CN106282199B - Gene of dwarf plant and application thereof - Google Patents

Abstract

The invention discloses a gene of a dwarf plant, which has a nucleotide sequence shown in SEQ ID No.1, or a sequence with one or more nucleotides deletion, addition and/or substitution but unchanged functions. The invention also relates to an expression vector and a cell containing the gene of the dwarfing plant, a method for dwarfing the plant, and application of the expression vector containing the gene and a transgenic cell containing the gene in the dwarfing plant. The rice plant containing the gene of the dwarfing plant of the invention is dwarfed compared with its wild type.

Description

Gene of dwarf plant and application thereof

Technical Field

The invention relates to a gene of a dwarfing plant, an expression vector and a cell containing the gene of the dwarfing plant, a method for dwarfing the plant, and application of the expression vector containing the gene and a transgenic cell containing the gene in the dwarfing plant.

Background

Dwarfing is an excellent agronomic trait in many plants. In recent years, various dwarfing-related genes have been identified and cloned, most of which are related to synthesis and signal transduction of plant hormones (such as gibberellin, auxin, brassinosteroids, etc.), and the loss of function or over-expression of which can cause dwarfing phenotype of plants; in addition, some polyamine synthetic genes, cell wall related genes, homeobox genes, transcription factor genes and other important genes for growth and development are found to cause plant dwarfing due to functional deletion.

The dwarfing of rice plants is generally considered to be the change of morphology or cytology of the rice plants caused by the action of dwarf genes, such as shortening internodes, reducing the number of cells and the like; at the same time, the expression of the gene is also influenced by the external environment and endogenous conditions. While plant hormones are involved almost in the whole process of rice growth and development, they can exert physiological effects independently, and can also precisely regulate the development of plants through interaction with other hormones or genes.

In recent years, extensive and intensive research on genetics of plant dwarfing-related genes, hormone regulation of dwarfing mutants, cloning and utilization of dwarfing-related genes and the like has been carried out, and particularly great progress has been made in controlling plant height by using genetic engineering means.

Disclosure of Invention

The invention aims to provide a gene of a dwarf plant and application thereof.

The invention provides a gene of a dwarf plant, which has a nucleotide sequence shown in SEQ ID No.1, or a sequence with one or more nucleotides deletion, addition and/or substitution but unchanged functions.

Preferably, the gene has a nucleotide sequence shown as SEQ ID No. 1.

Preferably, the plant is rice.

The present invention also provides an expression vector containing the gene of claim 1.

The present invention also provides a transgenic cell containing the gene of claim 1.

Preferably, the transgenic cell is a rice transgenic cell.

The present invention also provides a method for dwarfing a plant, which comprises introducing the gene of claim 1 into rice cells to obtain a dwarfed transgenic rice plant.

The invention also provides a gene of the dwarfing plant, an expression vector containing the gene and application of a transgenic cell containing the gene in the dwarfing plant.

Preferably, the plant is rice.

The rice plant containing the gene of the dwarfing plant of the invention is dwarfed compared with its wild type.

Drawings

FIG. 1 is an electrophoresis diagram of PCR products of genes of dwarf plants, in which lanes 1-2 are 426bp fragments of the genes and M is a 2000bp control.

Figure 2 is the expression level of the gene in transgenic lines and wild type plants (mean + standard error, n-5), wherein asterisks indicate significant differences between transgenic lines and wild type (x, P <0.01, student's t-test). Ov1-3 was three different transgenic lines.

FIG. 3 is the change in phenotype of the over-expressed transgenic line, wherein FIG. 3A is the phenotype of the over-expressed transgenic line at day 30, FIG. 3B is the phenotype of the over-expressed transgenic line at day 55, and Ov1-3 are three different transgenic lines.

Detailed Description

The following describes in detail specific embodiments of the present invention. It should be understood that the detailed description and specific examples, while indicating the present invention, are given by way of illustration and explanation only, not limitation.

1. Experimental Material

1.1 Experimental materials

Wild-type Nipponbare (Nip, Nipponbare) seeds were purchased from the japan rice genome resource center.

1.2 conditions for Rice cultivation

Selecting plump and mature Nipponbare seeds, and adding 0.66% diluted HNO₃Breaking dormancy for 16h, accelerating germination to expose white in dark at 37 deg.C, sowing on nylon gauze, culturing in rice nutrient solution, culturing in nutrient solution for one month, and planting in soil. The cultivation is carried out in an incubator or a greenhouse under the following environmental conditions: the illumination intensity is 450 mu mol m^-2s^-1Humidity is 70%, temperature and light cycle are 30 ℃/24 ℃ and 12h/12 h.

1.3 primer Synthesis and sequencing

Both primer synthesis and sequencing were performed by Biotechnology (Shanghai) Inc.

2. Experimental methods

2.1 cloning of genes of dwarf plants

The full-length cDNA clone AK240906 of the gene was obtained from the Rice Genome Resource Center (http:// www.rgrc.dna.affrc.go.jp) of Japan, and the full-length of the gene was amplified using OU/L primers using the plasmid of AK240906 as a template. The PCR primer sequences were as follows:

OU：5’-CACCATGATCAGTGCCAGGAGA-3’

OL：5’-CAAGCAAGAAATATGCTGGTTGAC-3’

the PCR conditions were: 5min at 95 ℃; 30s at 95 ℃, 30s at 60 ℃ and 1min at 72 ℃ for 15 cycles; 10min at 72 ℃.

2.2 construction of expression vectors

Performing Gel electrophoresis detection on the PCR amplification product obtained in the step 2.1, and recovering and purifying by using a Gel recovery Kit MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0(Code No.9762) of TaKaRa company, wherein the specific operation method refers to the specification; connecting the purified fragment to a cloning vector pENTR, connecting overnight at 24 ℃, thermally shocking and transforming a colon bacillus TOPO10 competent cell, coating a kanamycin-resistant LB plate, culturing for 16-18h at 37 ℃, selecting a positive monoclonal colony, extracting a plasmid, and sending the plasmid to Shanghai for biological sequencing; the full-length fragment of the dwarfing gene on the correctly sequenced plasmid was recombined by LR reaction exchange into the overexpression vector pH7FGW 2. For ligation of pENTR vector and LR reaction, refer to the Invitrogen Specification (Code No. K2400-20 and Code No. 11791-020).

2.3 Induction of mature Rice embryos and Agrobacterium-mediated transgenesis

Mature seeds of wild rice Nipponbare are used as test materials to induce rice callus, and the constructed overexpression vector is transferred into rice by an agrobacterium-mediated transgenic method. The transformed rice callus is co-cultured by agrobacterium, screened by positive callus, differentiated to emerge, rooted by plantlet and hardened, and then transferred to field for seed reproduction. The method comprises the following specific steps:

2.3.1 preparation of shock-competent cells, the procedure was as follows:

(1) EHA105 single colonies were picked from streaked non-resistant YEP plates. Inoculated into a small amount of YEP liquid medium (added with 50mg/L streptomycin), and shake-cultured at 28 ℃ overnight.

(2) 1ml of the bacterial suspension was aspirated and inoculated into 100ml of YEP (50mg/L streptomycin had been added) liquid medium. Shake culture at 28 ℃ for 2h, and detection was started from 4h until OD600 was 0.3. (about 4 to 5 hours)

(3) Preparing competent cells by the following steps:

a) the broth was submerged on ice for at least 1h with the culture vessel and not shaken occasionally to allow uniform refrigeration of all the broth.

b) Transfer the broth into a 50ml centrifuge tube that was also pre-cooled. Centrifuge at 4000rpm for 10 minutes at 4 ℃.

c) The supernatant was discarded and the cells were gently suspended in 20ml of pre-cooled HEPES (1mM, pH7.0) solution.

d) Centrifugation was carried out at 4000rpm for 10 minutes at 4 ℃. The supernatant was discarded.

e) Repeating the steps (3) and (4)2-3 times.

f) The supernatant was discarded and 2ml of pre-cooled 10% glycerol was added to gently suspend the cells. The mixture was allowed to stand on ice for several minutes. I.e. competent cells.

g) Split 100 μ l to 1.5ml centrifuge tubes. Quick freezing with liquid nitrogen, and storing at-70 deg.C.

2.3.2 Agrobacterium strain competence electrotransformation, the steps are as follows:

a) adding 2. mu.l of plasmid into EHA105 competent cells, mixing gently, and ice-cooling for 30 min;

b) sucking the plasmid and competent mixed solution into an electrode cup, and performing electric shock transformation;

c) immediately adding l ml of fresh SOC liquid culture medium, and gently shaking at 28 ℃ and 150rpm for 4-6 h;

d) centrifuging at 5000rpm for 1-2 min, collecting thallus, spreading on YEP solid culture medium plate containing streptomycin (50mg/L) and spectinomycin (50mg/L), and culturing at 28 deg.C for 2-3 d;

e) selecting single colony, identifying positive transforming bacteria, and storing at-80 deg.c.

2.3.3 mature embryo as test material to induce callus, the steps are as follows:

a) selecting plump, smooth and non-bacterial plaque seeds, and shelling;

b) putting the seeds into a 50ml sterile centrifuge tube, and pouring 70% alcohol for disinfection for 2 minutes;

c) pouring off alcohol, adding 40ml of 20-30% sodium hypochlorite (NaClO) solution, and soaking for 30 minutes;

d) pouring out the sodium hypochlorite solution, washing the seeds with sterile distilled water for 4-5 times, and soaking for 30 minutes for the last time;

e) the seeds are put on sterile filter paper for suction drying and are put into a mature embryo induction culture medium, and 12-14 seeds are placed in each dish;

f) sealing film (Micropore) after completion of operation^TMSurgical Tape) sealed and incubated for 3 weeks at 28 ℃ in an incubator illuminated by light;

g) opening the culture dish on an ultraclean workbench, picking naturally-divided embryogenic callus (light yellow, compact and spherical) with forceps, placing into a subculture medium, and subculturing at 28 deg.C in an illumination incubator for 5-10 days.

2.3.4 infection and selection of resistant callus

a) Selecting Agrobacterium monoclonal or sucking the preserved Agrobacterium liquid 50 μ L into 5ml YEP (containing 50mg/L streptomycin and 50mg/L spectinomycin) culture solution, performing shake culture at 28 deg.C and 250rpm for 12-24 hr to obtain liquid OD₆₀₀0.8 to 1.0;

b) collecting 500 μ L of the bacterial liquid, centrifuging at 4 deg.C and 4000rmp for 2min in a 1.5ml centrifuge tube, discarding supernatant, and making into suspension with 30ml of AAM sensitive bacterial liquid containing 200 μmol/L AS (acetosyringone) to make the bacterial liquid OD₆₀₀To a final concentration of 0.01;

c) picking out the rice callus growing to a certain size, and putting the rice callus into the agrobacterium tumefaciens suspension for infection for 5 minutes;

d) taking out the callus, placing the callus on sterile filter paper, and draining the callus for 30-40 minutes;

e) placing the callus on a co-culture medium, and performing dark culture at 25 ℃ for 2.5 days;

f) taking out the callus, and washing with sterile water for 5-6 times without continuous oscillation. Then, the mixture is washed for 1-2 times by using 250mg/L carbenicillin sodium carb (or 500mg/L cephradine cef) sterile water. Finally placing the mixture on sterile filter paper and draining for 1-2 h;

g) transferring the aired callus to a selection culture medium containing 300mg/L carbenicillin sodium carb (or 500mg/L cephradine cef) and 50mg/L hygromycin hyg for first round selection, wherein each dish contains 25 calli (one initial callus is used as a strain), and the selection culture is carried out at 28 ℃ for 14d in light;

h) the grown primary calli were transferred to selection medium containing 300mg/L carbenicillin sodium carb (or 500mg/L cephradine cef) and 80mg/L hygromycin hyg for a second selection round at 12 per dish and 28 ℃ in the light until granular resistant calli grew out.

2.3.5 Induction differentiation and rooting of resistant callus

a) Selecting 3-7 yellow resistant calli from the same callus, transferring into a differentiation tank (1 tank and 1 strain is preferred) filled with differentiation medium, placing into a constant temperature culture room at 25 deg.C, and waiting for differentiation into seedlings (20-50 d);

b) when the seedlings grow to the top of the differentiation tank cover, the roots of the regenerated plants are removed by sterile scissors (the root-stem combination part is not damaged carefully), and the regenerated plants are placed into a rooting culture medium to take root and strengthen the seedlings;

c) and 7d, picking out test tubes with intact root, stem and leaf differentiation of the seedlings (the seedlings grow to the tops of the test tubes, and the test tubes are opened timely), opening a sealing film, adding a proper amount of distilled water or sterile water (to prevent the growth of the bacteria), hardening the seedlings for about 3d until the seedlings stand upright, washing off agar, performing solution culture for 1-2 weeks, and detecting.

2.4 identification of transgenic Positive plants

Extracting total RNA of leaves of the transgenic plants, and performing reverse transcription to obtain corresponding cDNA. The RNA extraction was carried out using the RNAprep pure plant total RNA extraction kit (Code No. DP432) from Tiangen corporation, and the reverse transcription and cDNA preparation were carried out using the 1st-Strand cDNA Synthesis kit (Code No. D2639A) from TaKaRa corporation, according to the instructions thereof. Quantitative RT-PCR Using Takara

Premix Ex Taq^TM(Tli RNaseH Plus) quantification kit. The primer sequences are as follows:

qRTF：ATGATCAGTGCCAGGAGACTTG

qRTR：AAGACTGCAGTGCCGAGGTAC

the reaction system is as follows:

roche for analysis

80System Real Time PCR amplification instrument, PCR reaction conditions as follows: 10min at 95 ℃; 10s at 95 ℃,15 s at 60 ℃, 10s at 72 ℃ and 40 cycles; 5s at 95 ℃ and 1min at 65 ℃; 30s at 40 ℃.

3. Results and analysis of the experiments

3.1 cloning of genes of dwarf plants

PCR amplification is carried out according to the designed primer sequence, the product is connected to a cloning vector pENTR, the PCR detection of bacterial liquid is carried out, the electrophoresis result is shown in figure 1, the bacterial liquid is sent to Shanghai for sequencing, and the sequencing result proves that the gene of the dwarfing plant is obtained by cloning.

3.2 fluorescent quantitative PCR analysis of the expression multiple of the gene in the transgenic lines

The constructed overexpression vector containing the gene coding region of the dwarf plant is transformed into a callus induced by a wild type (NIP) mature embryo by an agrobacterium-mediated method, and 10 homozygous T2 generation transgenic overexpression strains are obtained through identification and screening. The fold expression of the gene in these lines was analyzed at the RNA level by the fluorescent quantitative PCR method (see FIG. 2), and the results showed that the fold expression of the gene was increased in the 10 transgenic lines to various degrees. Three strains are randomly selected from the strains for phenotype observation and data statistics, and FIG. 2 shows that the expression multiple of the gene in the three strains is improved by 6-10 times.

3.3 phenotypic changes of overexpression transgenic lines.

And selecting three transgenic lines subjected to identification and screening in the step 3.2 for phenotype observation and data statistics. The results are shown in Table 1 and FIG. 3.

TABLE 1 comparison of the heights of the over-expressed transgenic Rice lines with the wild type

Table 1 shows the plant height statistics of the over-expressing transgenic lines at 30-day and 55-day seedling ages, and the Ov1-3 is three different transgenic lines. The results in table 1 and fig. 3 show that: the over-expressed transgenic rice lines at 30 and 55 days of seedling age were significantly shorter than wild type.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Claims (2)

1. A method for dwarfing plants, which comprises introducing a gene having a nucleotide sequence shown in SEQ ID No.1 into rice cells to obtain dwarfed transgenic rice plants.

2. The application of the gene with the nucleotide sequence shown as SEQ ID No.1 in dwarfing plants, wherein the plants are rice.

Images