CN117070536A - Application of Arabidopsis HOS1 gene in regulating and controlling leaf senescence - Google Patents

Abstract

The application discloses Arabidopsis thalianaHOS1The application of the gene in regulating and controlling the senescence of plant leaves, the saidHOS1The nucleotide sequence of the gene is shown as SEQ ID NO. 1. The application uses agrobacterium-mediated method to transfer into arabidopsis Columbia (Col-0) to verify the function of target gene, which is beneficial to elucidation from molecular mechanismHOS1The function of the gene in the senescence process of the leaf. Research shows that Arabidopsis thalianaHOS1Mutation of the gene leads to premature leaf senescence, which, based on the current situation that premature leaf senescence leads to crop yield loss,HOS1the mechanism of gene regulation and control of leaf senescence provides theoretical basis and gene resources for delaying crop senescence and further increasing yield.

Description

Arabidopsis thalianaHOS1Application of gene in regulating and controlling leaf senescence

Technical Field

The application belongs to the field of biotechnology, and in particular relates to an arabidopsis thalianaHOS1The application of the gene in regulating and controlling leaf senescence.

Background

Senescence is an essential, active process in plant growth, morphogenesis and response to the environment, a physiological process in which the whole organ, tissue or plant gradually goes to a decline in function and ultimately leads to death. The direct manifestation of senescence of plant leaves is yellowing, as well as other changes in color. Yellowing is mainly the degradation of chlorophyll, not the synthesis of lutein. Degradation of chlorophyll leads to a sudden drop in photosynthesis, while catabolism of biological macromolecules such as proteins, lipids, nucleic acids replaces anabolism, and most of the nutrients produced from catabolism are transported to active growing tissues such as new buds, leaves and developing fruit seeds. However, in the crop production process, the premature senility of some crops reduces the carbon source for photosynthesis fixation, thereby influencing the yield and quality of the crops. Therefore, the exploration of the plant senescence mechanism can provide a theoretical basis for the future cultivation requirements of various germplasm.

HOS1(High expression of Osmotically responsive genes) is an E3 ubiquitin ligase, withICE1(Inducer of CBF expression 1) direct interaction and ubiquitination degradationICE1Negative regulation of cold signaling. And has been reported in succession in recent years,HOS1functional mechanisms of genes involved in cold signals are conserved among rice, apple, grape and other species, arabidopsis thalianaHOS1The gene is involved in the regulation of flowering time, hypocotyl elongation, plant heat resistance and other physiological processes besides cold signal regulation. However, there is no report about aging.

Disclosure of Invention

The application aims to provide an arabidopsis thalianaArabidopsis thaliana）HOS1Gene [ (B/C)At2G39810) Application in regulating and controlling leaf aging process to expandHOS1Application range of the gene.

In order to achieve the above purpose, the technical scheme of the application is as follows:

arabidopsis thalianaHOS1The nucleotide sequence of the gene is shown as SEQ ID NO. 1. The saidHOS1The CDS of the gene is 2784 bases in length and encodes a protein containing RING structure with E3 ubiquitin ligase function, which is 927 amino acids in total.

The most main purpose of the application is to disclose Arabidopsis thalianaHOS1Application of gene in regulating and controlling plant leaf senescence, and experiment provesHOS1Gene upregulation of leaf senescence, i.e.HOS1The gene can delay the senescence of plant leaves.

Wherein, the regulation and control plantsSenescence of leaves was shown to be: after dark treatment, mutantshos1-3The leaf of the mutant shows a phenomenon of earlier senescence, which is found to show lower photosynthesis efficiency than the wild type; the mutant is accelerated by hormone abscisic acid (ABA) treatmenthos1-3Yellowing of leaves, shows lower photosynthesis efficiency compared to wild type; these results demonstrate that HOS1 is involved in the process of leaf senescence mediated by ABA. Senescence marker genesSAG12，ORE1，SGR1The expression level in the mutant is significantly higher than that in the wild type, whereinSAG12Particularly, the phase difference is more than hundred times. The expression level of chloroplast-related genes is significantly suppressed in the mutant. The above results illustrateHOS1The involvement in regulating senescence in plant leaves can be accomplished by regulating expression of senescence-associated genes and chloroplast-associated genes.

Through the anaplerosis experiment, the stable over-expressed transgenic plant is obtained by adopting the arabidopsis flower-wool dip dyeing method, and the obtained transgenic plant can partially anaplerosis arabidopsishos1-3Phenotype of premature leaf senescence in mutant leaves.

The application also protects the arabidopsis thalianaHOS1Double source expression vector of genepACT2::HOS1-MYC。

Wherein, the primers used for constructing the expression vector through homologous recombination are as follows:

HOS1-MYC-F: GTGTGTGACCTCGAGACTAGTATGGATACGAGAGAAATCAAC；

HOS1-MYC-R: ATACCGTCGCACCATACTAGTTCTTGCTGCGAATCTACGTC。

the application also discloses a method for obtaining the transgenic plant, which comprises the following steps: the expression vector is used for preparing the expression vectorpACT2::HOS1-MYCTransferring into Agrobacterium tumefaciens GV3101 competence, and performing flocculation dip dyeing under the action of Agrobacterium tumefacienspACT2::HOS1-MYCIntroduction of Arabidopsis mutanthos1-3Thereby obtaining a transgenic plant capable of partially restoring Arabidopsis thalianahos1-3Phenotype of premature leaf senescence in mutant leaves.

In the present application, the plant suitable for the present application is not particularly limited as long as it is suitable for performing a gene transformation operation such as various crops, flower plants, forestry plants, or the like. The plant may be, for example (without limitation): dicotyledonous, monocotyledonous or gymnosperm plants.

As a preferred mode, the "plant" includes, but is not limited to: arabidopsis thaliana. As used herein, the term "plant" includes whole plants, parent and progeny plants thereof, and various parts of plants, including seeds, fruits, shoots, stems, leaves, roots (including tubers), flowers, tissues and organs, in which the gene or nucleic acid of interest is found. Reference herein to "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, again wherein each of the foregoing comprises the gene/nucleic acid of interest.

The present application includes any plant cell, or any plant obtained or obtainable by a method therein, as well as all plant parts and propagules thereof. The present patent also encompasses transfected cells, tissues, organs or whole plants obtained by any of the foregoing methods. The only requirement is that the sub-representations exhibit the same genotypic or phenotypic characteristics, and that the progeny obtained using the methods of this patent have the same characteristics.

The application also extends to harvestable parts of a plant as described above, but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. And further to other derivatives of the plants after harvest, such as dry granules or powders, oils, fats and fatty acids, starches or proteins. The application also relates to a food or food additive obtained from the relevant plant.

The beneficial effects of the application are as follows:

the application provides Arabidopsis thaliana through the above mattersHOS1The application of the gene in regulating and controlling plant leaf senescence; through a series of experimental means such as dark treatment, hormone treatment and the like, the arabidopsis thaliana is provedHOS1A gene is a gene capable of regulating expression of a plant senescence-associated gene and chloroplast-associated gene, thereby affecting plant senescence. The gene can be used for developing breeding of other crops by transgenic technology, effectively according toThe growth cycle of crops is controlled at will, and the yield and harvest are increased. Provides a theoretical basis for accurately modifying one gene in the future so as to realize the aim of multiple functions.

Drawings

FIG. 1 is an Arabidopsis mutanthos1-3、Leaf senescence phenotype of WT seedlings dark treated; FIG. 1A is a plot of chlorophyll content per fresh weight of samples of FIG. 1A showing senescence phenotype of Arabidopsis seedlings suspended in sterile deionized water under light and dark conditions.

FIG. 2 is an Arabidopsis mutanthos1-3、Leaf senescence of WT seedlings subjected to dark treatment, maximum photochemical rate under the same conditions and related gene expression conditions; FIG. 2A shows leaf senescence phenotype and maximum photochemical rate of Arabidopsis seedlings suspended in sterile deionized water after treatment under light and dark conditions, FIG. 2B shows the corresponding samples in FIG. 2AHOS1The relative expression levels of the genes are shown in FIG. 2C, which shows the relative expression levels of the senescence-associated genes and chloroplast-associated genes of the corresponding samples shown in FIG. 2A.

FIG. 3 is an Arabidopsis mutanthos1-3、Leaf senescence and maximum photochemical rate and related gene expression conditions of WT seedlings after being treated by plant hormone abscisic acid ABA; FIG. 3A shows leaf senescence phenotype and maximum photochemical rate after treatment of Arabidopsis seedlings with abscisic acid ABA, FIG. 3B shows the corresponding samples of FIG. 3AHOS1The relative expression levels of the genes are shown in FIG. 3C, which shows the relative expression levels of senescence-associated genes and chloroplast-associated genes corresponding to each sample in FIG. 3A.

FIG. 4 is an Arabidopsis mutanthos1-3、WT and its complement over-expression transgenic plantHOS1-MYC/hos1 #1、HOS1-MYC/hos1 #2) Expression identification of genotype, transcript level and protein level; FIG. 4A shows a T-DNA insertion mutanthos1-3The primers (LP, RP, LB 1.3) were downloaded on (http:// signal. SALK. Edu/tdnaprimers.2. Html) according to the number SALK_069312, the identification method can also be found on the site, FIG. 4B is FIG. 4A corresponding to each sampleHOS1The relative expression amounts of the genes are shown in FIG. 4C, which shows the expression of the MYC antibody in transgenic plants by Western blot hybridization.

FIG. 5 is an Arabidopsis mutanthos1-3、WT and its complement over-expression transgenic plantHOS1-MYC/hos1 #1、HOS1-MYC/hos1 #2) Senescent phenotype of 4 week old in vitro leaves; fig. 5A is a senescence phenotype of 4 week old in vitro leaf suspensions in sterile deionized water for 5 days under light and dark conditions, and fig. 5B is a bar graph of chlorophyll content per fresh weight of each sample of fig. 5A.

Detailed Description

The present application will be described in detail with reference to specific examples. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the application to those skilled in the art. The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated. The test methods in the following examples are conventional methods unless otherwise specified. The reagents and materials employed, unless otherwise indicated, are commercially available.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the present application. The preferred methods and materials described herein are presented for illustrative purposes only.

The practice of the present application will employ, unless otherwise indicated, conventional techniques of botanicals, microorganisms, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination, and bioinformatics, which will be apparent to one of skill in the art. These techniques are fully explained in the published literature, and the methods of DNA extraction, phylogenetic tree construction, gene editing method, gene editing vector construction, gene editing plant acquisition, etc. used in the present application can be realized by the methods disclosed in the prior art except the methods used in the examples described below.

The terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" as used herein are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-or double-stranded structures. Such nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. "Gene" or "gene sequence" is used broadly to refer to a functional DNA nucleic acid sequence. Thus, a gene may include introns and exons in genomic sequences, and/or coding sequences in cDNA, and/or cDNA and regulatory sequences thereof. In particular embodiments, for example in relation to isolated nucleic acid sequences, it is preferred that they are cDNA.

Before describing the specific embodiments, in order to facilitate a person skilled in the art to understand the relevant development of the present application in detail, the following brief description of background experimental conditions such as part of experimental materials and detection methods in the following embodiments is provided below:

biological material:

the Columbia type arabidopsis thaliana, commonly used experimental materials in botanic research, can be obtained from public sources; mutanthos1-3Agrobacterium GV3101 competent, dual-source expression vector pDT1, available from AraShare, was derived from the present laboratory.

Related primers were synthesized and sequenced, and were synthesized and provided by the division of biological engineering (Shanghai) Co.

EXAMPLE 1 dark treatment of Arabidopsis thalianahos1-3Leaf senescence-associated phenotype

Referring to FIG. 1, arabidopsis WT and mutanthos1-3Inoculating to 1/2 MS culture medium of 0.7% agar, culturing at 22deg.C for 7 days at light/dark cycle of 16/8 h, transferring to culture plate containing sterile water, and culturing in dark for 5 days to determine chlorophyll content. We can see that dark treatment caused aging and yellowing of WT leaves, compared to WT, mutantshos1-3Exhibiting more severe leaf yellowing (FIG. 1A), mutanthos1-3The chlorophyll content difference from WT was significantly greater than that of both under light conditions (fig. 1B). Description of the applicationHOS1The mutation of (c) makes the plant more susceptible to senescence under dark conditions.

EXAMPLE 2 dark treatment of Arabidopsis thalianahos1-3Gene expression of (2)

Referring to FIG. 2, WT and mutant were dark treated for 6 dayshos1-3Seedlings were assayed for initial fluorescence F0, maximum fluorescence yield Fm, and maximum photochemical rate (Fv/Fm) using chlorophyll fluorescence imaging system, as can be seen in FIG. 2A for mutants after dark treatmenthos1-3The fluorescence intensity of the leaf was significantly lower than that of the corresponding WT, which is said to be a post-shading mutanthos1-3Leaf photosynthesis efficiency was significantly lower than that of WT (fig. 2A). Gene expression was detected by QRT-PCR to find T-DNA insertion mutantshos1-3The expression level of (2) was significantly lower than that of WT, indicating that the mutant in fig. 2A was a knockout mutant. In WTHOS1The expression of the gene is inhibited after dark treatment, and the dark condition promotes leaf senescence under dark treatmentHOS1Inhibition of gene expression may partially explain its mutantshos1-3The phenomenon that the leaves senesced faster in the dark (fig. 2B).

In addition, expression of senescence marker gene and part of chloroplast development-related gene was examined, and senescence marker gene was foundSAG12，ORE1AndSGR1expression in mutants of (2)hos1-3In which mutants after dark treatment are significantly elevatedhos1-3In (a)SAG12The expression level of (2) was 145 times higher than that of the wild type. And the gene encoding the photosynthetic electron transfer chain componentCAB3AndPetCchloroplast ribosomal subunitPRPL13Dark treated mutantshos1-3Is inhibited (fig. 2C). The above results show that,HOS1genes are involved in regulating the leaf senescence process and can be accomplished by regulating expression of senescence marker genes and part of chloroplast-associated genes.

EXAMPLE 3 Arabidopsis thaliana under ABA treatmenthos1-3Gene expression of (2)

Referring to FIG. 3, mutants were seen after soaking seedlings with 20 uM ABA for 4 dayshos1-3Leaf yellowing occurred, initial fluorescence F0, maximum fluorescence yield Fm, and maximum photochemical rate (Fv/Fm) were measured using chlorophyll fluorescence imaging system, and ABA treated mutants can be seen in FIG. 3Ahos1-3Fluorescence intensity display of bladeSignificantly lower fluorescence intensity than the corresponding WT, indicating ABA treated mutantshos1-3Leaf photosynthesis efficiency was significantly reduced (fig. 3A). FIG. 3B shows the T-DNA insertion mutant of FIG. 3Ahos1-3The expression level of (2) was significantly lower than that of WT, indicating that the mutant in fig. 3A was a knockout mutant.

Detecting expression of senescence marker genes and chloroplast-related genes, and finding out mutants after ABA treatmenthos1-3Marker gene for medium senescenceSAG12AndSGR1the expression quantity of the mutant is 55 times and 6 times of that of the wild type corresponding gene respectivelyhos1-3Midcoding photosynthetic electron transfer chain component genesPetCAnd chloroplast ribosomal subunitsPRPL13The inhibition is carried out in comparison with the wild type,ORE1andCAB3the expression level of (a) was not significantly changed (FIG. 3C), indicating that ABA treatment significantly promoted the mutanthos1-3Marker gene for medium senescenceSAG12AndSGR1expression of (a) ABA regulatory senescence marker genesSAG12AndSGR1the process of promoting leaf senescence is receivedHOS1Inhibition of genes. WT and mutant after ABA treatmenthos1-3Senescence marker genesSAG12AndSGR1the difference in expression level of (a) was significantly smaller than that of the corresponding gene under dark conditions (a) by 55-fold and 6-fold, respectively, indicating thatHOS1In addition to the ABA signaling pathway, other signaling pathways for regulating leaf senescence are involved in the leaf senescence regulation process of genes.

EXAMPLE 4 Arabidopsis thalianahos1-3Acquisition of anaplerotic transgenic plants

Referring to FIG. 4, usingspeIRestriction endonuclease double-source expression vectorpDT1Linearization, since the primer for amplifying the gene is added at both endspDT1Carrier bodyspeIHomologous sequences on both sides, so that it is possible to carry out direct recombination by homologous recombinationHOS1Is seamlessly ligated to the PCR product of (C)pDT1On a carrierspeISites, can obtain the double-source expression vectorpACT2::HOS1-MYC. Double source expression vectorpACT2::HOS1-MYCTransforming into the competence of Agrobacterium GV3101, soaking the flower with the Agrobacterium, and thenpACT2::HOS1-MYCIntroduction into Arabidopsis mutanthos1-3To obtain stable transgenic plantpACT2::HOS1-MYC/hos1 #1、pACT2::HOS1-MYC/hos1 #2). To confirm the genotypes of the obtained transgenic plants, we extracted DNA separately, and verified by PCR, to demonstrate that the two transgenic plants were homozygous for the T-DNA insertion (fig. 4A); the results of QRT-PCR showed that in two stable transgenic plantsHOS1The expression level of (a) was significantly higher than that of the wild type (FIG. 4B); western blot hybridization experiments demonstrated stable expression of HOS1 protein in both transgenic plants (fig. 4C). These results demonstrate that transgenic plants [ ]pACT2::HOS1-MYC/hos1 #1、pACT2::HOS1-MYC/hos1 #2) Can be used as mutanthos1-3Related studies were carried out on the supplement material of (c).

EXAMPLE 5 Arabidopsis thalianahos1-3Anaplerosis of leaf senescence phenotype

HOS1Is a multifunctional gene and participates in various physiological development processes through various mechanisms. Such as a nucleoporin component involved in regulating mRNA output; as E3 ubiquitin ligase is involved in plant freezing signaling pathway; involved in the plant heat-resistant response process through DNA repair; is involved in flowering regulation of plants by chromosomal remodeling.HOS1The functions are mainly performed at the protein level and in the plant bodyHOS1Is tightly regulated. We attempted to use the 35S promoter for overexpressionHOS1But in the transgenic plants obtained in a plurality of attemptsHOS1The protein content of (2) is not significantly higher than that of WT, so we use insteadACTIN2Promoter driveHOS1Insertion mutant in T-DNAhos1-3Construction of stable transgenic Material against the background of (A) to mutanthos1-3Further studies were performed for control.

Referring to FIG. 5, 4 week old leaves were taken, placed in vitro in sterile water-containing plates and dark for 5 days, and chlorophyll content was determined, which indicated that transgenic HOS1-MYC could be used to supplement the mutanthos1-3Leaf yellowing phenotype (FIG. 4A), stable transgenic plants [ ]pACT2::HOS1-MYC/hos1 #1、pACT2::HOS1-MYC/hos1 #2) Chlorophyll content-comparable mutants of (C)hos1-3Significantly increased, but not completely complemented to wild-type levels (fig. 4B). The stable transgenic plants did not completely complement the mutant phenotypeMay be different from the promoter and transgeneHOS1Is related to fusion of MYC tags at the C-terminus. Through a feedback experiment, the powerful demonstration can be realizedHOS1The gene participates in regulating and controlling the senescence process of plant leaves.

To sum up, arabidopsis thalianaHOS1Genes can influence plant leaf senescence by regulating expression of plant senescence-associated genes, chloroplast-associated genes, in ABA-dependent and ABA-independent pathways. The gene can be used for developing breeding of other crops through transgenic technology, effectively controlling the growth cycle of the crops according to the wish, and realizing yield increase and harvest improvement.

The above-mentioned embodiments are merely preferred embodiments of the present application, which are not intended to limit the scope of the present application, and other embodiments can be easily made by those skilled in the art through substitution or modification according to the technical disclosure in the present specification, so that all changes and modifications made in the principle of the present application shall be included in the scope of the present application.

Claims (4)

1. Arabidopsis thalianaHOS1The application of the gene in regulating and controlling leaf senescence is characterized in thatHOS1The nucleotide sequence of the gene is shown as SEQ ID NO.1, and the gene is shown in the specificationHOS1The gene can delay the senescence of arabidopsis leaves.

2. The use according to claim 1, wherein said modulation of leaf senescence is manifested by: after dark treatment, mutantshos1-3The photosynthesis efficiency of the leaf of (2) is lower than that of the wild type; after ABA soaks plant seedlings, mutantshos1-3Is yellowing in leaves of (C) and mutantshos1-3The photosynthetic efficiency of the leaf is lower than that of the wild type.

3. Double-source expression vectorpACT2::HOS1-MYCApplication in regulating and controlling leaf aging，Characterized by comprising the Arabidopsis thaliana as defined in claim 1HOS1And (3) a gene.

4. The dual source expression vector of claim 3pACT2::HOS1-MYCApplication in regulating and controlling leaf aging，The method is characterized in that primers used for constructing the expression vector through homologous recombination are as follows:

HOS1-MYC-F: GTGTGTGACCTCGAGACTAGTATGGATACGAGAGAAATCAAC；

HOS1-MYC-R: ATACCGTCGCACCATACTAGTTCTTGCTGCGAATCTACGTC。