of reverse primer (10. mu.M), 0.2. mu.L of Advantage2 PCR Polymerase Mix, 14.6. mu.L of PCR-Grade water; after the PCR was completed, 5. mu.L of the resulting mixture was subjected to agarose gel electrophoresis to examine the specificity and size of the amplified product.

The obtained PCR product only has one DNA band, so that the TA cloning can be directly carried out on the PCR product, the kit used is pMD18-T vector kit (Dalibao biology), the reaction system and the operation process are that 1.5 microliter of PCR product is taken, 1 microliter of pMD18-T vector (50 ng/microliter) and 2.5 microliter of 2 Xligation solution I are sequentially added, the mixture is evenly mixed and placed at 16 ℃ for overnight reaction, the Ligation product is transferred into escherichia coli DH5 α by adopting a heat shock transformation method, LB solid culture medium containing ampicillin (ampicilin, Amp) is used for screening positive clones, a plurality of single colonies are selected, after bacteria shaking, amplification is carried outPnGlu1Identifying the multiple cloning site insertionPnGlu1The clones identified are sequenced and finally obtainedPnGlu1The full-length cDNA was 1417bp and was found to contain a 1140bp open reading frame by NCBI ORF finder (http:// www.ncbi.nlm.nih.gov/gorf. html) analysis (see sequence listing),PnGlu1encodes a protein PnGlu1 containing 379 amino acids, the molecular weight of the protein is 41.8k D, and the isoelectric point (pI) is 7.75, which indicates that the protein is basic protein.

Example 2: construction of plant overexpression vectors

The insertion is extracted by adopting a SanPrep column type plasmid DNA small extraction kit (Shanghai worker)PnGlu1The Escherichia coli plasmid pMD-18T-PnGlu1And the plasmid of the plant expression vector pCAMBIA2300s, and 1. mu.L of the plasmid was subjected to agarose gel electrophoresis to detect the extracted substanceThe integrity and concentration of the granules are high and low; using restriction endonucleasesBamHI (TaKaRa) andEcoRI (TaKaRa) against plasmid pMD-18T-PnGlu1And pCAMBIA2300s (100 mu L system), wherein the reaction system and the operation process are as follows: taking 20. mu.L of pMD-18T-PnGlu1And pCAMBIA2300s plasmid, 10. mu.L of 10 XHbuffer, and 4. mu.L ofBamHI、6μLEcoRI、60μL ddH₂O, mixing uniformly, centrifuging for a short time, and reacting at 37 ℃ overnight; all the products of the digestion are spotted in agarose gel for electrophoresis, and thenPnGlu1The fragments and the pCAMBIA2300s vector large fragment are respectively subjected to gel recovery, and a SanPrep column type DNA gel recovery kit (Shanghai's engineering) is used in the whole process; taking 1 microliter of the recovered product, detecting the size and concentration of the recovered fragment by agarose gel electrophoresis, and storing at-20 ℃ for later use.

The recovered DNA was purified by using T4 DNA Ligase (TaKaRa)PnGlu1The DNA fragment and the pCAMBIA2300s vector fragment were ligated, and the reaction system (20. mu.L) and the procedure were as follows: taking 10 μ LPnGlu1The DNA fragment was added with 2. mu.L of vector DNA of AMBIA2300s, 2. mu.L of 10 XT 4 DNA Ligase Buffer, 1. mu. L T4 DNA Ligase, and 5. mu.L of ddH in this order₂O, mixing, centrifuging for a short time, reacting in water bath at 16 deg.C overnight, transferring the ligation product into Escherichia coli DH5 α by heat shock transformation, screening positive clones with solid culture medium containing 50 mg/L kanamycin (Km), selecting single colony shake bacteria, and amplifying with bacterial liquid as templatePnGlu1The specific primers of (1) are subjected to PCR, and selectedPnGlu1If the detected strain is positive, the clone successfully connected with pCAMBIA2300s is added with glycerol and stored at-80 ℃ for later use.

Extracting and purifying pCAMBIA2300s-PnGlu1A plasmid. Then the plant expression vector pCAMBIA2300s constructed above is frozen and thawed by liquid nitrogenPnGlu1Transferred into Agrobacterium tumefaciens LBA4404 competent cells. The operation steps are as follows: taking 2 μ g of pCAMBIA2300s-PnGlu1Adding plasmid into a centrifuge tube containing 200 μ L competent cells, mixing gently, ice-cooling for 5 min, transferring into liquid nitrogen, freezing for 1 min, and rapidly placing in 37 deg.C water bath 5min, immediately after ice bath for 2 min, 800. mu.L of LB liquid medium was added and cultured at 28 ℃ for 4 h with shaking. The activated agrobacterium is smeared on LB solid culture medium containing 50 mg/L Km and is statically cultured at 28 ℃. Selecting single colony shake bacteria, and amplifyingPnGlu1The specific primer of (2) is used for PCR to detect pCAMBIA2300s-PnGlu1If the positive clone is transferred into agrobacterium, adding glycerol into the positive clone, and storing the positive clone at-80 ℃ for later use.

Example 3: agrobacterium-mediated genetic transformation of plants and transgenic plant screens

The transgenic recipient in this experiment was tobacco, tobacco seeds were soaked in 75% ethanol for 30s, washed with sterile water and then washed with 0.1% HgCl₂Soaking for 8 min, washing with sterile water for several times, sowing on 1/2MS culture medium, dark culturing at 28 deg.C for 6 d, germinating, transferring to light incubator (25 deg.C, 16h/d light), and subculturing with 1/2MS culture medium once a month.

The preserved liquid containing pCAMBIA2300s was taken out from the-80 ℃ refrigeratorPnGlu1Agrobacterium LBA4404 strain of plasmid was inoculated into 5 mL LB liquid medium containing 50 mg/L Km and 20 mg/L rifampicin, and cultured at 28 ℃ until the medium became turbid. Sucking 1 mL of turbid bacterial liquid to an LB solid culture medium containing 50 mg/L Km, and culturing for 48 h at 28 ℃; then, appropriate amount of the agrobacteria on LB solid medium was scraped and inoculated into MGL liquid medium supplemented with 20 mg/L acetosyringone, and shake-cultured at 28 ℃ for 2-3 h to activate the agrobacteria.

Cutting leaves of aseptic seedling of tobacco into 1 cm²And completely soaking the left and right leaf discs in the MGL liquid culture medium containing the activated agrobacterium for 15 min, sucking bacterial liquid on the surfaces of the leaves by using sterile filter paper, placing the leaf discs on a co-culture medium for room temperature culture, wherein the co-culture medium for tobacco transformation is MS +0.02 mg/L6-BA +2.1 mg/L NAA +30g/Lsucrose +6g/L agar, and co-culturing for 2 days at 22 ℃ in the absence of light.

Transferring the co-cultured leaf discs to an MS screening culture medium added with antibiotics to be divided into seedlings, and screening transgenic plants. The tobacco screening culture medium is MS +0.5 mg/L6-BA +0.1 mg/L NAA +30g/L sucrose +6g/L agar +50 mg/L Km +200 mg/L cephamycin (cefixime sodium salt, Cef); during screening culture, the culture bottle is transferred to an illumination culture box for culture (25 ℃, 16h/d illumination and 8h/d darkness), after the tobacco grows out of buds, the MS culture medium containing 50 mg/L Km and 200 mg/L Cef is used for subculture, the regeneration plant needs to be further screened because the callus differentiation rate of the tobacco is higher, the tobacco regeneration seedling is transferred to the MS culture medium containing 50 mg/L Km to root the tobacco regeneration seedling, and finally the regeneration seedling with better rooting is selected for further detection.

Extracting genome DNA of transgenic tobacco plant leaf by CTAB method, collecting 1 μ L of the extracted genome DNA, detecting its integrity and concentration by agarose gel electrophoresis, and amplifying with the genome DNA of transgenic plant as templatePnGlu1After the PCR is finished, 8 mu L of the product is used for agarose gel electrophoresis to detect positive transgenic plants, the amplification result of part of tobacco transgenic plants is shown in figure 1,PnGlu1and (4) co-screening 47 positive transgenic plants from the transgenic tobacco.

Example 4: in transgenic tobaccoPnGlu1Expression analysis and antifungal Activity analysis of transgenic plants

Taking positive transgenic single plant and tender leaf of non-transgenic tobacco (wild type) to extract total RNA, reverse transcribing to generate first strand cDNA, and using it as template to make amplificationPnGlu1The specific primers are used for carrying out PCR, and each transgenic individual is analyzed according to the PCR resultPnGlu1The expression of transcription level, total RNA extraction and RT-PCR were performed in the same manner as in example 1, after PCR was completed, 5. mu.L of the DNA was subjected to agarose gel electrophoresis, and the results of detection of a part of individuals were shown in FIG. 2, and 31 transgenic individuals were detected in totalPnGlu1The expression was carried out at the transcriptional level in a large amount, and the numbers of these individuals were 1 to 31.

Inoculating a plurality of fungi stored in a laboratory on a PDA solid culture medium (200 g/L of potatoes, 15 g/L of agar and 20g/L of glucose), carrying out dark culture at 28 ℃, adding protein when bacterial colonies grow to the diameter of about 2-3 cm, and analyzing the in-vitro antifungal activity of a transgenic plant.

In order to prevent the extracted protein from being polluted by other mixed bacteria, the whole plant protein extraction process is aseptic operation, and 1 g of transgenic tobacco is taken firstlyPlacing single grass plants (numbered 1, 6, 13 and 21 respectively) and wild leaves into a mortar, adding 1 mL of protein extract (1M NaCl, 0.1M sodium acetate, 1% PVP, pH 6), and grinding thoroughly; transferring into 1.5 mL centrifuge tube, mixing, standing overnight at 4 deg.C, centrifuging at 4 deg.C for 30min (12,000 g/min), collecting supernatant, and determining total protein concentration with ultraviolet spectrophotometer. The total protein concentration of the transgenic and wild type plants is adjusted to 0.2 mug/muL, then 20 muL is respectively dropped on the sterile filter paper of each fungus culture medium, the total protein of different transgenic tobacco plants is added on the plate of each fungus, the total protein of the wild type tobacco and a blank control (solution for extracting the protein) are added in parallel, the growth of each treated fungus is observed after the fungus is cultured for several days at 28 ℃, and the growth of each treated fungus is evaluated according to the total protein concentrationPnGlu1The results of the in vitro antifungal activity of the transgenic tobacco are shown in FIG. 3,PnGlu1the transgenic tobacco protein has strong inhibiting effect on the growth of staphylococcus, fusarium verticillium, fusarium solani and colletotrichum gloeosporioides.

Sequence listing

<110> university of Kunming science

<120> panax notoginseng β -1,3 glucanase gene PnGlu1 and application thereof

<160>4

<170>PatentIn version 3.3

<210>1

<211>1417

<212>DNA

<213>Panax notoginseng

<220>

<221>mRNA

<222>(1)..(1417)

<220>

<221>5'UTR

<222>(1)..(63)

<220>

<221>CDS

<222>(64)..(1203)

<220>

<221>3'UTR

<222>(1204)..(1417)

<400>1

gcggggaata tcatacattt catcagtacg tagttctctt acttctgatt gctttatata 60

tatatgttct tcaccatgac tatattttcc agaagaacta ataacagttt cctcgtaatg 120

acacctatac tgcttcttct ggggtttatg attgcaagct ttaagattac aggggtagaa 180

tctgttggcg cgtgttatgg aatgctagga aacaatctcc cacctgcatc agaagttgta 240

aatctataca aatcatacaa ccttgatcga atgagactct acgatccaaa tcgagccgct 300

atacaagctc tacaaaactc taatatcgaa gttatgattg gtgtcccaaa ctcagacctc 360

cagcgtctgg ccaatgatcc tggctatgca tacgactggg tgtacggaaa tcttgtagat 420

tacccacaag tcaaatttcg gtacatagcc gtaggaaatg aagtgagtcc cattaacggt 480

ggcacagcct ggctagctcc gttcgtctta ccagccatgc aacacatcca aacggcagta 540

ctttcggcag ctcgactggc aaacacggtt aaggtgtcaa ccgcaataga tatgacatta 600

ataggaaact cttatccccc ttcacaaggt agctttaggg gagatattag ggcatatttt 660

gatccgatta ttcggtttct tgtcaacaac aatgcgccct tgctagctaa tgtgtacccg 720

tattttagcc acattgggaa tccgcgtgat atttctttgt cttacgcaat tttcactgct 780

ccggggccag tgatatggga caatggcctt ggttaccaga atcttttcga tgcaatgatg 840

gatgctttat atgcggctgt tgagagggcc ggaggtggct cgttgaaggt ggtggtatca 900

gaaactggat ggccgtctgc cggaggagtg gcgacaactt ttgataatgc gcgtaattat 960

tactctagat tgattcaaca tgtggaaaag ggaaccccta ggaggccggg gagactagag 1020

acctacatgt ttgcgacgtt tgatgaaaat aataaaaatc cagaatatga gaagcatttt 1080

ggattgtttt tcccaaataa gcagcccaag tttccactca gaatttccat gggtactgga 1140

tctggggata tcgtttctga tggaaactct actagtttgg gttgggttaa gagtgacatg 1200

taactagctt agctagaggg tttgtaatat aataatattg catgatttgc ctttacatgc 1260

atgctttgag tttgggttga ataagtgtaa gcgatcatga tatgaatatt gatgtttgat 1320

ttaatttctt tgtatttaat ttgtaagttt ttgataagtg taaacaagga cgtttcatgt 1380

ttgttttgta caaaaaaaaa aaaaaaaaaa aaaaaaa 1417

<210>2

<211>379

<212>PRT

<213>Panax notoginseng

<400>2

Met Phe Phe Thr Met Thr Ile Phe Ser Arg Arg Thr Asn Asn Ser Phe

1 5 10 15

Leu Val Met Thr Pro Ile Leu Leu Leu Leu Gly Phe Met Ile Ala Ser

20 25 30

Phe Lys Ile Thr Gly Val Glu Ser Val Gly Ala Cys Tyr Gly Met Leu

35 40 45

Gly Asn Asn Leu Pro Pro Ala Ser Glu Val Val Asn Leu Tyr Lys Ser

50 55 60

Tyr Asn Leu Asp Arg Met Arg Leu Tyr Asp Pro Asn Arg Ala Ala Ile

65 70 75 80

Gln Ala Leu Gln Asn Ser Asn Ile Glu Val Met Ile Gly Val Pro Asn

85 90 95

Ser Asp Leu Gln Arg Leu Ala Asn Asp Pro Gly Tyr Ala Tyr Asp Trp

100 105 110

Val Tyr Gly Asn Leu Val Asp Tyr Pro Gln Val Lys Phe Arg Tyr Ile

115 120 125

Ala Val Gly Asn Glu Val Ser Pro Ile Asn Gly Gly Thr Ala Trp Leu

130 135 140

Ala Pro Phe Val Leu Pro Ala Met Gln His Ile Gln Thr Ala Val Leu

145 150 155 160

Ser Ala Ala Arg Leu Ala Asn Thr Val Lys Val Ser Thr Ala Ile Asp

165 170 175

Met Thr Leu Ile Gly Asn Ser Tyr Pro Pro Ser Gln Gly Ser Phe Arg

180 185 190

Gly Asp Ile Arg Ala Tyr Phe Asp Pro Ile Ile Arg Phe Leu Val Asn

195 200 205

Asn Asn Ala Pro Leu Leu Ala Asn Val Tyr Pro Tyr Phe Ser His Ile

210 215 220

Gly Asn Pro Arg Asp Ile Ser Leu Ser Tyr Ala Ile Phe Thr Ala Pro

225 230 235 240

Gly Pro Val Ile Trp Asp Asn Gly Leu Gly Tyr Gln Asn Leu Phe Asp

245 250 255

Ala Met Met Asp Ala Leu Tyr Ala Ala Val Glu Arg Ala Gly Gly Gly

260 265 270

Ser Leu Lys Val Val Val Ser Glu Thr Gly Trp Pro Ser Ala Gly Gly

275 280 285

Val Ala Thr Thr Phe Asp Asn Ala Arg Asn Tyr Tyr Ser Arg Leu Ile

290 295 300

Gln His Val Glu Lys Gly Thr Pro Arg Arg Pro Gly Arg Leu Glu Thr

305 310 315 320

Tyr Met Phe Ala Thr Phe Asp Glu Asn Asn Lys Asn Pro Glu Tyr Glu

325 330 335

Lys His Phe Gly Leu Phe Phe Pro Asn Lys Gln Pro Lys Phe Pro Leu

340 345 350

Arg Ile Ser Met Gly Thr Gly Ser Gly Asp Ile Val Ser Asp Gly Asn

355 360 365

Ser Thr Ser Leu Gly Trp Val Lys Ser Asp Met

370 375

<210>3

<211>26

<212>DNA

<213> Artificial sequence

<400>3

tcatcagtac gtagttctct tacttc 26

<210>4

<211>25

<212>DNA

<213> Artificial sequence

<400>4

agctaagcta gttacatgtc actct 25

Claims (2)

1. Panax notoginseng β -1,3 glucanase genePnGlu1The nucleotide sequence is shown as SEQ ID NO: 1, the code is shown as SEQ ID NO: 2 in the sequence table 2.

2. The notoginseng β -1,3 glucanase gene of claim 1PnGlu1In increasing the effect of tobacco on staphylococcus (Botryosphaeria dothidea) Fusarium verticillatum (A)Fusarium verticillioide) Fusarium solani (F.solani) (II)F. solani) Colletotrichum gloeosporioides (B) ((B))Colletotrichum gloeosporioides) Use in resistance.

Images