CN117417932A

CN117417932A - Promoter P delta OsVSP1 for specific expression of plant leaf mesophyll cells and application thereof

Info

Publication number: CN117417932A
Application number: CN202311344986.XA
Authority: CN
Inventors: 崔学安; 路铁刚; 吴苏亭; 张治国; 王志伟; 陈国鑫; 邢豹; 吴金霞; 孙学辉; 杜量衡
Original assignee: Biotechnology Research Institute of CAAS
Current assignee: Biotechnology Research Institute of CAAS
Priority date: 2023-10-17
Filing date: 2023-10-17
Publication date: 2024-01-19

Abstract

The invention discloses a promoter P delta OsVSP1 for specific expression of plant leaf mesophyll cells and application thereof, belonging to the field of plant molecular biology. The promoter pΔosvsp1 is 1) or 2) or 3) as follows: 1) A DNA fragment shown in SEQ ID No. 1; 2) A DNA fragment having a homology of 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more with the nucleotide sequence defined in 1) and having a promoter function; 3) DNA fragments which hybridize under stringent conditions with the nucleotide sequences defined under 1) or 2) and which have promoter function. Experiments prove that: the promoter P delta OsFS1 can effectively start the specific expression of a target gene in mesophyll cells of leaves, thereby effectively avoiding the adverse effect caused by the continuous expression of exogenous genes in other tissues of plants.

Description

Promoter P delta OsVSP1 for specific expression of plant leaf mesophyll cells and application thereof

Technical Field

The invention relates to the field of plant molecular biology, in particular to a promoter P delta OsVSP1 for specific expression of plant leaf mesophyll cells and application thereof.

Background

The growth and development of higher plants are the result of the ordered expression and synergistic effect of different genes in different time and space. Promoters are important cis-acting elements that determine the expression pattern and intensity of a gene by binding to transcription factors. The promoters are classified into three types, namely constitutive, inducible and tissue-specific promoters according to the mode in which they regulate gene transcription.

The tissue-specific promoter is a promoter with organ and/or tissue specificity for promoting transcription of a target gene, and under the drive of the promoter, the expression of the gene is often limited to certain specific organ and/or tissue sites and shows the characteristics of fertility regulation and the like. The tissue specific promoter can not only accumulate the expression product of the target gene in a certain organ or tissue part and increase the regional expression quantity, but also effectively avoid negative effects such as metabolic burden and the like caused by the constitutive expression promoter by adopting the tissue specific expression promoter to drive the target gene to express. However, there are still few promoters for tissue-specific expression that are clear in the regulatory mechanisms and are useful for genetic improvement of crops.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a DNA molecule with the mesophyll cell specific promoter function. The technical problems to be solved are not limited to the described technical subject matter, and other technical subject matter not mentioned herein will be clearly understood by those skilled in the art from the following description.

In order to solve the technical problems, the invention provides the following technical scheme:

the invention provides a DNA molecule which is 1) or 2) or 3):

1) A DNA fragment shown in SEQ ID No. 1;

2) A DNA fragment having a homology of 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more with the nucleotide sequence defined in 1) and having a promoter function;

3) DNA fragments which hybridize under stringent conditions with the nucleotide sequences defined under 1) or 2) and which have promoter function.

Wherein SEQ ID No.1 consists of 1954 nucleotides in total.

Herein, the 80% identity or more may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

The invention also provides the following biological materials:

b1 An expression cassette comprising a nucleic acid molecule as defined in SEQ ID No. 1;

b2 A recombinant vector comprising a nucleic acid molecule as defined in SEQ ID No. 1;

b3 A recombinant microorganism comprising a nucleic acid molecule as defined in SEQ ID No.1, or a recombinant microorganism comprising the expression cassette of B1), or a recombinant microorganism comprising the recombinant vector of B2);

b4 A transgenic plant cell line comprising a nucleic acid molecule as defined in SEQ ID No.1, or a transgenic plant cell line comprising an expression cassette as described in B1).

Vectors described herein are well known to those of skill in the art and include, but are not limited to: plasmids, phages (e.g., lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), ti plasmids, or viral vectors. The recombinant vector may be a recombinant expression vector or a recombinant cloning vector.

The recombinant vector in the biological material is obtained by inserting the DNA molecule into a multiple cloning site or a recombination site of a plant expression vector.

In one embodiment of the present invention, the recombinant vector is specifically a vector obtained by inserting the DNA molecule shown in SEQ ID No.1 between the PstI and EcoRI cleavage recognition sites of the pCAMBIA1391Z vector and keeping the other sequences of the pCAMBIA1391Z vector unchanged.

Further, the expression cassette in the above biological material is composed of a target gene whose expression is started by the DNA molecule having a promoter function, and a transcription termination sequence; the DNA molecule is functionally linked to the gene of interest, and the gene of interest is linked to the transcription termination sequence.

In one embodiment of the invention, the gene of interest is in particular the GUS gene (derived from the pCAMBIA1391Z vector); the transcription termination sequence is specifically a NOS transcription terminator (derived from the pCAMBIA1391Z vector).

The invention also provides a method for cultivating the transgenic plant, which is to use the DNA molecule to start the expression of the target gene in the original plant, so as to obtain the transgenic plant expressing the target gene.

Specifically, the expression of the gene of interest is the specific expression of the gene of interest in mesophyll cells. Compared with the prior art, the invention has the following advantages:

(1) The rice leaf mesophyll cell specific expression promoter is P delta OsVSP1, which is derived from mutant vsp1 with a background of rice japonica rice variety Japanese sunny, the mutant promoter sequence POsVSP1 is deleted for 8bp to generate P delta OsVSP1, the fragment size of the promoter is 1954bp, and the P delta OsVSP1 promoter has the following characteristics: a) Is positioned at the 5' end and upstream of the OsVSP1 gene; b) The length of the base is 1954bp; c) Has necessary site for initiating transcription and transcription initiation point; d) Specifically expressed in mesophyll cells of rice leaves. The promoter provided by the invention can effectively control the specific expression of a target gene in mesophyll cells of leaves, and can avoid adverse effects caused by the continuous expression of exogenous genes in other tissues of plants, such as biosafety problems caused by transgene drift and pollen escape.

(2) The recombinant expression vector containing the mesophyll cell specific expression promoter Pdelta OsVSP1 is transferred into the mesophyll cell specific expression promoter, and under the regulation and control of the mesophyll cell specific expression promoter Pdelta OsVSP1 of the recombinant expression vector, the downstream gene is positioned in the mesophyll cell for expression, so that a tool is provided for researching the specific expression of the gene in the mesophyll cell in the field of plant genetic engineering, and the recombinant expression vector has a wide application prospect.

Experiments prove that: the promoter P delta OsVSP1 provided by the invention can effectively start the specific expression of a target gene in rice leaf mesophyll cells, can avoid adverse effects caused by continuous expression of the target gene in other cells of plant leaves, and can be used for functional analysis and identification of genes related to growth and development of the plant leaf mesophyll cells. Not only serves the breeding of transgenic rice, but also reserves resources for the transformation and design of long-term promoters.

Drawings

FIG. 1 is a graph showing the results of molecular detection of the P.DELTA.OsVSP1 promoter. A is the result of PCR; b is the double enzyme digestion result. M1 and M2: DL-5000,1: the size of the band is 1954bp;2: bamHI and NcoI double cut bands.

FIG. 2 is a map of the T-DNA region of the expression vector pCAMBIA1391Z. Wherein A is pCAMBIA1391Z vector, LB and RB are respectively represented as left and right boundaries of T-DNA; hyg represents the hygromycin resistance gene; MCS means multiple cloning sites; NOS represents a terminator of a gene; b is pCAMBIA1391Z polyclonal site map

FIG. 3 is a graph showing the results of histochemical staining of GUS gene. Wherein A represents a blade; b represents a blade transverse cutting view.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

pCAMBIA1391Z vector: described in "Xuean Cui, zhiguo Zhang, yanwei Wang, jinxia Wu, xiao Han, xiaofeng Gu, tiegang Lu. TWI1 Regulates cell-to-cell movement ofOSH15 to control leafcell date. New Phytol.2019Jan;221 326-340', which is available to the public from the institute of biotechnology at the national academy of agricultural sciences, which is used only for repeated experiments related to the present invention, and which is not used for other purposes.

Agrobacterium AGL1: purchased from Beijing village allied biogenic gene technologies Inc., product number ZK296.GUS staining solution (pH 7.0): the solute consisted of 100mM potassium ferrocyanide, 100mM potassium ferricyanide, 0.5mM EDTA (pH 8.0), 10mg/ml X-Gluc and 0.1% (volume ratio) Tween 20 in 200mM PBS buffer.

The primers used in the following examples were synthesized by Shenzhen Dai bioengineering Co., ltd, and sequenced by Shanghai bioengineering Co., ltd. pTEAY-T1 Cloning Kit, taq enzyme, trans 5. Alpha. Competence and related kits were all purchased from Beijing full gold biotechnology Co., ltd; restriction enzymes BamHI and NcoI, T ₄ The ligases were all purchased from Dalian TaKaRa; antibiotics were purchased from SIGMA company in the united states; the rest reagents are all of domestic analytical purity.

EXAMPLE 1cloning of the rice leaf mesophyll cell-specific promoter P.DELTA.OsVSP1

1. Primer design

Primer 1 and primer 2 were used as primers for amplifying the P.DELTA.OsVSP1 promoter, primer 1 plus BamHI cleavage recognition site sequence GGATCC, and the downstream primer plus NcoI cleavage recognition site sequence CCATGG.

The primer sequences were as follows:

primer 1 (upstream primer): 5'-GGATCCCTGCATCCCAAATAAGAAGGAACT-3';

primer 2 (downstream primer): 5'-CCATGGGTCGACTCGGTCTCAGTGTCGCT-3'.

2. PCR amplification

And (2) taking the rice vsp1 mutant genome DNA extracted by the efficient plant genome DNA extraction kit of the Tiangen company as a template, and carrying out PCR amplification by using the upstream primer and the downstream primer designed in the step (1) to obtain a PCR product.

The PCR conditions were as follows: pre-denaturation: 98 ℃ for 10min; denaturation: 98 ℃ for 10s; annealing: 5s at 60 ℃; extension: 2min30s at 72 ℃ for 36 cycles; total extension: and at 72℃for 10min.

3. PCR product detection

After the completion of the PCR reaction, the PCR product was detected by 2% agarose gel electrophoresis, and the detection results are shown in FIG. 1A.

4. pEASYT1Cloning Vector-P delta OsVSP1 Vector construction

Recovering and purifying the PCR product to obtain a target fragment, connecting the target fragment with a pEASY T1Cloning Vector to obtain a recombinant Vector pEASY-P delta OsVSP1, and finally converting the recombinant Vector pEASY-P delta OsVSP1 into escherichia coli competent Trans5 alpha cells; positive clones were screened by PCR and restriction enzyme detection and sequenced, and sequencing results showed that pEASY-pΔosvsp1 contained a DNA molecule with nucleotide sequence of SEQ ID No.1, which was named pΔosvsp1 promoter (1954 bp total).

SEQ ID No.1

CTGCATCCCAAATAAGAAGGAACTAGGAGATGACCAGAACAATGAGGGCGCCGCGGATATCACTAACCCAGGAATTGTTTGCGACGCCAGAACCAATTGTGCGTGAACCCCGGAGACGCGAGGGCACGACGACGAGGAGGTCTTGAGCCAAGGAGGCCACCAGGCGACCGTCGATCCACTGGTCAGTCCAGAAGAGAGTTGATTCACCATCTCTTGACACGAAGAATGTGACGCAGCAAACATGTCGGAGACACTCCGCTCAACGGGGGCCTTAAGGCCAGCCCAGTAGGGATGCAATGAGCACTGAAGCCAAAGCCAGCGAACTCGCAGGGCGAACCCACTAGTTTTAAAAAAACTAGATAATTTTACTTTTCTAGCTCTTTTGGACAGCTATATGCTCTTTTATCTATCTACATTCAATTTATTGTACACACAACCATGTGAGTTCATTGCCAAGTAAAAACCGAAATACTTAAGATCATTCATATACTTAAGAAAATGGCAAATTTTGCTATAGGACACCTAAAATTTGTGTAATTTGCTTATAGAAATTGTAAAAGCATGTCACGATTGAAAGCCATCCTAAAAGACTAATAATTTGCTAGAGGACACTTGCGACTCAATTGTAAAGATAAATTCTTAGGAAAAAAGATAATGCCCCTAGGAACACATGCTTCAAACATAGTGATAGAGTGAAGACTTAGAAATTATGCAATTCTAAATTAGCCATCACCCCAAATAGATCACTAGTATACATCGTATTCCATCTTCACTCAAGCCTTAGCTCAAAAGCTTTTCACCCTAGAGTCATTCTCATTCTTTTGAAGAATTTATTGTTCCAATTGAGTCGAAATTGTCCTCCAGCAAATTATCAGTTTTAGAGATGTCTTTTAGCCGTGAGATGTTTTTGCGATGTATATCAGCAAATTGTACAAATTTTGTGTGCCTTGTAGCAAAATTTGCCTTAAAAAAAAGAGTCAGCGTGATTCGATATAATAAAAATAAGAGTAGCGTGATTCAAGATATAATAAAAATAAGATTACCTGGTTCAAGGTGTACTTGTTTTTAAAACCACCCGTCATTTGATCGTTGCTTTTACCAGCCGTAGTCAAAATTTAAATCTTACTACTAAATTTAATTTTAAGGTTTTTTATCATAGTTTTTTTGGCATTAACATTTAAATCACTAACAACACAATATAAAAGTTCTCCTCTTCATTTATTCTTTCTCTCTTTATTATAAGAGCTATATAGCAAATTGTTTCAACATATATTTGTCGTGTGTTTTAGGCCCCATCGTTTAACCAAATATGGATAACACATTTATGTGTGTATTCTTAGCGATTTAAATACCAATGTTGAAAAATAAATTTTGATAAAAAAAACTTGAAAATCAAAATTTTAGAATTTAAATTTTAACAACTACCGATATTGTAGAGAAAAAGAGAAGATCTTATTTCATAAAGGGAGACTACGTAACGGTATTATCGTTTCGACGGAATAACTCACATCGGCATGAATCCTATAGGTATTAGATCTAATACATTCGATACCAAACATGATACCCCGTACGTATCATATCTGATATCATACTGACGTCAATATGATACTATACGTATCAGATCTGGTACCTACAATGCTAGATATGAACCCCATAAGAATTAGATCTGGCATCTAAATACCATGTTCACGTCATCATGTTACCATGATACCTCGTGCTATTCGGTTGAAACAGTATAACATTCTACGGTATTTCTGTATTTTAGATTGATATACAATCTTTTGTGGTGTTAGCACTAGCAGTCAAAGGAGTGGCCGAAGTGGGGACCATCTTCCTCCAGATTAAACCTTTTTTTTTCCCGGACTCGCACCGGACTTGCCGTCCGCCGCCATTGCGCGTCTCCGCCCAAACCCAAATGTTCGCCGACGGCGAGCGACACTGAGACCGAGTCGAC

Example 2 functional verification of P.DELTA.OsVSP1 promoter

1. Acquisition of transgenic lines

1. Construction of expression vectors

The recombinant vector pEASY-P.DELTA.OsVSP1 in step 4 of example 1 was digested simultaneously with BamHI and NcoI to obtain a P.DELTA.OsVSP1 fragment as shown in FIG. 1B; cutting the pCAMBIA1391Z vector by restriction enzymes BamHI and NcoI (the map is shown in FIG. 2) to obtain a pCAMBIA1391Z vector skeleton fragment; and connecting the P delta OsVSP1 fragment with the pCAMBIA1391Z vector skeleton fragment to obtain a recombinant plasmid P delta OsVSP1-pCAMBIA1391Z.

The recombinant plasmid P delta OsVSP1-pCAMBIA1391Z is obtained by replacing the sequence between the BamHI and NcoI cleavage recognition sites of the pCAMBIA1391Z vector with the P delta OsVSP1 promoter sequence shown in SEQ ID No.1, and keeping other sequences of the pCAMBIA1391Z vector unchanged. Wherein, the P.DELTA.OsVSP1 promoter is used for promoting the expression of GUS gene.

2. The recombinant plasmid Pdelta OsVSP1-pCAMBIA1391Z is introduced into agrobacterium tumefaciens AGL1 to obtain recombinant agrobacterium tumefaciens AGL 1/Pdelta OsVSP1-pCAMBIA1391Z.

3. And (3) suspending the recombinant agrobacterium prepared in the step (2) AGL1/P delta OsVSP1-pCAMBIA1391Z in a YEP liquid culture medium for culture to obtain a bacterial solution of the agrobacterium with P delta OsVSP1-pCAMBIA1391Z, and storing at-80 ℃ for later use.

YEP liquid medium: 10.0g of yeast extract powder, 10.0g of peptone, 5.0g of sodium chloride are weighed and dissolved in 1L of distilled water or deionized water, and the mixture is autoclaved at 121 ℃ for 15 minutes and cooled for standby, wherein pH 7.0+/-0.2 (25 ℃).

Example 3 Agrobacterium-mediated genetic transformation of Rice "Nippon" and detection of transgenic plants

S1, rice callus induction

The rice variety 'Nippon sunny' is preserved in a combined laboratory by photosynthesis promotion and C4 rice creation of the institute of biotechnology of China academy of agricultural sciences. The optimal hygromycin concentration for screening of resistant calli was 50mg/L.

Shelling mature water Japanese sunny seeds, then sequentially treating 1min with 75% ethanol and sterilizing the seed surface with 20% sodium hypochlorite for 15min; washing the seeds with sterilized water for 5 times; placing seeds on a callus induction medium, wherein the induction medium is obtained by adding 2.5 mg/L2, 4-D,0.8g/L hydrolyzed casein, 0.3g/L proline, 30g/L sucrose and 3g/L phytagel on the basis of an N6 medium; the inoculated seeds were placed in the dark for 4 weeks at a temperature of 28.+ -. 1 ℃.

S2, subculturing the callus

The embryogenic callus which is bright yellow, compact and relatively dry is selected and placed in a secondary culture medium (the nutrient components are the same as those of an induction culture medium), and is cultured for 3 weeks in the dark, wherein the culture temperature is 28+/-1 ℃.

S3, preparing an agrobacterium culture solution

Agrobacterium culture Agrobacterium was pre-cultured in LA medium (10 g/L Tryptone,5g/L Yeast extract,10g/LNaCl,15g/L agar powder, pH 7.0) containing 50mg/L kanamycin for 2d at 28+ -1deg.C; agrobacterium was transferred to suspension medium (N6 medium macroelement component, N6 medium microelement component, N6 medium ferric salt component and N6 medium vitamin component) and 2.5 mg/L2, 4-D,0.8g/L hydrolyzed casein, 0.3g/L proline, 30g/L sucrose, 10g/L glucose and 100. Mu.M acetosyringone were added thereto, and cultured on a shaker at 28℃for 2 hours at 200 rpm.

S4. Agrobacterium infection

Transferring the callus into a sterilized triangular flask; regulation of Agrobacterium suspension to OD _600nm The value is about 0.3; soaking the callus in agrobacterium suspension for 30min; transferring the callus to sterilized filter paper for drying; then placed on a co-culture medium (N6 medium macroelement component, N6 medium microelement component, N6 medium ferric salt component and N6 medium vitamin component, 2.5 mg/L2, 4-D,0.3g/L proline, 30g/L sucrose, 10g/L glucose, 100 mu M acetosyringone and 8g/L agar powder) for 3D culture at a temperature of 22 ℃.

S5, callus screening culture

Washing the co-cultured callus with sterilized water for 10 times; then soaking the callus in sterilized water containing 200mg/L of timentin for 30min; transferring the callus to sterilized filter paper for drying; the callus was transferred to selection medium (2.5 mg/L2, 4-D,0.3g/L proline, 50mg/L hygromycin, 200mg/L timentin, 30g/L sucrose and 8g/L agar powder were added on the basis of N6 medium) and selected for 2 times each for 2 weeks.

S5, callus differentiation culture

The resistant calli were transferred to differentiation medium (MS medium plus 2mg/L KT,0.2mg/LNAA,2 mg/L6-BA, 0.2mg/L IAA,0.8g/L hydrolyzed casein, 0.3g/L proline, 30g/L sucrose and 3g/L phytagel), and cultured under light (2000 Lux) at 28.+ -. 1 ℃.

S6, rooting culture

Roots produced during differentiation were cut off and then transferred to rooting medium (20 g/L sucrose and 3g/Lphytagel were added on a 1/2MS medium basis) and cultured with 2000Lux light for 3 weeks (temperature 28.+ -. 1 ℃).

S7, transplanting tissue culture seedlings

And (3) washing off residual culture medium on roots, transferring seedlings with good root systems into a greenhouse, keeping soil moist for the first few days, and obtaining regenerated plantlets which are T0 generation transgenic plants.

S8, identifying transgenic plants

Extracting the DNA of 11T 0 generation transgenic plants obtained in the step 4, and carrying out PCR amplification by using a primer 3 and a primer 4, wherein the primer 3 is from a P delta OsVSP1 promoter, and the primer 4 is from a carrier skeleton. PCR procedure was as above. If PCR amplification gave a DNA fragment of 1954bp in size, T was indicated ₀ The DNA of the transgenic plant contains a P delta OsVSP1 fragment, namely the positive transgenic P delta OsVSP1 promoter plant. The PCR result shows that 10 positive transfer P delta OsVSP1 promoter plants are obtained.

Primer 3 (upstream primer): 5'-CTGCATCCCAAATAAGAAGGAACT-3';

primer 4 (downstream primer): 5'-GTCGACTCGGTCTCAGTGTCGCT-3'.

S9, GUS staining identification of plant transformed with P delta OsVSP1 promoter

Collecting the young roots, stems, young leaves and glumes of the 10 positive P delta OsVSP1 promoter plants identified in S8, and transferring the samples into a test tube; then adding a proper amount of GUS buffer solution to submerge the tissue blocks, adding GUS staining solution, uniformly mixing, and preserving for 4-12h at 37 ℃; after dyeing, firstly placing the dyed tissue in 75% ethanol for rinsing and decoloring, and then soaking in 50% and 20% ethanol for more than 20min respectively until the material is white; finally, observing under a microscope, and obtaining blue tissue which is the GUS expression part.

The staining results are shown in FIG. 3. Wherein A represents a blade; b represents a blade transverse cutting view. Thus, the GUS gene was specifically expressed only in all mesophyll cells of the P.DELTA.OsVSP1 promoter-transferred plant (blue part indicated by the frame or arrow). Therefore, the promoter Pdelta OsVSP1 of the invention is specifically expressed in all mesophyll cells of rice leaves, and can be used for promoting the specific expression of a target gene in mesophyll cells of rice leaves.

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims

A dna molecule, 1) or 2) or 3) as follows:

1) A DNA fragment shown in SEQ ID No. 1;

2) A DNA fragment having a homology of 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more with the nucleotide sequence defined in 1) and having a promoter function;

3) DNA fragments which hybridize under stringent conditions with the nucleotide sequences defined under 1) or 2) and which have promoter function.
2. The biomaterial is any one of the following B1) to B4):

b1 An expression cassette comprising the nucleic acid molecule of claim 1;

b2 A recombinant vector comprising the nucleic acid molecule of claim 1;

b3 A recombinant microorganism comprising the nucleic acid molecule of claim 1, or a recombinant microorganism comprising the expression cassette of B1), or a recombinant microorganism comprising the recombinant vector of B2);

b4 A transgenic plant cell line comprising the nucleic acid molecule of claim 1, or a transgenic plant cell line comprising the expression cassette of B1).
3. The biomaterial according to claim 2, wherein the recombinant vector is a recombinant plasmid obtained by inserting the DNA molecule according to claim 1 into a multiple cloning site or a recombination site of a plant expression vector.
4. The biomaterial according to claim 3, wherein the expression cassette consists of a target gene whose expression is initiated by the DNA molecule having a promoter function, and a transcription termination sequence; the DNA molecule is functionally linked to the gene of interest, and the gene of interest is linked to the transcription termination sequence.
5. A method for growing transgenic plants, characterized in that the expression of a gene of interest is initiated in a starting plant with the DNA molecule according to claim 1, resulting in a transgenic plant expressing said gene of interest.
6. The method of claim 5, wherein said expressing said gene of interest is specific for expressing said gene of interest in mesophyll cells.
7. Use of a DNA molecule according to claim 1 or a biomaterial according to any one of claims 2 to 4 for any one of the following:

a1 Use in the initiation of expression of a gene of interest;

a2 Use in genetic modification of plants.
8. The use according to claim 7, wherein said promoting expression of the gene of interest is promoting expression of the gene of interest in a plant.
9. The use according to claim 8, wherein the expression is specific expression in mesophyll cells of a plant.
10. The method according to claim 5 or 6, and/or the use according to any one of claims 7-9, wherein the plant is any one of the following:

g1 Monocotyledonous plants;

g2 A gramineous plant;

g3 Rice plant;

g4 Rice seed plants;

g5 Rice.