CN117417931A

CN117417931A - Promoter POsVSP1 derived from vascular bundle specific expression of rice and application thereof

Info

Publication number: CN117417931A
Application number: CN202311341431.XA
Authority: CN
Inventors: 崔学安; 张治国; 吴苏亭; 陈国鑫; 王志伟; 杜量衡; 吴金霞; 孙学辉; 路铁刚
Original assignee: Biotechnology Research Institute of CAAS
Current assignee: Biotechnology Research Institute of CAAS
Priority date: 2023-10-17
Filing date: 2023-10-17
Publication date: 2024-01-19

Abstract

The invention discloses a promoter POsVSP1 for vascular bundle specific expression from rice and application thereof, and relates to the field of plant molecular biology. POsVSP1 is in particular the following A1) or A2) or A3): a1 A DNA fragment shown in SEQ ID No. 1; a2 A DNA fragment having a homology of 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more with the nucleotide sequence defined in A1); a3 A DNA fragment which hybridizes under stringent conditions to the nucleotide sequence defined in A1) or A2) and has promoter function. The promoter POsVSP1 can effectively start the specific expression of a target gene in vascular bundles and not express in other organ tissues, meets the requirement of the specific expression of the target gene in the vascular bundles of rice, and avoids the adverse effect caused by the continuous expression of exogenous genes in other tissues of plants.

Description

Promoter POsVSP1 derived from vascular bundle specific expression of rice and application thereof

Technical Field

The invention relates to the field of plant molecular biology, in particular to a promoter POsVSP1 for vascular bundle specific expression from rice and application thereof.

Background

The structure and morphology of plants vary greatly during the different stages of their growth and their interaction with the environment. These changes are controlled by the expression of a series of genes in specific tissues and at specific time, and the precise regulation and control switch is a plant tissue specific promoter, and under the drive of the promoter, the expression of the genes usually only defines certain specific organs and/or tissue parts and shows the characteristics of fertility regulation and the like. The tissue specific promoter can accumulate the expression product of the target gene in a certain organ or tissue part, the tissue specific expression promoter is adopted to drive the target gene to express, and only the regional expression quantity is increased, so that negative effects such as metabolic burden and the like caused by the constitutive expression promoter can be effectively avoided. However, there are still few promoters for tissue-specific expression that are clear in the regulatory mechanisms and are useful for genetic improvement of crops.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a DNA molecule with vascular bundle specific promoter function. The technical problems to be solved are not limited to the described technical subject matter, and other technical subject matter not mentioned herein will be clearly understood by those skilled in the art from the following description.

In order to solve the technical problems, the invention provides the following technical scheme:

the present invention provides any one of the following applications of a DNA molecule or biological material:

1) The application in the initiation of the expression of the target gene;

2) Use in genetic modification of plants;

the DNA molecule is A1) or A2) or A3) as follows:

a1 A DNA molecule of SEQ ID No.1, which is named POsVSP1 promoter, derived from rice (Oryza sativa),

a2 A DNA fragment having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the nucleotide sequence defined by SEQ ID No.1 and having a promoter function,

a3 A DNA fragment which hybridizes under stringent conditions with the nucleotide sequence defined in SEQ ID No.1 and has a promoter function;

the biomaterial is any one of the following B1) to B4):

b1 An expression cassette containing said DNA molecule,

b2 A recombinant vector containing said DNA molecule,

b3 A recombinant microorganism comprising said DNA molecule, or a recombinant microorganism comprising B1) said expression cassette, or a recombinant microorganism comprising B2) said recombinant vector,

b4 A transgenic plant cell line comprising said DNA molecule, or a transgenic plant cell line comprising the expression cassette of B1).

Wherein SEQ ID No.1 consists of 1962 nucleotides in total.

Herein, the 80% identity or more may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

Further, the initiation of the expression of the gene of interest is to initiate expression of the gene of interest in a plant.

Further, the expression is specific expression in vascular bundles of plants.

Further, the plant is any one of the following: g1 Monocotyledonous plants; g2 A gramineous plant; g3 Rice plant; g4 Rice seed plants; g5 Rice. Specifically, the rice variety is Nipponbare.

Vectors described herein are well known to those of skill in the art and include, but are not limited to: plasmids, phages (e.g., lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), ti plasmids, or viral vectors. The recombinant vector may be a recombinant expression vector or a recombinant cloning vector.

In one embodiment of the present invention, the recombinant vector is specifically a vector obtained by inserting the DNA molecule shown in SEQ ID No.1 between the BamHI and NcoI cleavage recognition sites of the pCAMBIA1391Z vector and keeping the other sequences of the pCAMBIA1391Z vector unchanged.

The expression cassette consists of the DNA molecule with a promoter function, a target gene for the expression of which is started by the DNA molecule and a transcription termination sequence; the DNA molecule is functionally linked to the gene of interest, and the gene of interest is linked to the transcription termination sequence.

In one embodiment of the invention, the gene of interest is in particular the GUS gene (derived from the pCAMBIA1391Z vector); the transcription termination sequence is specifically a NOS transcription terminator (derived from the pCAMBIA1391Z vector).

POsVSP1 promoter or recombinant vector, expression cassette, transgenic cell line or recombinant bacteria in the above application also belong to the protection scope of the present invention.

The invention also provides a method for cultivating the transgenic plant, which is to use the DNA molecule to start the expression of the target gene in the plant so as to obtain the transgenic plant expressing the target gene.

Specifically, the expression of the gene of interest is the specific expression of the gene of interest in the vascular bundle.

Compared with the prior art, the invention has the following advantages:

(1) The rice vascular bundle specific expression promoter is POsVSP1 from japonica rice variety Nipponbare, the fragment size of the promoter is 1962bp, and the POsVSP1 promoter has the following characteristics: a) Is positioned at the 5' end and upstream of the OsVSP1 gene; b) The base length is 1962bp; c) Has necessary site for initiating transcription and transcription initiation point; d) Specifically expressed in rice vascular bundles. The promoter provided by the invention can effectively control the specific expression of a target gene in vascular bundles, does not express in other organ tissues, and can avoid adverse effects caused by the continuous expression of exogenous genes in other tissues of plants, such as biological safety problems caused by transgene drift and pollen escape.

(2) The recombinant expression vector containing the vascular bundle specific expression promoter POsVSP1 is transferred into the vascular bundle specific expression promoter, and the downstream gene is positioned in vascular bundle expression under the regulation and control of the vascular bundle specific expression promoter POsVSP1 of the recombinant expression vector, so that a tool is provided for researching the specific expression of the gene in the vascular bundle in the field of plant genetic engineering, and the recombinant expression vector has a wide application prospect.

Experiments prove that: the promoter POsVSP1 provided by the invention can effectively start the specific expression of a target gene in a rice vascular bundle, does not express in other organs and tissues, can avoid adverse effects caused by the continuous expression of the target gene in other tissues of a plant, and can be used for functional analysis and identification of genes related to growth and development of the plant vascular bundle. Not only can serve the breeding of transgenic rice, but also reserve resources for the transformation and design of long-term promoters.

Drawings

FIG. 1 is a graph showing the detection results of POsVSP1 promoter molecules. A is the result of PCR; b is the double enzyme digestion result. M1 and M2: DL-5000,1: the size of the band is 1962bp;2: bamHI and NcoI double cut bands.

FIG. 2 is a map of the T-DNA region of the expression vector pCAMBIA1391Z. Wherein A is a pCAMBIA1391Z vector, LB and RB are respectively represented as a left border and a right border of T-DNA, hyg represents hygromycin resistance gene, MCS represents a multiple cloning site, NOS represents a terminator of the gene; b is pCAMBIA1391Z polyclonal site map.

FIG. 3 is a graph showing the results of histochemical staining of GUS gene. Wherein A represents a blade; b represents a blade transverse cutting diagram; c represents glume; d represents stems; e represents the root.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

pCAMBIA1391Z vector: described in "Xuean Cui, zhiguo Zhang, yanwei Wang, jinxia Wu, xiao Han, xiaofeng Gu, tiegang Lu. TWI1 Regulates cell-to-cell movement of OSH15 to control leaf cell date. New Phytol.2019 Jan;221 326-340', which is available to the public from the institute of biotechnology at the national academy of agricultural sciences, which is used only for repeated experiments related to the present invention, and which is not used for other purposes.

Agrobacterium AGL1: purchased from Beijing village allied biogenic gene technologies Inc., product number ZK296.

GUS staining solution (pH 7.0): the solute consisted of 100mM potassium ferrocyanide, 100mM potassium ferricyanide, 0.5mM EDTA (pH 8.0), 10mg/ml X-Gluc and 0.1% (volume ratio) Tween 20 in 200mM PBS buffer.

The primers used in the following examples were synthesized by Shenzhen Dai bioengineering Co., ltd, and sequenced by Shanghai bioengineering Co., ltd. pEASY T1Cloning Kit, taq enzyme, trans5 alpha competence and related kits were all purchased from Beijing full gold biotechnology Co., ltd; restriction enzymes BamHI and NcoI, T ₄ The ligases were all purchased from Dalian TaKaRa; antibiotics were purchased from SIGMA company in the united states; the rest reagents are all of domestic analytical purity.

EXAMPLE 1cloning of rice vascular bundle-specific promoter POsVSP1

1. Primer design

Primer 1 and primer 2 were used as primers for amplifying POsVSP1 promoter, primer 1 plus BamHI cleavage recognition site sequence GGATCC, and downstream primer plus NcoI cleavage recognition site sequence CCATGG.

The primer sequences were as follows:

primer 1 (upstream primer): 5'-GGATCCCTGCATCCCAAATAAGAAGGAACT-3';

primer 2 (downstream primer): 5'-CCATGGGTCGACTCGGTCTCAGTGTCGCT-3'.

2. PCR amplification

And (2) taking rice Japanese sunny genome DNA extracted by a high-efficiency plant genome DNA extraction kit of Tiangen company as a template, and carrying out PCR amplification by using the upstream primer and the downstream primer designed in the step (1) to obtain a PCR product.

The PCR conditions were as follows: pre-denaturation: 98 ℃ for 10min; denaturation: 98 ℃ for 10s; annealing: 5s at 60 ℃; extension: 2min30s at 72 ℃ for 36 cycles; total extension: and at 72℃for 10min.

3. PCR product detection

After the completion of the PCR reaction, the PCR product was detected by 2% agarose gel electrophoresis, and the detection results are shown in FIG. 1A.

4. pEASY T1Cloning Vector-POsVSP1 Vector construction

Recovering and purifying the PCR product to obtain a target fragment, connecting the target fragment with a pEASY T1Cloning Vector to obtain a recombinant Vector pEASY-POsVSP1, and finally converting the recombinant Vector pEASY-POsVSP1 into an escherichia coli competent Trans5 alpha cell; positive clones were screened by PCR and enzyme digestion detection and sequenced for verification, and sequencing results showed that pEASY-POsVSP1 contained a DNA molecule with the nucleotide sequence of SEQ ID No.1, which was named the POsVSP1 promoter (total 1962 bp).

SEQ ID No.1

CTGCATCCCAAATAAGAAGGAACTAGGAGATGACCAGAACAATGAGGGCGCCGCGGATATCACTAACCCAGGAATTGTTTGCGACGCCAGAACCAATTGTGCGTGAACCCCGGAGACGCGAGGGCACGACGACGAGGAGGTCTTGAGCCAAGGAGGCCACCAGGCGACCGTCGATCCACTGGTCAGTCCAGAAGAGAGTTGATTCACCATCTCTTGACACGAAGAATGTGACGCAGCAAACATGTCGGAGACACTCCGCTCAACGGGGGCCTTAAGGCCAGCCCAGTAGGGATGCAATGAGCACTGAAGCCAAAGCCAGCGAACTCGCAGGGCGAACCCACTAGTTTTAAAAAAACTAGATAATTTTACTTTTCTAGCTCTTTTGGACAGCTATATGCTCTTTTATCTATCTACATTCAATTTATTGTACACACAACCATGTGAGTTCATTGCCAAGTAAAAACCGAAATACTTAAGATCATTCATATACTTAAGAAAATGGCAAATTTTGCTATAGGACACCTAAAATTTGTGTAATTTGCTTATAGAAATTGTAAAAGCATGTCACGATTGAAAGCCATCCTAAAAGACTAATAATTTGCTAGAGGACACTTGCGACTCAATTGTAAAGATAAATTCTTAGGAAAAAAGATAATGCCCCTAGGAACACATGCTTCAAACATAGTGATAGAGTGAAGACTTAGAAATTATGCAATTCTAAATTAGCCATCACCCCAAATAGATCACTAGTATACATCGTATTCCATCTTCACTCAAGCCTTAGCTCAAAAGCTTTTCACCCTAGAGTCATTCTCATTCTTTTGAAGAATTTATTGTTCCAATTGAGTCGAAATTGTCCTCCAGCAAATTATCAGTTTTAGAGATGTCTTTTAGCCGTGAGATGTTTTTGCGATGTATATCAGCAAATTGTACAAATTTTGTGTGCCTTGTAGCAAAATTTGCCTTAAAAAAAAGAGTCAGCGTGATTCGATATAATAAAAATAAGAGTAGCGTGATTCAAGATATAATAAAAATAAGATTACCTGGTTCAAGGTGTACTTGTTTTTAAAACCACCCGTCATTTGATCGTTGCTTTTACCAGCCGTAGTCAAAATTTAAATCTTACTACTAAATTTAATTTTAAGGTTTTTTATCATAGTTTTTTTGGCATTAACATTTAAATCACTAACAACACAATATAAAAGTTCTCCTCTTCATTTATTCTTTCTCTCTTTATTATAAGAGCTATATAGCAAATTGTTTCAACATATATTTGTCGTGTGTTTTAGGCCCCATCGTTTAACCAAATATGGATAACACATTTATGTGTGTATTCTTAGCGATTTAAATACCAATGTTGAAAAATAAATTTTGATAAAAAAAACTTGAAAATCAAAATTTTAGAATTTAAATTTTAACAACTACCGATATTGTAGAGAAAAAGAGAAGATCTTATTTCATAAAGGGAGACTACGTAACGGTATTATCGTTTCGACGGAATAACTCACATCGGCATGAATCCTATAGGTATTAGATCTAATACATTCGATACCAAACATGATACCCCGTACGTATCATATCTGATATTTAGGTATCATACTGACGTCAATATGATACTATACGTATCAGATCTGGTACCTACAATGCTAGATATGAACCCCATAAGAATTAGATCTGGCATCTAAATACCATGTTCACGTCATCATGTTACCATGATACCTCGTGCTATTCGGTTGAAACAGTATAACATTCTACGGTATTTCTGTATTTTAGATTGATATACAATCTTTTGTGGTGTTAGCACTAGCAGTCAAAGGAGTGGCCGAAGTGGGGACCATCTTCCTCCAGATTAAACCTTTTTTTTTCCCGGACTCGCACCGGACTTGCCGTCCGCCGCCATTGCGCGTCTCCGCCCAAACCCAAATGTTCGCCGACGGCGAGCGACACTGAGACCGAGTCGAC

Example 2 functional verification of POsVSP1 promoter

1. Acquisition of transgenic lines

1. Construction of expression vectors

The recombinant vector pEASY-POsVSP1 in step 4 of example 1 was digested simultaneously with restriction enzymes BamHI and NcoI to obtain a POsVSP1 fragment, as shown in FIG. 1B; cutting the pCAMBIA1391Z vector by restriction enzymes BamHI and NcoI (the map is shown in FIG. 2) to obtain a pCAMBIA1391Z vector skeleton fragment; and connecting the POsVSP1 fragment with the pCAMBIA1391Z vector skeleton fragment to obtain a recombinant plasmid POsVSP1-pCAMBIA1391Z.

The recombinant plasmid POsVSP1-pCAMBIA1391Z is obtained by replacing the sequence between the BamHI and NcoI cleavage recognition sites of the pCAMBIA1391Z vector with the POsVSP1 promoter sequence shown in SEQ ID No.1, and keeping the other sequences of the pCAMBIA1391Z vector unchanged. Wherein the POsVSP1 promoter is used to initiate the expression of GUS gene.

2. The recombinant plasmid POsVSP1-pCAMBIA1391Z is introduced into the agrobacterium tumefaciens AGL1 to obtain recombinant agrobacterium tumefaciens AGL1/POsVSP1-pCAMBIA1391Z.

3. And (3) suspending the recombinant agrobacterium prepared in the step (2) AGL1/POsVSP1-pCAMBIA1391Z in a YEP liquid culture medium for culture to obtain a bacterial solution of the agrobacterium with the POsVSP1-pCAMBIA1391Z, and storing at-80 ℃ for later use.

YEP liquid medium: 10.0g of yeast extract powder, 10.0g of peptone, 5.0g of sodium chloride are weighed and dissolved in 1L of distilled water or deionized water, and the mixture is autoclaved at 121 ℃ for 15 minutes and cooled for standby, wherein pH 7.0+/-0.2 (25 ℃).

Example 3 Agrobacterium-mediated genetic transformation of Rice "Nippon" and detection of transgenic plants

S1, rice callus induction

The rice variety 'Nippon sunny' is preserved in a combined laboratory by photosynthesis promotion and C4 rice creation of the institute of biotechnology of China academy of agricultural sciences. The optimal hygromycin concentration for screening of resistant calli was 50mg/L.

Shelling mature water Japanese sunny seeds, then sequentially treating 1min with 75% ethanol and sterilizing the seed surface with 20% sodium hypochlorite for 15min; washing the seeds with sterilized water for 5 times; placing seeds on a callus induction medium, wherein the induction medium is obtained by adding 2.5 mg/L2, 4-D,0.8g/L hydrolyzed casein, 0.3g/L proline, 30g/L sucrose and 3g/L phytagel on the basis of an N6 medium; the inoculated seeds were placed in the dark for 4 weeks at a temperature of 28.+ -. 1 ℃.

S2, subculturing the callus

The embryogenic callus which is bright yellow, compact and relatively dry is selected and placed in a secondary culture medium (the nutrient components are the same as those of an induction culture medium), and is cultured for 3 weeks in the dark, wherein the culture temperature is 28+/-1 ℃.

S3, preparing an agrobacterium culture solution

Agrobacterium culture Agrobacterium was pre-cultured in LA medium (10 g/L Tryptone,5g/L Yeast extract,10g/LNaCl,15g/L agar powder, pH 7.0) containing 50mg/L kanamycin for 2d at 28+ -1deg.C; agrobacterium was transferred to suspension medium (N6 medium macroelement component, N6 medium microelement component, N6 medium ferric salt component and N6 medium vitamin component) and 2.5 mg/L2, 4-D,0.8g/L hydrolyzed casein, 0.3g/L proline, 30g/L sucrose, 10g/L glucose and 100. Mu.M acetosyringone were added thereto, and cultured on a shaker at 28℃for 2 hours at 200 rpm.

S4. Agrobacterium infection

Transferring the callus into a sterilized triangular flask; regulation of Agrobacterium suspension to OD _600nm The value is about 0.3; soaking the callus in agrobacterium suspension for 30min; transferring the callus to sterilized filter paper for drying; then placed on a co-culture medium (N6 medium macroelement component, N6 medium microelement component, N6 medium ferric salt component and N6 medium vitamin component, 2.5 mg/L2, 4-D,0.3g/L proline, 30g/L sucrose, 10g/L glucose, 100 mu M acetosyringone and 8g/L agar powder) for 3D culture at a temperature of 22 ℃.

S5, callus screening culture

Washing the co-cultured callus with sterilized water for 10 times; then soaking the callus in sterilized water containing 200mg/L of timentin for 30min; transferring the callus to sterilized filter paper for drying; the callus was transferred to selection medium (2.5 mg/L2, 4-D,0.3g/L proline, 50mg/L hygromycin, 200mg/L timentin, 30g/L sucrose and 8g/L agar powder were added on the basis of N6 medium) and selected for 2 times each for 2 weeks.

S5, callus differentiation culture

The resistant calli were transferred to differentiation medium (MS medium plus 2mg/L KT,0.2mg/LNAA,2 mg/L6-BA, 0.2mg/L IAA,0.8g/L hydrolyzed casein, 0.3g/L proline, 30g/L sucrose and 3g/L phytagel), and cultured under light (2000 Lux) at 28.+ -. 1 ℃.

S6, rooting culture

Roots produced during differentiation were cut off and then transferred to rooting medium (20 g/L sucrose and 3g/Lphytagel were added on a 1/2MS medium basis) and cultured with 2000Lux light for 3 weeks (temperature 28.+ -. 1 ℃).

S7, transplanting tissue culture seedlings

And (3) washing off residual culture medium on roots, transferring seedlings with good root systems into a greenhouse, keeping soil moist for the first few days, and obtaining regenerated plantlets which are T0 generation transgenic plants.

S8, identifying transgenic plants

And (3) extracting the DNA of the 17T 0 generation transgenic plants obtained in the step (4), and carrying out PCR amplification by using a primer 3 and a primer 4, wherein the primer 3 is from a POsVSP1 promoter, and the primer 4 is from a carrier skeleton. PCR procedure was as above. If the DNA fragment with the size of 2156bp is obtained by PCR amplification, the T is shown ₀ The DNA of the transgenic plant contains POsVSP1 fragment, namely the positive transgenic POsVSP1 promoter plant. The PCR result shows that 14 positive POsVSP1 promoter plants are transformed.

Primer 3 (upstream primer): 5'-CTGCATCCCAAATAAGAAGGAACT-3';

primer 4 (downstream primer): 5'-TCATCATCATAGACACACGA-3'.

S9, GUS staining identification of POsVSP1 promoter plant

Collecting the young roots, stems, young leaves and glumes of the 14 positive POsVSP1 promoter plants identified in S8, and transferring the samples into a test tube; then adding a proper amount of GUS buffer solution to submerge the tissue blocks, adding GUS staining solution, uniformly mixing, and preserving for 4-12h at 37 ℃; after dyeing, firstly placing the dyed tissue in 75% ethanol for rinsing and decoloring, and then soaking in 50% and 20% ethanol for more than 20min respectively until the material is white; finally, observing under a microscope, and obtaining blue tissue which is the GUS expression part.

The dyeing result is shown in fig. 3, wherein a represents a leaf; b represents a leaf slice diagram; c represents glume; d represents stem sections; e represents the root. As can be seen, the GUS gene was specifically expressed only in all vascular bundles of roots, stems, leaves and glumes of plants transformed with the POsVSP1 promoter (blue part is indicated by the frame or arrow), and no GUS gene was expressed in other cells of the tissue. Therefore, the promoter POsVSP1 of the invention is specifically expressed in all vascular bundles of rice, and can be used for promoting the specific expression of a target gene in the vascular bundles.

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims

Use of any of the following dna molecules or biological materials:

1) The application in the initiation of the expression of the target gene;

2) Use in genetic modification of plants;

the DNA molecule is A1) or A2) or A3) as follows:

a1 A DNA molecule whose nucleotide sequence is SEQ ID No.1,

a2 A DNA fragment having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the nucleotide sequence defined by SEQ ID No.1 and having a promoter function,

a3 A DNA fragment which hybridizes under stringent conditions with the nucleotide sequence defined in SEQ ID No.1 and has a promoter function;

the biomaterial is any one of the following B1) to B4):

b1 An expression cassette containing said DNA molecule,

b2 A recombinant vector containing said DNA molecule,

b3 A recombinant microorganism comprising said DNA molecule, or a recombinant microorganism comprising B1) said expression cassette, or a recombinant microorganism comprising B2) said recombinant vector,

b4 A transgenic plant cell line comprising said DNA molecule, or a transgenic plant cell line comprising the expression cassette of B1).
2. The use according to claim 1, wherein said promoting expression of the gene of interest is promoting expression of the gene of interest in a plant.
3. The use according to claim 2, wherein the expression is specific in the vascular bundle of a plant.
4. Use according to any one of claims 1 to 3, wherein the plant is any one of the following:

g1 Monocotyledonous plants;

g2 A gramineous plant;

g3 Rice plant;

g4 Rice seed plants;

g5 Rice.
5. The DNA molecule or biological material of claim 1.
6. The biomaterial according to claim 5, wherein: the recombinant vector is a recombinant plasmid obtained by inserting the DNA molecule of claim 1 into a multiple cloning site or a recombination site of a plant expression vector.
7. The biomaterial according to claim 6, wherein: the expression cassette consists of a target gene for promoting expression of the DNA molecule of claim 1 and a transcription terminator; the DNA molecule is functionally linked to the gene of interest, and the gene of interest is linked to the transcription terminator.
8. A method of growing a transgenic plant by using the DNA molecule of claim 1 to initiate expression of a gene of interest in a starting plant to obtain a transgenic plant expressing the gene of interest.
9. The method according to claim 8, wherein: the expression of the gene of interest is specific expression of the gene of interest in the vascular bundle.