CN111575286B - Corn pollen specific promoter and application thereof - Google Patents

Abstract

The invention discloses a corn pollen specific promoter and application thereof. The maize pollen specific promoter has a sequence shown in SEQ ID NO.1 or a DNA sequence which can be hybridized with the sequence shown in SEQ ID NO.1 under a strict condition and has promoter activity. The maize pollen specific high-efficiency expression promoter provided by the invention has important application value when a pollen abortion material is created by a genetic engineering means, for example, the promoter sequence is connected with an antisense gene of a pollen development essential gene or constructed into an RNA interference vector, and the gene essential for pollen development can be silenced and expressed in pollen after being transformed into a plant to generate a pollen abortion plant, so that adverse effects caused by continuous expression of a target gene in other parts are avoided. The invention provides a novel method for driving a target gene to be efficiently and specifically expressed in pollen by using a promoter, and the novel method has wide application prospect in the aspects of genetic improvement of plants and research on plant bioreactors.

Description

Corn pollen specific promoter and application thereof

Technical Field

The invention relates to a promoter and application thereof, in particular to a corn pollen specific promoter and application thereof. The invention belongs to the field of biotechnology.

Background

A promoter is a DNA sequence recognized, bound and transcribed by RNA polymerase, contains conserved sequences required for RNA polymerase specific binding and transcription initiation, is mostly located upstream of the transcription initiation point of a structural gene, is not transcribed per se, and is a DNA sequence required for eukaryotic gene expression. In the process of research and application of transgenic plants, the discovery that the low expression level of exogenous genes is an important factor causing the target traits of the transgenic plants to be unsatisfactory and causing the phenotype to be insignificant when researching the action mechanism of the genes. Since the expression level of a target gene is critically dependent on the promoter upstream of the gene. Therefore, the selection of a suitable plant promoter is a first consideration to enhance the expression of a foreign gene.

The promoter of a eukaryotic gene determines the expression timing and site of a certain gene. Promoters can be classified into constitutive promoters expressing in various tissues, tissue-specific promoters and inducible promoters expressing only in specific tissues and organs, according to the transcription pattern of the promoters. At present, the three promoters are widely used in plant genetic engineering. For example, the CaMV 35S promoter and CsVMV promoter among constitutive promoters are commonly applied to dicots, where the CsVMV promoter has the ability to drive transcription of foreign genes in transgenic grapes comparable to the use of two CaMV 35S promoters [ Li Z J, et al. Rice Actinl promoters and maize Ubiqutin promoters are commonly used in monocots to drive foreign gene expression. Driven by a constitutive promoter, the foreign gene is expressed continuously at various sites of the transgenic plant and at all developmental stages. However, constitutive promoters expose some problems during application. For example, exogenous genes are expressed in whole plants, some functional heterologous proteins or metabolites are accumulated in the plants in large quantities, the original metabolic balance of the plants is broken, and some products are even toxic, so that the normal growth of the plants is prevented, and finally the plants are killed. Expression of viral capsid proteins using constitutive promoters may result in the transfer of viral capsids, leading to the production of new strains of plant viruses [ Robinson DJ. environmental disruption of release of genetic plants derived insertions. transgene Res.1996, 5359 ]. In addition, repeated use of the same promoter to drive two or more foreign genes may cause gene silencing or co-suppression phenomena.

Therefore, the tissue-specific promoter is utilized to start the target gene to be expressed at a specific part of a receptor plant at a specific time or under specific conditions, so that the adverse effect caused by a constitutive promoter can be effectively avoided, and the specific character of the plant is qualitatively modified by driving the expression of the target gene. The tissue-specific promoter has a general promoter structure, and also has several elements for controlling tissue-specific expression, and generally has the general characteristics of an enhancer and a silencer, and the expression specificity of the promoter is determined by the types, the number, the relative positions and the like of the elements, so the promoter has wide application value. With the development of biotechnology, the research and application of tissue-specific promoters will certainly become a hot spot in the field of future plant genetic engineering. Common tissue-specific promoters include endosperm-specific promoters [ V.Colot, et al (1987) Localization of sequence in heat end protein gene in heat control in EMBO. Journal, 6(12)3559- ], seed-specific promoters [ Beach RN, et al (1985) amplification and analysis of soybean β -condensation in section, 4(12)3047-, phloem-specific promoters [ Bostwick DE, et al (1994) Organization and catalysis of current genetic genes. plant Molecular Biology, 26, 887-897], root-specific promoters [ Yamamoto YT, et al (1991) catalysis of cis-acting sequences regulated root-specific gene expression in tobacco. plant Cell, 3, 371-382], and the like.

Among them, the pollen-specific promoter has promoter activity only in plant pollen, and most of the expressed foreign proteins are concentrated in pollen, so that it has been attracting attention to artificially create plant materials for pollen abortion by influencing metabolism and development of substances in pollen. Therefore, the cloning and application of pollen-specific promoters is becoming an increasing focus of application. For example, in the production of maize hybrids, the female parent is emasculated and then the pollen of the male parent is pollinated to the filaments of the female parent, ultimately producing the maize hybrid used in production. The manual emasculation and pollination process needs to consume a large amount of manpower and material resources, and the seed production cost of the corn hybrid is greatly increased. Therefore, the corn pollen specific promoter drives the target gene, directionally interferes the development process of the corn pollen, obtains the corn parent with pollen abortion, can greatly save the seed production cost, and has important application value in the actual production.

Disclosure of Invention

The invention aims to provide a corn pollen specific expression promoter, which is derived from corn genomic DNA and can be specifically expressed in corn pollen; the invention also aims to provide application of the promoter in corn breeding, which can drive homologous and heterologous genes to be specifically expressed in corn pollen with high efficiency.

In order to achieve the purpose, the invention adopts the following technical means:

the nucleotide sequence cloned from corn genome DNA by utilizing PCR is named as pPSP1, the length is 2921bp, the nucleotide sequence is a double-stranded nucleic acid type, and the nucleotide sequence is shown as a sequence table SEQ ID No. 1. Bioinformatics analysis the sequence of pPSP1 is located near the bz locus and contains the essential elements of a eukaryotic promoter. Then, the invention constructs a plant expression vector containing a pPSP1 promoter driving exogenous gene, wherein an expression cassette comprises a pPSP1 promoter, a GUS (beta-glucuronidase) reporter gene and a transcription termination region from a nopaline synthase (nos) gene, a selection marker gene is a hygromycin resistance gene, and the expression vector is named pCambia1301-pPSP 1-GUS. Transforming the expression vector driven by the promoter sequence containing the pPSP1 into corn, carrying out histochemical staining observation on pollen, young roots, old roots, young leaves, old leaves, young embryos, mature embryos, filaments and early-stage-developing male flowers of the transgenic corn, and observing green tissues such as leaves and the like after decoloring by using 95% ethanol. As a result, the young roots, old roots, young leaves, old leaves, young embryos, mature embryos, filaments and early-developed male flowers of the transgenic maize plants were found to be blue-colored, and only the pollen of the transgenic maize plants was found to be blue-colored, compared with the control plants. Thus, it was found that the maize pollen-specific promoter of the present invention indeed has pollen-specific expression activity.

On the basis of the research, the invention provides a corn pollen specific promoter which has a sequence shown by SEQ ID NO.1 or a DNA sequence which can be hybridized with the sequence shown by SEQ ID NO.1 under a strict condition and has promoter activity.

Furthermore, the invention also provides a recombinant DNA molecule which contains the maize pollen specific promoter and a target nucleotide sequence operably connected with the promoter.

Wherein, preferably, the target nucleotide sequence has the function of coding a certain protein or other active substances, and comprises an RNA or DNA sequence, and the target nucleotide sequence is not combined with the pollen-specific promoter under the normal condition.

Wherein, preferably, the nucleotide sequence of interest comprises a heterologous nucleic acid sequence that is different from the promoter plant species, and a homologous nucleic acid sequence derived from the same promoter plant species.

Preferably, the recombinant DNA molecule further comprises other promoter sequences, and the maize pollen specific promoter and the other promoter sequences form a fusion promoter.

Furthermore, the invention also provides a plant expression vector which contains the recombinant DNA molecule.

Wherein, preferably, the plant expression vector is pCambia 1301.

Furthermore, the invention also provides a method for expressing the pollen-specific promoter in the corn, which comprises the following steps:

(1) introducing a plant expression vector containing the invention into corn cells or tissues;

(2) growing said maize cell or tissue into a mature plant.

Among them, it is preferable that the step (1) uses any plant transformation method capable of introducing the plant expression vector into corn cells or tissues.

Preferably, the maize cells are derived from maize germinating embryos, and the plant transformation method is an agrobacterium-mediated method.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides a maize pollen specific promoter, which has important application value when a pollen abortion material is created by a genetic engineering means, the promoter sequence is connected with an antisense gene of a pollen development essential gene or constructed into an RNA interference vector, and the gene essential for pollen development can be silenced and expressed in pollen after being transformed into a plant, so that a pollen abortion plant is generated, and the adverse effect caused by continuous expression of a target gene in other parts is avoided. The invention provides a novel method for driving a target gene to be efficiently and specifically expressed in pollen by using a promoter, and the novel method has wide application prospect in the aspects of genetic improvement of plants and research on plant bioreactors.

Drawings

FIG. 1 is an electrophoretogram of PCR clone pPSP1 fragment;

in the figure, 1 is a standard molecular weight marker; 2. the result is the cloning result of pPSP 1;

FIG. 2 shows the construction of a plant expression vector driven by pPSP 1;

FIG. 3 shows the identification of a pPSP 1-driven plant expression vector;

in the figure, a shows the result of PCR amplification of the pPSP1 fragment with HindIII and NcoI restriction sites; 1-3 are different amplified samples, M is standard molecular weight DNA; b, performing PCR detection on the Escherichia coli resistant bacteria liquid transformed after a pPSP1 fragment with HindIII and NcoI enzyme cutting sites is connected with pMD 19T; 1 is blank control, 2-3 are different clones; c is pCambia1301-pPSP1-GUS enzyme digestion and PCR identification; 1 is pCambia1301-pPSP1-GUS HindIII + NcoI double enzyme digestion identification result, 2 is result of plasmid PCR amplification pPSP1 fragment, and M is standard molecular weight DNA;

FIG. 4 is a genetic transformation of a plant expression vector driven by pPSP1 into maize;

in the figure, a is the embryo-scratching treatment of the receptor material seeds; b is the longitudinal view of the germinating embryo and the incised wound site (black line); c, the germination condition of corn grains infected by agrobacterium; d is the result of the transformed plant after hygromycin spraying screening; e is T₀Seeds of the generation positive plants; f is T1 generation resistant plant sprayed with 15mg/L hygromycin;

FIG. 5 is a molecular assay of transgenic maize;

in the figure, a is PCR detection of GUS gene of T1 generation plants; b is Southern blot hybridization of GUS gene of T1 generation plant; c is RT-PCR analysis of GUS gene of T1 generation plant; in the figure, M is standard molecular weight DNA; p is pCambia1301-pPSP1-GUS positive control; 1-9 are different transformed plants; wt is wild type untransformed negative control;

FIG. 6 is a GUS histochemical analysis;

in the figure, A and a are young embryos; b and B are mature embryos; c and C are radicles; d and D are old roots; e and E are young leaves; f and F are mature leaves; g and G are early anthers; h and H are mature anthers; i and I are the enlarged observation of mature anthers; j and J are mature pollen grains; k and K are germinated pollen grains; l and L are filaments; WT is a wild type sample, pCambia1301-pPSP1-GUS is a transgenic sample for transforming the vector;

FIG. 7 shows the construction scheme of pPSP1-EN1+2 vector;

FIG. 8 is a PCR amplification of EN1 and EN2 antisense gene fragments;

in figure 1 is EN1 antisense fragment; 2 is an EN2 antisense fragment; m is standard molecular weight DNA;

FIG. 9 is a PCR identification of pMD19-EN1 and pMD19-EN 2;

in the figure, M is standard molecular weight DNA; 1 is the PCR identification result of pMD19-EN 1; 2 is the PCR identification result of pMD19-EN 2;

FIG. 10 shows the restriction enzyme identification of pPSP1-EN1 and pPSP1-EN 2;

in the figure, M is standard molecular weight DNA; 1 and 2 are pPSP1-EN1 NcoI + BstEII double enzyme digestion; 3 and 4 are pPSP1-EN2 NcoI + BstEII double enzyme digestion;

FIG. 11 shows the restriction enzyme identification of pPSP1-EN1+ 2;

in the figure, M is standard molecular weight DNA; 1 and 2 are the double enzyme digestion identification results of pPSP1-EN1+2 HindIII + EcoRI;

FIG. 12 is a molecular assay for pPSP1-EN1+2 transgenic maize;

in the figure, a is T1 generation transgenic corn PCR detection; b is the Southern blot detection of the transgenic maize plant pPSP1-EN1+2, 1-5 is a transgenic maize sample, and 6 is a wild sample; c is detection of ZmENO1 and ZmENO2 gene expression quantity in T1 generation transgenic maize pollen; m is standard molecular weight DNA; 1-6 are different transgenic lines;

FIG. 13 is a phenotypic characterization of pPSP1-EN1+2 maize;

in the figure, a is a maize seedling-stage phenotype of the transgenic pPSP1-EN1+2 gene; b is a maize growth-stage phenotype of the transgenic pPSP1-EN1+2 gene; c is a wild type tassel phenotype; d is wild type corn seed setting condition; e is the maize tassel phenotype of the transgenic pPSP1-EN1+2 gene; f is the fructification condition of the transgenic maize with the pPSP1-EN1+2 gene; g is the iodine-potassium iodide staining condition of wild corn pollen; h is the in vitro germination condition of the wild pollen; i and k are the iodine-potassium iodide dyeing condition of the corn pollen with two transferred pPSP1-EN1+2 genes; j and l are the in vitro germination of maize pollen with two transferred pPSP1-EN1+2 genes.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. The examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

Example 1 cloning of maize pollen specific promoter sequence pPSP1

The surface of McC seed of corn cultivated species is sterilized, and then placed in a culture dish paved with wet filter paper, and cultured for 3-5 days at 24-28 ℃ to ensure that young leaves grow out, 2g of fresh and tender seedlings are collected, total DNA is extracted by a CTAB improved method, 2-3 mu L of DNA sample is taken, and the purity and concentration of the DNA sample are detected by agarose gel electrophoresis.

Design of cloning primers, F: AGTAGGCCAAAATTTCCAAACA, respectively; r: CAGCTCCTGCTCCAAGATTGACG PCR reaction using the above primers, consisting of LA taq polymerase 0.2. mu.L, GC buffer 5. mu.L, dNTP 1.5. mu.L, F primer 0.2. mu.L, R primer 0.2. mu.L, Template DNA 2. mu.L, ddH₂O 1.9μL。

The PCR reaction procedure was as follows: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 1min, annealing at 56 deg.C for 1min, extension at 72 deg.C for 2min, amplification for 35 cycles, extension at 72 deg.C for 5min, and storage at 4 deg.C. Separating PCR product by 1% agarose gel electrophoresis, performing 100V constant voltage electrophoresis for 30-40min, detecting and analyzing with gel imaging system, and obtaining the result shown in figure1 is shown. The target band with correct size was recovered with DNA gel recovery kit (Tiangen Biochemical technology, Beijing, Ltd.), and the recovered fragment was subcloned into sequencing vector pMD19-T (Takara products) using the ligation system: ligation buffer 5. mu.L, pMD 19-T1. mu.L, recovered PCR fragment 4. mu.L, ligation overnight at 16 ℃ and transformation of the ligation product to CaCl₂ E.coli DH 5. alpha. competent cells were cultured overnight in LB solid medium containing ampicillin (final concentration: 100. mu.g/ml); white colonies grown on the plates were picked, inoculated into LB liquid medium containing ampicillin (final concentration 100. mu.g/ml) overnight, centrifuged to collect the cells and subjected to alkaline lysis [ Sambrook, et al, 1989, Molecular Cloning, a Laboratory Manual, Cold Spring harbor Laboratory, New York, p19-21]Extracting plasmids, carrying out PCR amplification, identifying positive clones, sending the positive clones to a company for sequencing, and naming the recombinant plasmid with correct sequencing as pMD19T-pPSP1, wherein the target fragment is named as pPSP1 and has a sequence shown in SEQ ID NO. 1. Primers for amplification of the pPSP1 fragment were designed with HindIII and NcoI cleavage sites, and the primer sequences were HindIII-F: CCAAGCTTAGTAGGCCAAAATTTCCAAACA, NcoI-R: CCCATGGCAGCTCCTGCTCCAAGATTGACG, using the recombinant plasmid identified as correct pMD19T-pPSP1 as a template, the amplification system, reaction conditions and identification method are the same as the method for obtaining pMD19T-pPSP1, and the recombinant plasmid sequenced correctly is named pMD19T-pPSP 1-HN.

Example 2 construction of plant expression vector pCambia1301-pPSP1-GUS

As shown in FIG. 2, the construction scheme is that pMD19T-pPSP1-HN plasmid (constructed in example 1) is extracted by alkaline lysis method, and is subjected to double digestion with HindIII and NcoI to obtain pPSP1 promoter fragment with HindIII and NcoI digestion sites, and is connected with large fragment of plant expression vector pCambia1301 which is subjected to the same digestion, and then the ligation product is transformed into CaCl₂ E.coli DH 5. alpha. competent cells were cultured overnight on LB solid medium containing kanamycin (final concentration 100. mu.g/ml); white colonies growing on the plates were picked, inoculated into LB liquid medium containing kanamycin (final concentration 100. mu.g/ml) for overnight culture, centrifuged to collect cells, plasmids were extracted by alkaline lysis, and restriction enzymes HindIII and Nc were addedAnd carrying out oI double enzyme digestion and PCR amplification identification. The enzyme cutting system is as follows: 10 Xbuffer 2. mu.L, plasmid 4. mu.L, HindIII and NcoI 0.5. mu.L each, ddH₂mu.L of O13, digested at 37 ℃ for 4h and detected by 1% agarose gel electrophoresis to confirm that pCambia1301-pPSP1-GUS contains the pPSP1 promoter fragment. The reaction system and reaction procedure identified by PCR were the same as those for cloning of the pPSP1 fragment described above. The correct expression vector was identified and named pCambia1301-pPSP 1-GUS. The results of the plant expression vector identification are shown in FIG. 3.

Example 3 transformation of maize germinating embryos with pCambia1301-pPSP-GUS expression vector

The recombinant plant expression vector pCambia1301-pPSP1-GUS constructed in example 2 was transformed into Agrobacterium tumefaciens EHA105 by freeze-thaw method, with reference to Hofen et al [ Hofen R, Willmitzer L, (1988) Storage of component cells for Agrobacterium transformation. nucleic Acids Research, 16, 9877 ].

The method for transforming exogenous genes by using maize germinating embryos is operated according to the test steps of Wang et al (2007) as follows:

(1) preparing agrobacterium liquid: selecting identified positive Agrobacterium colony (pCambia1301-pPSP1-GUS), inoculating into 50mL YEB liquid culture medium containing Kanamycin and Rifamicin antibiotics, incubating at 28 deg.C and shaking at 200rpm for 8-12hr, and determining OD₆₀₀A value of 0.8, directly used for infestation;

(2) preparation of corn acceptor material: selecting plump seeds without insect damage (wild type McC), placing one part of each 100 seeds in a sterilized wide-mouth bottle, adding 70% ethanol solution, sterilizing for 30s, soaking in 0.1% mercuric chloride for 10min, washing with sterile water for 5-7 times to remove residual mercuric chloride, adding 150mL sterile water, shaking in shaking table at 90rpm, and soaking for 12 hr; the embryo growing point of the expanded seed was scratched with the tip of a scalpel (placed on sterilized filter paper) in a clean bench, and placed in a new jar containing 135mL of sterile water, as shown in fig. 4a, b, for use.

(3) Transformation and screening: soaking the treated maize explants in 15mL of bacterial liquid, adding an AS solution, performing shaking co-culture at 90rpm for 48 hours, sowing the maize explants in nutrient soil containing vermiculite, and counting the emergence rate after seeds germinate, wherein the emergence rate is shown in a graph 4 c; and 3, spraying a hygromycin solution of 15mg/L for screening in the 1-leaf and 1-heart stage, transferring the resistant plants to a large pot, finely potting and managing until the plants are fruited, and harvesting seeds, wherein the steps are shown in figures 4d, e and f.

(4) Molecular detection of regenerated plants: will T₀The generation seeds are sowed in a large basin, and the genome DNA is extracted for the PCR detection of GUS gene. The genomic DNA was extracted in the same manner as used for cloning of pPSP1, and the primer sequences were GUS-F: 5'-GCAACTGGACAAGGCACT-3', respectively; GUS-R: 5'-GAGCGTCGCAGAACATTACA-3', the reaction system is: LA taq polymerase 0.2. mu.L, GC buffer 5. mu.L, dNTP 1.5. mu.L, GUS-F primer 0.2. mu.L, GUS-R primer 0.2. mu.L, Template DNA 2. mu.L, ddH₂O1.9 μ L; the PCR reaction procedure was as follows: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 1min, annealing at 56 deg.C for 1min, extension at 72 deg.C for 1min, amplification for 35 cycles, extension at 72 deg.C for 5min, and storage at 4 deg.C. The PCR products are separated by 1% agarose gel electrophoresis, and detected and analyzed by a gel imaging system after 100V constant voltage electrophoresis for 30-40 min. The results are shown in FIG. 5 a.

The PCR positive plants were further subjected to Southern blot hybridization. To verify the positive transgenic plants detected by PCR, T is waited₁When the generation grows to 3 leaves and 1 heart stage, leaf genome DNA is extracted by a CTAB method (Stacey and Isaac,1994), and then Southern hybridization detection is carried out. The results are shown in FIG. 5 b.

The DNA probe is obtained by PCR amplification under the action of Ex Taq DNA Polymerase by taking pCAMBIA1301-GUS as a template and GUS-F and GUS-R as primers. The PCR reaction program is: pre-denaturation at 1.94 deg.C for 4min, denaturation at 2.94 deg.C for 1min, annealing at 3.58 deg.C for 1min, extension at 4.72 deg.C for 2min, 5.30 cycles, and extension at 6.72 deg.C for 5 min. The PCR product was detected by agarose gel electrophoresis and recovered. Then, the probe DNA fragment (2 mug) is used as a template to mark the probe DNA; will T₁Carrying out enzyme digestion on the genomic DNA (40 mu g) of the generation positive plant and then carrying out electrophoresis; the steps of membrane transfer, hybridization, Detection and the like are all operated according to the instruction of a DIG High Prime DNA Labeling and Detection Starter Kit I Kit (Roche); the developed film was photographed and recorded with a digital camera.

After T1 generation plant powder is scattered, Trizol reagent (Thermo Scientific) is adopted to extract the total RNA of the maize pollen. 5-10 mu L of the extracted RNA is used for electrophoresis detection of 1% agarose gel, and a gel imaging system is adopted to detect the integrity of the RNA. The Reverse transcription procedure was performed according to the cDNA first strand synthesis M-MuLV Reverse Transcriptase (RNase H Minus) kit (Thermo Fisher Scientific) instructions. The reverse transcribed cDNA was expressed as GUS-F: 5'-GCAACTGGACAAGGCACT-3' and GUS-R: 5'-GAGCGTCGCAGAACATTACA-3' primer is used for RT-PCR analysis to detect the transcription level of GUS gene, and the expression of GUS gene in pollen is proved, and the reaction condition is the same as that of GUS gene molecule detection in reaction system. The results are shown in FIG. 5 c.

Example 4 histochemical staining analysis of GUS Activity in transgenic maize

Histochemical staining analysis of GUS gene activity was performed according to Bradford et al [ Bradford H M.A rapid and sensitive method for the quantification of microbial analytes of protein digestion [ J ] Anal biochem, 1976, 72248 254 ]. The collected different tissue materials of the transgenic maize obtained in example 3 and the staining reaction solution containing substrate X-Gluc (X-Gluc staining solution comprises 1.0mg/μ L X-Gluc; 50mmol/L phosphate buffer solution, pH 7.0; 10mmol/L EDTA, pH 8.0; 0.05mmol/L potassium ferricyanide; 0.05mmol/L potassium ferrocyanide; methanol with a final concentration of 20%; 0.1% Triton X-100) were incubated at 37 ℃ overnight for histochemical staining observation, and the green tissues such as leaves were observed after being decolorized with 95% ethanol. As a result, it was found that, compared with the control strain, the transgenic maize plants did not show blue color in all of the young roots, old roots, young leaves, old leaves, young embryos, mature embryos, filaments, and early-developed male flowers, and only the pollen of the transgenic maize plants showed blue color, as shown in FIG. 6.

Thus, it was found that the maize pollen-specific promoter of the present invention indeed has pollen-specific expression activity.

Example 5 establishment of a Male sterile line in maize

1. Obtaining of corn ZmENO 1(EN 1 gene) and ZmENO2 gene (EN 2 gene) antisense fragment and construction of pPSP1-EN1+2 expression vector

pPSP1-EN1+The construction scheme of the vector 2 is shown in FIG. 7. Extraction and reverse transcription of total RNA from maize pollen As in example 3, antisense fragment primers EN1 and EN2 were designed, with NcoI and BstEII sites at each end, and the sequences EN 1-5: cccatggaatcatcccgaggtgaccacggga, respectively; EN 1-3: gggtacccggtacgtcctcaagtactaggag, respectively; EN 2-5: cccatggaatcatcccgaggtgtccacgtg, respectively; EN 2-3: gggtacccgatacgtcctcaaatactaggaa, performing PCR amplification, wherein the reaction system is as follows: taq polymerase 0.2. mu.L, GC buffer 5. mu.L, dNTP 1.5. mu.L, EN1-5/EN2-5 primer 0.2. mu.L, EN1-3/EN2-3 primer 0.2. mu.L, Template DNA 2. mu.L, ddH₂O0.9 μ L; the PCR reaction procedure was as follows: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 1min, annealing at 56 deg.C for 1min, extension at 72 deg.C for 1min, amplification for 35 cycles, extension at 72 deg.C for 5min, and storage at 4 deg.C. The PCR products were separated by 1% agarose gel electrophoresis, and after electrophoresis at constant voltage of 100V for 30-40min, they were detected and analyzed by a gel imaging system, and the results are shown in FIG. 8. The processes of recovering the PCR product, connecting with a pMD19-T vector, transforming and identifying are carried out according to the method in example 1, and pMD19-EN1 plasmid and pMD19-EN2 are respectively constructed, wherein antisense fragments of EN1 and EN2 are respectively shown as SEQ ID NO.2 and SEQ ID NO. 3. The PCR identification results of pMD19-EN1 and pMD19-EN2 are shown in FIG. 9.

The constructed pMD19-EN1 plasmid and pMD19-EN2 are respectively cut by NcoI and BstEII, products containing EN1 and EN2 antisense fragments are recovered and are connected with pCambia1301-pPSP1-GUS vectors which are cut by the same enzyme, and pPSP1-EN1 plasmid and pPSP1-EN2 are respectively constructed. The restriction enzyme identification results of pPSP1-EN1 and pPSP1-EN2 are shown in FIG. 10.

The primer sequence for amplifying the fragment containing pPSP1-EN2-Nos polyA with HindIII and EcoRI sites is as follows: f: CCAAGCTTAGTAGGCCAAAATTTCCAAACA, respectively; r: CGGAATTCTTTTTTTTTTTTTTTTTTTTTTT, the amplification system is the same as above, the template is the constructed pPSP1-EN2 plasmid, the amplification conditions are pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 1min, annealing at 56 ℃ for 1min, extension at 72 ℃ for 4min, amplification for 35 cycles, extension at 72 ℃ for 5min, and storage at 4 ℃. The PCR products are separated by 1% agarose gel electrophoresis, and detected and analyzed by a gel imaging system after 100V constant voltage electrophoresis for 30-40 min. The PCR product containing the fragment of pPSP1-EN2-Nos polyA was recovered, ligated with pMD19-T vector, transformed and identified according to the method of example 1, and the resulting plasmid was named pMD19-pPSP1-EN 2.

The plasmid pPSP1-EN1 and the plasmid pMD19-pPSP1-EN2 are subjected to double enzyme digestion by HindIII and EcoRI respectively, and after a target fragment is recovered, the plasmid pPSP1-EN1+2 is constructed by connection, transformation and identification. The restriction enzyme identification result of pPSP1-EN1+2 is shown in FIG. 11.

2. Genetic transformation of maize and molecular detection of transgenic maize by pPSP1-EN1+2

The procedures of genetic transformation, PCR detection and Southern blot hybridization of maize were the same as in example 3. The procedures of RNA extraction and reverse transcription in RT-PCR detection of the interference effect of EN1 and EN2 gene fragments are the same as those in example 3, and the sequence of the primer for detecting the interference effect of the EN1 gene fragment is EN 1-5: aatcatcccgaggtgaccacggga, respectively; EN 1-3: cggtacgtcctcaagtactaggag, respectively; EN 2-5: aatcatcccgaggtgtccacgtg, respectively; EN 2-3: cgatacgtcctcaaatactaggaa, the reaction system and conditions are the same as those in example 7, the reference gene is corn tubulin gene, the primer sequences are Tub1-F: 5'-CCTTCAACACCCCTGCTATG-3' and Tub1-R: 5'-CAATGCCAGGGAACATAGTG-3', and the reaction system is: mu.L of template, 0.5. mu.L of each primer, 0.5. mu.L of Taq DNA polymerase, 2. mu.L of buffer, 1. mu.L of dNTP and water to 20. mu.L, and the reaction conditions are as follows: 94 ℃ for 5min, 94 ℃ for 30sec, 60 ℃ for 30sec, 72 ℃ for 20sec, 35 cycles, 72 ℃ for 10 min. The molecular detection results of pPSP1-EN1+2 transgenic maize are shown in FIG. 12.

3. Phenotypic observation and fertility identification of transgenic maize

Iodine-potassium iodide staining of transgenic corn pollen to obtain proper amount of pollen on a glass slide, and adding one drop of staining solution, wherein the preparation method comprises the following steps: weighing 1.95g of potassium iodide and 0.45g of iodine, dissolving in 150mL of distilled water, dyeing for 5min, observing the coloring condition under a microscope, wherein the fully-colored and dark brown pollen is fertile pollen, and the dark brown pollen is shrunken and the light colored pollen is abortion pollen. In the pollen in-vitro germination experiment, pollen which is just scattered in the morning on sunny days is selected and scattered on a germination culture medium, and the components of the culture medium are as follows: 15% sucrose, 0.005% H₃BO₃，10mM CaCl₂，0.05mM KH₂PO₄12% PEG 4000 and 0.7% agar, high pressureSterilizing, placing germination sample in culture dish with a layer of wet filter paper, culturing at 25 deg.C under constant temperature illumination for 2hr, and observing germination condition under microscope.

The phenotype identification result of the transgenic maize with the pPSP1-EN1+2 is shown in figure 13, and the result shows that the plants in the seedling stage and the growth stage of the transgenic maize grow normally and have no obvious defect, the pollen fertility is detected through self-pollination, and the result shows that the transgenic maize pollen obtained by the method cannot be fertilized, the female ear cannot fruit, and the purpose of abortion is achieved. The transgenic corn ear obtained by the method is conferred with wild corn pollen, so that the ear can bear fruit normally, and the corn material obtained by the method has the characteristics of a sterile line and can be applied to actual breeding.

Thus, it was found that the maize pollen-specific promoter of the present invention indeed has pollen-specific expression activity. Enolase (enolase) is a key enzyme in the glycolytic pathway that catalyzes the production of phosphoenolpyruvate from glycerate-2 phosphate, which controls the production of pyruvate, an important substance in cellular energy metabolism. When the energy metabolism of cells is abnormal, abnormal development is caused. Corn has two enolase isozymes, enolase 1(ENO1) and enolase 2(ENO2), encoded by ZmENO 1(EN 1 gene for short) and ZmENO2 gene (EN 2 gene for short), respectively. Therefore, the corn pollen specific promoter pPSP1 is used for driving the ZmENO1 and ZmENO2 gene antisense fragments to be expressed in the corn, so that the expression of the ZmENO1 and ZmENO2 genes in the pollen can be interfered to obtain a pollen abortion material, the adverse effect of using a constitutive promoter on the growth of other tissues of the corn can be avoided, and the corn pollen specific promoter has important application value.

Sequence listing

<110> Shenyang agriculture university

<120> pollen specific promoter and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2921

<212> DNA

<213> maize

<400> 1

agtaggccaa aatttccaaa caatgcaggc taatcgtaga cttatcacga ttaatcggat 60

caatctgaaa acattgcata aaaccttata ataaatgcta ttttgtcaat ctggagaggc 120

aactgctaga agacagaagg ttcttgatgc tttcagacaa ctggtgacag gaatacagat 180

ccaaagccaa gatacaggag gctgttactg ctgctgcaac tcatgtatca actacaaatt 240

atgttcttct gttggtaaaa cctctgaaca gcaagacgac ctttcacgcg cgacagacta 300

tctcgacgaa cctgtcgaag ttcttcctgc actcaccgcc tggcccgaac gcctcggcca 360

ccaaggcctg cagctccttg gcccttgccc tcatccgcgc cccttcctcc ccgcgcagca 420

gctcctccac ggccgcggcc actccggcgc tcgtcatggc gccctcgaac gcggcgccga 480

acccccacac gtgcgccacg gaccgcgcgt tcatccgctg gtcgccgaag aaggggcggc 540

acgccatggg caccccgctg gacacgccct ccagcaccga cgcccacccg gcgtgcgtca 600

cgaacgcgcc cacggaaggg tggcgcagca cggccacctg cggcgcccag ggcaccacga 660

gcccggaccc ggtgcccgcg gcgcggtcaa ggaaacccgg cgggaggagc gtccacgagt 720

cctcgcgcag cgaccacagg aacggcgcgg ccgaggcctc cagcccggcc gccagctcgc 780

ggagctcgtc aggccgcggg cacgccaccg tgccgaagct gacgtacgcg acgccgcgcg 840

cgggttggcg gcccagccag gcgaggcagc cgtgcgggtc ggctggtgcg gcggtgtcgg 900

cgtcgtcctc ggcgaggagg aggtggtagg ggccgaacgg gacgcagttg ggcaggatct 960

ccgcgagcgc cgcggtgacg tcgggcgggt ccaggcctgg gaacgtgttg agtgccacgg 1020

cggcggcaga gcgcgggagg cactgcccca tgcggtggac gaggaggttg atgacgtagt 1080

tgaagtcgcc ggagacgacg ccgtctggga ggtcacggac gcggtagctg gcgaggcccg 1140

ggtgggagat cagtggctcg tccaccctgt ttgcggctgc gaacgatgga aatgcaacag 1200

ccattcgctc atcaaacccg cgcgcaatga agggacaagg aagggagaga agtagtactg 1260

tagtagtaga atccaacgca ccctggtcgc cgacgtcctc ccggagcgcg tcggtgcgga 1320

cgtgcgccag gagcgcgcac gacgcggccg tccacaccgg cacccacggc gcccccgcgg 1380

aggcggccgc gtccgccgca ggccacacga acgcgtcgcc caccacgcag gtcaccctgg 1440

cgccgcccgc cgcggcgcgg gccgcctcca gccaggcctt cacccctccg gcctccgcgg 1500

cctccatgaa cagctgcatc tgccgcggca ccggcacggt ctcctcggcc gcgggcgcgc 1560

cgtccggtac ctcgacgaag cgcaggttcc ccgggagccc gtgcccggcg gaggcgctgc 1620

tggccttgcg gagctgcgcg agggaggacg cggtggagag gaacgagagc gtggccccgg 1680

acggcgccgc ggcggcagcc agggcgcgcg cgatggagag cagcaccgcc gcgtgggagc 1740

tgaacgggaa ggcgaccacg gccacgtgcg gcggcgggga ggactcgccg tcggcgggcg 1800

ccatcttcgc gcgctcaggc tgttcggcta ggctagccgc tagcgtcgga tgcgacctgc 1860

gatgcgatgc gaatgcgatg cgtgcgggct tcgctggggg cgcaacgtgt ccgctttatt 1920

ccgcgcgacc acgcgtgcgc acctgccagt cgcagttaga cgtgccgaaa tttttaggtg 1980

agccggcggt tggatcgccg cgcacgcagc gcatcgggct tagctgttgg tgctgtggag 2040

tttggggacc ggagtttgtt gggatcaacg gtgagtggat cgctcgccag cgtgcagcgc 2100

gctccagtag gtacattctg gacacacccc cgtgcacgat atggcaaggc cgggccagag 2160

ctgtgaaggc tgtggaccag gggatggggc actggattgt gccggattgt cacgggatct 2220

ggtctaaact gtcgtgttca tgtcagtcca ttgtgcggag gtcgtggtcc aaagatgtga 2280

ctaaacctgt gccgtatgac attatataaa tcgtgtccgt gtcgtgtcaa agcatcgcgg 2340

gtcgtactgt gcttagtgcc tacccattta ggccctgttt gggaacaaag tttttgaaaa 2400

ccacagtttt tgaaatacta cagtatactt tagttatgac aatactgcag tttacaatac 2460

cacaattttg aaaactgagg tccagaccta agtttagaat aacttaaaac aactatagta 2520

tttgcaatac ttcagtttta aaaacagaga ttttagccaa cttgccaaac acaattctgt 2580

atataatacc gtagtatttt attcttccaa aactgtgaaa aaacttcact ctcaaacacc 2640

ccttagcgaa taagtatata ggttacaatc gtgtgcgctc gtgagccatg gtagttttgt 2700

gatggtgttt gactgtttgt ttccaaagtg taaataaaaa gtcgagtaac caaacgtgtt 2760

ccacaggaac atgaatccgt tgtccagtgg ccacccgttg aacgaggttg aagcccccga 2820

taaacagctc tatttttggc cggcgcgtac ggcccaaacg gccaccacat ccctaaaatg 2880

gcgtgcttta ataagagacg tcaatcttgg agcaggagct g 2921

<210> 2

<211> 834

<212> DNA

<213> maize

<400> 2

ttagtagggc tccactggtg ccctgaactt tgctccggcg tagaccgcgg catcaccgag 60

ctcttcctcg atcctgagca gctggttgta tttggccagg cgctcagacc ggcaaggagc 120

tcccgtcttg atttggcccg tagacaggcc aactgagagg tcagcaatga aggtgtcctc 180

tgtctcgcca ctcctgtggc ttgccatcac tccccatccg gcgcgcttgg acatcctgac 240

agcttcgata ctctcggtca cagacccgat ttggttcacc ttcaagagga gagcattgca 300

ggtcttctca ttgatggcct tggcgaccct ggtggggttg gtaacgagaa gatcatctcc 360

tacaatctgc actttctgtc caatctcatc agtgagtttg gcataagtgc tccagtcatc 420

ctgatcaaat ggatcttcga tcgactcgat agggtactca gaaacaaagg acttgtacag 480

gtctttcagg ctgtcgcctg aaattttgtt tgagccatcg ttgttctcct ccttgaaatt 540

aagatcataa gtcttgtctt tctcaccgaa gaactcagaa gcagcaacat ccattccaat 600

gaccaccttt ccagtgtagc cagccttttc tatggctgcc ttcaatagtt caaggccttc 660

tttgttttcc tgaatgttag gtgcaaaacc accttcatcc ccaacatttg tcgcatcctg 720

accgtacttc ttcttgatta tgctcttcag gttgtggtac acctcaactc ccatcttcat 780

ggcctccttg aacgaggagg caccagttgg gaggatcatg aactcctgca tggc 834

<210> 3

<211> 834

<212> DNA

<213> maize

<400> 3

ttagtagggc tccacaggtg cacggaattt ggcacctgcg tagacagcaa tagcgccaag 60

ctcttcttca atcctaagaa gctggttgta tttggcaaga cgctctgatc tgcagggtgc 120

tccagtctta atctgacccg tggacaaacc aactgccaga tcagcaatga aagtgtcctc 180

agtctcacca ctcctatgac tagtcatcac accccagccc gcacgctttg acatcttcac 240

agcctcaata ctctcagtca cagatccgat ttggttaacc ttgagcagaa gggcattgca 300

tgatttctcc ttgatagcct tagcaaccct agtggggttg gtgacgagaa ggtcatcacc 360

aacaatctgc acttgctctc caatttcttc agtcatctta gcatagtgaa cccagtcatc 420

ctggtcaaaa ggatcttcaa tcgaaacaat ggggtattcg ctcacaaaag atttgtatac 480

attctttaag ctatcgccag atatcttctg tgaaccatca ttattctcct ccttaaagtt 540

gaggtcatag gtttggtcct tgtcactgta aaactccgaa gcagcaacat ccattccgat 600

gacaaccttg ccagtgtatc cagccttctc aattgcagtt ttcaagagct caagtccttc 660

cttgttctcc tggatgttcg gagcaaaacc accttcgtca ccaacattcg tggcatcttg 720

cccatacttc tttttgataa cggacttcag gtggtgataa acttcaacac ccatcttcat 780

agcctcctta aatgaggcag ctccagtagg aaggatcata aactcctgca tagc 834

Claims (9)

1. A maize pollen specific promoter is characterized in that the sequence of the promoter is shown as SEQ ID No. 1.

2. A recombinant DNA molecule comprising the maize pollen-specific promoter of claim 1 operably linked to a nucleotide sequence of interest.

3. The recombinant DNA molecule of claim 2, wherein said nucleotide sequence of interest functions to encode a protein or other active agent that is not normally associated with a pollen-specific promoter.

4. The recombinant DNA molecule of claim 2 further comprising an additional promoter sequence, said maize pollen specific promoter comprising a fusion promoter with the additional promoter sequence.

5. A plant expression vector comprising the recombinant DNA molecule of any one of claims 2 to 4.

6. The plant expression vector of claim 5, wherein the plant expression vector is pCambia 1301.

7. A method for expressing a nucleotide sequence of interest in maize using the pollen-specific promoter of claim 1, comprising the steps of:

(1) introducing a plant expression vector comprising claim 5 or 6 into a maize cell or tissue;

(2) growing said maize cell or tissue into a mature plant.

8. The method of claim 7, wherein step (1) uses any plant transformation method capable of introducing said plant expression vector into maize cells or tissues.

9. The method of claim 8, wherein said maize cells are derived from maize germinating embryos and said plant transformation method is agrobacterium-mediated.

Images