CN109234308A - A kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation - Google Patents

A kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation Download PDF

Info

Publication number
CN109234308A
CN109234308A CN201811250112.7A CN201811250112A CN109234308A CN 109234308 A CN109234308 A CN 109234308A CN 201811250112 A CN201811250112 A CN 201811250112A CN 109234308 A CN109234308 A CN 109234308A
Authority
CN
China
Prior art keywords
woaded blue
culture
regeneration plant
transformation
agrobacterium tumefaciens
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811250112.7A
Other languages
Chinese (zh)
Inventor
刁勇
黄玉香
张磊
谭何新
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huaqiao University
Original Assignee
Huaqiao University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huaqiao University filed Critical Huaqiao University
Priority to CN201811250112.7A priority Critical patent/CN109234308A/en
Publication of CN109234308A publication Critical patent/CN109234308A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205Agrobacterium mediated transformation

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The present invention provides a kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation, it the described method comprises the following steps: the woaded blue explant after preculture is immersed in the activated Agrobacterium tumefaciems bacterium solution with target gene, shaking makes to take out after coming into full contact with, aseptic paper is blotted to be inoculated in co-culture medium after extra bacterium solution and be carried out dark culture 1-4 days, explant is transferred to resistance screening induced medium and carries out illumination cultivation, experience proliferation, it takes root, the drop of strong sprout anti-screening and culturing is after 30-120 days, positive transgenic seedling is transferred to earth culture progress hardening culture through water planting transition and grows up to woaded blue regeneration plant;The woaded blue explant is woaded blue seedling leaf.The present invention directly uses the sterile miaoye of woaded blue as explant, and materials are convenient, and woaded blue regeneration plant can be turned out in compared with short cycle, and required equipment is simple, and operating technology is easily mastered.

Description

A kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation
[technical field]
The invention belongs to the field of plant genetic project technology in Plant Biotechnology, in particular to a kind of crown gall The transgenosis woaded blue regeneration plant method for transformation of mediated by agriculture bacillus.
[background technique]
The genetic transformation of plant cell is a key link of plant genetic engineering.From Abel etc. (1986) by tobacco Mosaic virus (TMV) capsid protein imports tobacco cell, after the transgenic tobacco plant for obtaining anti-TMV virus, successively development Many plant genetic transformation methods and technology.
Cruciferae isatis Isatis indigotica Fort. is China's successive dynasties conventional Chinese medicine, and root claims plate blue Root, leaf claim folium isatidis, there is the effect of clearing heat and detoxicating, cool blood relieving sore-throat, can prevent and treat viral infection, popularity encephalitis B, stream Row sexuality emits, acute, chronic hepatitis, and mumps etc. is effectively.
Agrobacterium tumefaciems Agrobacterium tumefaciens is a kind of natural bio-carrier, can pass through its T-DNA Transfer, outer source DNA molecule is integrated into recipient plant Matrix attachment region and realizes genetic transformation.Agrobacterium tumefaciens mediated base Because conversion system is a more perfect plant conversion system, there is very extensive host range, can be used for most of Shuangzis Leaf plant and some monocotyledonous conversions.
At present report relevant to woaded blue genetic conversion system have woaded blue quick breeding method for tissue culture, device outside woaded blue root Official's method for generation, agrobacterium rhizogenes mediate hairy transgenic method of woaded blue, using cotyledon and hypocotyl as the woaded blue of explant Transform insect-resistant gene method, there is not yet using blade as the report of the woaded blue regeneration plant transgenic method of explant.
It is successfully many because being known as to influence Agrobacterium tumefaciens transformation, type, position, physiological status including transformed plant; Type, cell suspending liquid density, culture medium composition and condition of culture of Agrobacterium tumefaciems etc..
Different plants will be by Agrobacterium tumefaciems induced synthesis regeneration plant, and obtains high-quality based on this Transgenic plant still will pay laborious task.
[summary of the invention]
The technical problem to be solved in the present invention is to provide a kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant Method for transformation directly uses the sterile miaoye of woaded blue as explant, and materials are convenient, and woaded blue regeneration can be turned out in compared with short cycle Plant, required equipment is simple, and operating technology is easily mastered.
The present invention is implemented as follows:
A kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation, it is characterised in that: the method packet Include following steps:
Woaded blue explant after preculture is immersed in the activated Agrobacterium tumefaciems bacterium solution with target gene, shaking Make to take out after coming into full contact with, aseptic paper is blotted to be inoculated in co-culture medium after extra bacterium solution and be carried out dark culture 1-4 days, explant Body be transferred to resistance screening induced medium carry out illumination cultivation, experience be proliferated, take root, the drop of strong sprout anti-screening and culturing 30-120 days Afterwards, positive transgenic seedling is transferred to earth culture progress hardening culture through water planting transition and grows up to woaded blue regeneration plant;
The woaded blue explant is woaded blue seedling leaf.
Further, the woaded blue explant is the 0.5-3cm that woaded blue tests for sterility is made into2Leaf dish.
Further, the target gene is the PHB-Flag label gene of shikimate kinase gene or zero load.
Further, the Agrobacterium tumefaciems bacterium solution is EHA105 or GV3101.
Further, the scheme of the preculture is MS or 1/2MS solid medium, and dark culture 1-48 hours, temperature was 24-30℃。
Further, the shaking is placed in the measure come into full contact in shaken cultivation case, and temperature is 25-37 DEG C, turns Speed is 0-200rpm.
Further, the co-culture medium is MS or 1/2MS solid medium, wherein the aminoadenine of benzyl containing 6- (6-BA) 0.1-2.0mg/L, methyl α-naphthyl acetate (NAA) 0.1-2.0mg/L, PH 5.5-6.0.
Further, the illumination cultivation condition be light intensity 1000-4000Lux, 18-30 DEG C of temperature, irradiation time 6- 24h。
Further, the resistance screening induced medium is MS or 1/2MS solid medium, wherein the amino gland of benzyl containing 6- Purine (6-BA) 0.1-2.0mg/L, methyl α-naphthyl acetate (NAA) 0.1-2.0mg/L, cefalexin (Cef) 0-500mg/L, hygromycin (Hyg) 0-20mg/L, PH 5.5-6.0.
Further, described take root, the culture medium in strong sprout step be respectively as follows: root media be MS or 1/2MS solid Culture medium, wherein containing methyl α-naphthyl acetate (NAA) 0.1-2.0mg/L, cefalexin (Cef) 0-500mg/L, hygromycin (Hyg) 0-20mg/ L, PH 5.5-6.0;Strong seedling culture base is MS or 1/2MS solid medium, wherein contain cefalexin (Cef) 0-500mg/L, tide Mycin (Hyg) 0-20mg/L, PH 5.5-6.0.
Further, the qualification program of the positive transgenic seedling is that the woaded blue of strong seedling culture in step is taken to regenerate miaoye Piece, using CTAB method extract total DNA, using gained total DNA be template identify whether the resistance containing over-express vector PHB-Flag Genetic fragment hpt and target gene fragment.
Further, the qualification program of the positive transgenic seedling is specially the woaded blue regrowth for taking strong seedling culture in step Whether blade extracts the total DNA of positive transgenic seedling leaf by CTAB method, contain using gained total DNA as template through PCR identification The resistance gene fragment hpt and target gene fragment of over-express vector PHB-Flag.
Further, the hardening condition of culture is as follows: the volume ratio of each component is Nutrition Soil: pumice: sandy soil=2:1: 1, light intensity 1000-4000Lux, 18-30 DEG C of temperature, irradiation time 6-24h.
The present invention has the advantage that
Inventive method materials are convenient, directly use the sterile miaoye of woaded blue as explant, established on this basis with blade For the method that the Agrobacterium tumefaciens mediated woaded blue of explant forms regeneration plant genetic system, used instrument is not only reduced Expense makes experimental implementation technology be easy to carry out in common lab, and to be carried out from now on using transgenic technology to woaded blue Genetic improvement provides technical support.
[Detailed description of the invention]
The present invention is further illustrated in conjunction with the embodiments with reference to the accompanying drawings.
Fig. 1 is the woaded blue aseptic seedling of the embodiment of the present invention 1.
Fig. 2 is that the woaded blue regeneration plant of the embodiment of the present invention 1 is taken root.
Fig. 3 is that the woaded blue regeneration plant PCR amplification of the embodiment of the present invention 1 identifies electrophoretogram.
Fig. 4 is the transgenosis woaded blue regeneration plant in 1 water planting of the embodiment of the present invention and earth culture.
[specific embodiment]
The present invention relates to a kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation, the method includes Following steps:
Woaded blue explant after preculture is immersed in the activated Agrobacterium tumefaciems bacterium solution with target gene, shaking Make to take out after coming into full contact with, aseptic paper is blotted to be inoculated in co-culture medium after extra bacterium solution and be carried out dark culture 1-4 days, explant Body be transferred to resistance screening induced medium carry out illumination cultivation, experience be proliferated, take root, the drop of strong sprout anti-screening and culturing 30-120 days Afterwards, positive transgenic seedling is transferred to earth culture progress hardening culture through water planting transition and grows up to woaded blue regeneration plant;
The woaded blue explant is the 0.5-3cm that woaded blue tests for sterility is made into2Leaf dish.
The target gene is the PHB-Flag label gene of shikimate kinase gene or zero load.
The Agrobacterium tumefaciems bacterium solution is EHA105 or GV3101.
The scheme of the preculture is MS or 1/2MS solid medium, and dark culture 1-48 hours, temperature was 24-30 DEG C.
The shaking is placed in the measure come into full contact in shaken cultivation case, and temperature is 25-37 DEG C, revolving speed 0- 200rpm。
The co-culture medium is MS or 1/2MS solid medium, wherein the aminoadenine of benzyl containing 6- (6-BA) 0.1- 2.0mg/L, methyl α-naphthyl acetate (NAA) 0.1-2.0mg/L, PH 5.5-6.0.
The illumination cultivation condition be light intensity 1000-4000Lux, 18-30 DEG C of temperature, irradiation time 6-24h.
The resistance screening induced medium is MS or 1/2MS solid medium, wherein the aminoadenine of benzyl containing 6- (6- BA) 0.1-2.0mg/L, methyl α-naphthyl acetate (NAA) 0.1-2.0mg/L, cefalexin (Cef) 0-500mg/L, hygromycin (Hyg) 0- 20mg/L, PH 5.5-6.0.
It is described take root, the culture medium in strong sprout step be respectively as follows: root media be MS or 1/2MS solid medium, In contain methyl α-naphthyl acetate (NAA) 0.1-2.0mg/L, cefalexin (Cef) 0-500mg/L, hygromycin (Hyg) 0-20mg/L, PH 5.5- 6.0;Strong seedling culture base is MS or 1/2MS solid medium, wherein containing cefalexin (Cef) 0-500mg/L, hygromycin (Hyg) 0-20mg/L, PH 5.5-6.0.
The qualification program of the positive transgenic seedling is specially that the woaded blue of strong seedling culture in step is taken to regenerate seedling leaf, is passed through CTAB method extracts the total DNA of positive transgenic seedling leaf, whether contains overexpression load through PCR identification using gained total DNA as template The resistance gene fragment hpt and target gene fragment of body PHB-Flag.
The hardening condition of culture is as follows: the volume ratio of each component is Nutrition Soil: pumice: sandy soil=2:1:1, light intensity 1000-4000Lux, 18-30 DEG C of temperature, irradiation time 6-24h.
1/2MS the and MS culture medium that the present invention selects is the common culture medium of plant cell engineering, is widely used in plant Object tissue cultures, work well.Plant culture used in the present invention is specifically added to different plants according to different culture periods The hygromycin of object hormone ratio, the antibiotic of various concentration and various concentration screening.
The full name of CTAB method of the present invention is cetyl trimethyl smelling hinge method, which can extract plant gene Group belongs to general molecular biology routine operation.
PCR of the present invention is " polymerase chain reaction ", is well known to those skilled in the art experimental method, according to PCR primer and PCR reaction condition, those skilled in the art can amplify purpose base according to common sense and empirically determined reaction system Cause.
Below in conjunction with specific embodiment, the present invention is further illustrated.
Embodiment 1:
(1) the recombination PHB-Flag plasmid for carrying target gene is extracted
By the Escherichia coli Trans1-T1 containing recombinant plasmid after bacterial examination, sequence verification, it is inoculated into the liquid of kanamycins In body culture medium (reagent preparation is purchased from Sheng Gong biotech firm), it is incubated overnight under conditions of 37 DEG C, 200rpm;It is mentioned with plasmid is small Kit (being purchased from Quan Shijin biotechnology company) extracts recombinant plasmid.This method belongs to general molecular biology routine operation.
(2) prepare the woaded blue explant that genetic transformation uses
Diploid Seeds of Isatis indigotica picks up from pharmaceutical college of The 2nd Army Medical College botanical garden, is carried out disinfection place using routine disinfection method Reason, sterilisation step are as follows: flowing water rinses 4h, and 75% alcohol embathes 1min, and aseptic water washing 3 times, 0.1% mercuric chloride vibrates 8min is washed, aseptic water washing 5 times or more, is inoculated on MS culture medium, in 25 DEG C of illumination (2000Lux) 16h, 18 DEG C of dark situations Grow up to aseptic seedling in the temperature-controlling chamber of 8h, as shown in Figure 1, wherein a is Seeds of Isatis indigotica sprouting, b is woaded blue aseptic seedling.
It from the leaf dish of clip 0.5-3cm2 size in woaded blue aseptic seedling, is inoculated on precultivation medium, turns as heredity The receptor of change;
The culture medium and leaf dish precultivation medium of woaded blue aseptic seedling are equal are as follows: and MS solid medium+30g/L glucose+ 7.5g agar, PH 5.6-5.8;
(3) acquisition of the Agrobacterium tumefaciems engineering bacteria containing the PHB-Flag recombinant plasmid for carrying target gene SK.
By the recombinant plasmid of extraction by freeze-thaw method import EHA105 Agrobacterium tumefaciems in, then through antibiotic resistance screening and The identification of PCR bacterial examination, obtains the Agrobacterium tumefaciems containing recombinant plasmid.
(4) genetic transformation of woaded blue blade explant
With rifampin containing 100mg/L (Rif, Agrobacterium tumefaciems resistance) and 75mg/L kanamycins, (Kan, PHB-Flag are carried Body resistance) YEB culture medium activation culture to OD600 be 0.6 ± 0.1 Agrobacterium tumefaciems engineering bacteria, at room temperature 5000rpm from Heart 10min, aseptic condition go down supernatant, with isometric fresh 1/2MS fluid nutrient medium resuspension containing acetosyringone (As) Thallus.28 DEG C, after 100rpm oscillation incubation 30min, the good leaf dish of preculture is disseminated in bacterium solution in superclean bench 10min, during which constantly jiggling keeps its dip dyeing abundant.Explant is taken out, residual bacterium solution is absorbed with aseptic filter paper, is inoculated in altogether Culture medium, 25 DEG C dark culture 2 days.
The explant of co-cultivation is transferred to except the progress degerming culture under 25 DEG C of illumination conditions on bacterium culture medium.
Co-culture medium are as follows: MS solid medium+30g/L glucose+1.0mg/L 6-BA+0.1mg/LNAA, PH 5.6-5.8;
Except bacterium culture medium are as follows: MS solid medium+30g/L glucose+1.0mg/L 6-BA+0.1mg/L NAA+500mg/ L Cef, PH 5.6-5.8;
(5) screening and culturing transgenic regenerated plant
Leaf dish is transferred on the anti-screening and culturing medium of drop, and illumination cultivation is to Multiple Buds are grown at 25 DEG C, replacement culture every 2 weeks Base is once until the withered and yellow no power of regeneration of leaf dish is stopped.If bacterium phenomenon of overflowing occurs in leaf dish, has depending on Multiple Buds upgrowth situation and do not exist together Reason, can carefully remove free of contamination Multiple Buds and be put into the anti-screening and culturing medium of new drop, otherwise can lose when Multiple Buds are up to 0.5cm It abandons;
It is gently removed when the long seedling to 1-2cm high of the Multiple Buds that are grown in leaf dish and is transferred to proliferation screening and culturing medium On, the illumination cultivation at 25 DEG C;
Regrowth after Multiplying culture it is long to 3cm or so when, move it into screening and culturing medium of taking root and continue to cultivate, the phase Between, in case of bacterium of overflowing, then the culture medium of the antibiotic containing high concentration is moved into after cleaning out the long bacterium position of regrowth again, closely Observe its condition of rooting;
Gained regrowth root long is then transferred into strong sprout screening and culturing medium one to 1cm or so and continues to cultivate, removing After all plant hormones, regrowth can normally take root (fibrous root) as shown in Fig. 2, wherein a be take root incubation time grow it is thick Root, b are the fibrous root that grows of woaded blue strong seedling culture period, when its root long is to about 2cm, then transfer them to strong sprout screening and culturing medium It is cultivated in two.
Anti- screening and culturing medium drops are as follows: MS solid medium+30g/L glucose+1.0mg/L 6-BA+0.1mg/L NAA+ 300mg/L Cef+10mg/L Hyg, PH 5.6-5.8;
It is proliferated screening and culturing medium are as follows: MS solid medium+30g/L glucose+1.0mg/L 6-BA+0.3mg/L NAA+ 300mg/L Cef+15mg/L Hyg, PH 5.6-5.8;
It takes root screening and culturing medium are as follows: MS+30g/L glucose+0.5mg/L NAA+100mg/L Cef+15mg/L Hyg, PH 5.6-5.8;
Strong sprout screening and culturing medium one are as follows: MS+30g/L glucose+Cef 100mg/L+15mg/L Hyg, PH 5.6-5.8;
Strong sprout screening and culturing medium two are as follows: MS+30g/L glucose+15mg/L Hyg, PH 5.6-5.8;
(6) PCR amplification identifies regeneration plant
It takes the woaded blue in strong seedling culture to regenerate seedling leaf 1, total DNA is extracted using CTAB method, using gained total DNA as template Identification whether resistance gene fragment hpt and target gene fragment containing over-express vector PHB-Flag.
Hpt fragment amplification primer are as follows:
Hpt-F:CGATTTGTGTACGCCCGACAGTC,
Hpt-R:CGATGTAGGAGGGCGTGGATATG;
Target gene fragment amplimer are as follows:
PhbSK-F:aaaGGATCCatggaggccagggtttctca;
Rbcs-R:attaacttcggtcattagaggc.
The nucleotide of the target gene SK (biological name in its source is Escherichia coli (Escherichia coli)) Sequence as shown in SEQ ID NO.1, the nucleotide sequence of the hpt fragment amplification primer hpt-F as shown in SEQ ID NO.2, The nucleotide sequence of the hpt fragment amplification primer hpt-R as shown in SEQ ID NO.3, draw by the target gene fragment amplification The nucleotide sequence of object phbSK-F is as shown in SEQ ID NO.4;The nucleotide of the target gene fragment amplimer Rbcs-R Sequence is as shown in SEQ ID NO.5, and said gene sequence is referring in particular to attachment nucleotides sequence list.
PCR reaction system is (20 μ L): Template DNA 1 μ L, Forward Primer (10 μM) 1 μ L, 1 μ L, 2rTaq PCR SuperMix of Reverse Primer (10 μM), 10 7 μ L of μ L, ddH2O.
PCR reaction condition are as follows: 94 DEG C of 5min, 30 circulations (94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 60s), 72 DEG C of 7min.
PCR product is through agarose gel electrophoresis and ultraviolet detection.The amplified band size of hpt is 812bp, target gene SK Show for 1385bp, such as Fig. 3, each swimming lane is expressed as follows in Fig. 3: M:DL-2000DNA molecule Marker, N:EHA105 empty bacterium are negative Control, the number of each positive regeneration plant of number swimming lane expression, the BcSK-OVX-1, BcSK-OVX-2 identified as shown in Figure 3, It is to have PHB-flag resistance base in BcSK-OVX-5, BcSK-OVX-6, BcSK-OVX-8, BcSK-OVX-9, BcSK-OVX-14 Because of the electrophoretic band of hpt and target fragment rbcsr, the rbcsr detected in the regeneration plant of target gene is transferred to due to inserting The segment of 400-500bp, so the more corresponding fragment lengths of purpose band, illustrate that these regeneration plants are transgenic positive Plant.
(7) the hardening culture of woaded blue regrowth
When at the top of woaded blue regrowth length to culture bottle, well-grown woaded blue regrowth is taken out from culture tank, root is used Tap water is rinsed well, and appropriate tap water (amount is limited to submerge root) is added in former culture tank, and woaded blue regrowth is put into culture Bottle, mouth cover preservative film (preservative film pricks hole with toothpick and is conducive to breathe freely), the illumination cultivation at 25 DEG C;
After culture about 1 week, the regrowth of (having new fibrous root to grow) in good condition is transplanted in hardening culture medium, in 25 DEG C, humidity 65% is cultivated under the conditions of light intensity 2000Lux, as shown in figure 3, wherein a is the transgenosis woaded blue regeneration in water planting Plant, b are the transgenosis woaded blue regeneration plant in earth culture.
Hardening culture medium are as follows: Nutrition Soil: pumice: sandy soil=2:1:1.
Inventive method directly uses the sterile miaoye of woaded blue as explant, obtains Agrobacterium tumefaciens mediated transgenosis woaded blue again Raw plant, materials are convenient, not only reduce the expense of used instrument, make experimental implementation technology be easy common lab into Row, and technical support is provided to carry out genetic improvement to woaded blue using transgenic technology from now on.
Although specific embodiments of the present invention have been described above, those familiar with the art should be managed Solution, we are merely exemplary described specific embodiment, rather than for the restriction to the scope of the present invention, it is familiar with this The technical staff in field should be covered of the invention according to modification and variation equivalent made by spirit of the invention In scope of the claimed protection.
Sequence table
<110>Huaqiao University
<120>a kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation
<130> 100
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 885
<212> DNA
<213>(Escherichia coli)
<400> 1
ttatccttgc ttcttcaaga aatgttcaat ttgtacaacc acctcaatac caatttcagt 60
tggcgttaga tcacagggat cttcatatcc aagtttcatc acaatatctt caagagaaac 120
tctcacttca gcgttggcgt acgcaccacc cctctcttca aaaaggtcag ttaacaactt 180
catggtcttt gaataaggat caccagaatc atgatgcaac aaaggccgag aattggttcc 240
gactgccgta agcctgtgtg ccaatgcttc caagggtaca tctagccaaa cagttatacc 300
atttcccatg tgtctccaat tgattggtcg aaccacagca ccaccacccg tggatacaat 360
caattgatgc cttgaagaca acttgtgcaa aacctcagtc tcattatctc tgaagaaatt 420
ttcgccatgt agtttgaaga tttcggcaac agtgtatcca ccagctgcct cctctattag 480
tgcatcacag tcacaaaatg aatatccaag ggccttggcc acaatcttgc ccactgttgt 540
ttttccagat cccatcattc caacaagata tatgcatcgt ccattcaggt atggtagaat 600
ctcttctgat ttattcttca tgatctttga ctcatcacct aatgctggaa aactgccaca 660
ctgcattaac gaagctgaat tgttttcaga agtacatgag acctctaaag caagaggttc 720
atgaaatctt ccctttttgc tgagccgttg gcaattcagt tttcgataca actgttgctc 780
cactttgttt cgcccaatgg gcaagtaacc gctgggtttt cttacaaatt ttcccagatc 840
catccatgtt gatagctgca atccttgaga aaccctggcc tccat 885
<210> 2
<211> 23
<212> DNA
<213>(artificial sequence)
<400> 2
cgatttgtgt acgcccgaca gtc 23
<210> 3
<211> 23
<212> DNA
<213>(artificial sequence)
<400> 3
cgatgtagga gggcgtggat atg 23
<210> 4
<211> 29
<212> DNA
<213>(artificial sequence)
<400> 4
aaaggatcca tggaggccag ggtttctca 29
<210> 5
<211> 22
<212> DNA
<213>(artificial sequence)
<400> 5
attaacttcg gtcattagag gc 22

Claims (13)

1. a kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation, it is characterised in that: the method includes Following steps:
Woaded blue explant after preculture is immersed in the activated Agrobacterium tumefaciems bacterium solution with target gene, shaking makes to fill Tap is taken out after touch, and aseptic paper is blotted to be inoculated in co-culture medium after extra bacterium solution and be carried out dark culture 1-4 days, explant turn Entering resistance screening induced medium and carries out illumination cultivation, experience is proliferated, takes root, the drop of strong sprout anti-screening and culturing is after 30-120 days, Positive transgenic seedling is transferred to earth culture progress hardening culture through water planting transition and grows up to woaded blue regeneration plant;
The woaded blue explant is woaded blue seedling leaf.
2. the Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation of one kind according to claim 1, special Sign is: the woaded blue explant is the 0.5-3cm that woaded blue tests for sterility is made into2Leaf dish.
3. the Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation of one kind according to claim 1, special Sign is: the target gene is the PHB-Flag label gene of shikimate kinase gene or zero load.
4. the Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation of one kind according to claim 1, special Sign is: the Agrobacterium tumefaciems bacterium solution is EHA105 or GV3101.
5. the Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation of one kind according to claim 1, special Sign is: the scheme of the preculture is MS or 1/2MS solid medium, and dark culture 1-48 hours, temperature was 24-30 DEG C.
6. the Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation of one kind according to claim 1, special Sign is: the shaking is placed in the measure come into full contact in shaken cultivation case, and temperature is 25-37 DEG C, revolving speed 0- 200rpm。
7. the Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation of one kind according to claim 1, special Sign is: the co-culture medium is MS or 1/2MS solid medium, wherein the aminoadenine of benzyl containing 6- (6-BA) 0.1- 2.0mg/L, methyl α-naphthyl acetate (NAA) 0.1-2.0mg/L, PH 5.5-6.0.
8. the Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation of one kind according to claim 1, special Sign is: the illumination cultivation condition be light intensity 1000-4000Lux, 18-30 DEG C of temperature, irradiation time 6-24h.
9. the Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation of one kind according to claim 1, special Sign is: the resistance screening induced medium is MS or 1/2MS solid medium, wherein the aminoadenine of benzyl containing 6- (6-BA) 0.1-2.0mg/L, methyl α-naphthyl acetate (NAA) 0.1-2.0mg/L, cefalexin (Cef) 0-500mg/L, hygromycin (Hyg) 0-20mg/ L, PH 5.5-6.0.
10. the Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation of one kind according to claim 1, special Sign is: it is described take root, the culture medium in strong sprout step be respectively as follows: root media be MS or 1/2MS solid medium, wherein Containing methyl α-naphthyl acetate (NAA) 0.1-2.0mg/L, cefalexin (Cef) 0-500mg/L, hygromycin (Hyg) 0-20mg/L, PH 5.5- 6.0;Strong seedling culture base is MS or 1/2MS solid medium, wherein containing cefalexin (Cef) 0-500mg/L, hygromycin (Hyg) 0-20mg/L, PH 5.5-6.0.
11. the Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation of one kind according to claim 1, special Sign is: the qualification program of the positive transgenic seedling is that the woaded blue of strong seedling culture in step is taken to regenerate seedling leaf, using CTAB Method extract total DNA, using gained total DNA be template identify whether the resistance gene fragment hpt containing over-express vector PHB-Flag And target gene fragment.
12. the Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation of one kind according to claim 11, Be characterized in that: the qualification program of the positive transgenic seedling is specially that the woaded blue of strong seedling culture in step is taken to regenerate seedling leaf, is led to The total DNA that CTAB method extracts positive transgenic seedling leaf is crossed, whether contains overexpression through PCR identification using gained total DNA as template The resistance gene fragment hpt and target gene fragment of carrier PHB-Flag.
13. the Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation of one kind according to claim 1, special Sign is: the hardening condition of culture is as follows: the volume ratio of each component is Nutrition Soil: pumice: sandy soil=2:1:1, light intensity 1000- 4000Lux, 18-30 DEG C of temperature, irradiation time 6-24h.
CN201811250112.7A 2018-10-25 2018-10-25 A kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation Pending CN109234308A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811250112.7A CN109234308A (en) 2018-10-25 2018-10-25 A kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811250112.7A CN109234308A (en) 2018-10-25 2018-10-25 A kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation

Publications (1)

Publication Number Publication Date
CN109234308A true CN109234308A (en) 2019-01-18

Family

ID=65082067

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811250112.7A Pending CN109234308A (en) 2018-10-25 2018-10-25 A kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation

Country Status (1)

Country Link
CN (1) CN109234308A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109971744A (en) * 2019-02-22 2019-07-05 中国人民解放军第二军医大学 Albumen and the application of a kind of acanthaceous indigo BcTSA gene and its coding

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2324399A1 (en) * 1998-03-19 1999-09-23 Sunstar Inc. A food composition and use thereof for lowering human cholesterol levels
CN101280319A (en) * 2008-03-27 2008-10-08 成都大学 Agrobacterium-mediated transgenic method for woad
CN108103093A (en) * 2017-12-15 2018-06-01 华南农业大学 A kind of genetic transforming method of Agrobacterium tumefaciens mediated eleusine indica

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2324399A1 (en) * 1998-03-19 1999-09-23 Sunstar Inc. A food composition and use thereof for lowering human cholesterol levels
CN101280319A (en) * 2008-03-27 2008-10-08 成都大学 Agrobacterium-mediated transgenic method for woad
CN108103093A (en) * 2017-12-15 2018-06-01 华南农业大学 A kind of genetic transforming method of Agrobacterium tumefaciens mediated eleusine indica

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
曾建军等: "菘蓝离体培养过程中愈伤组织和再生芽发生的细胞组织学观察 ", 《西南师范大学学报(自然科学版)》 *
苗永美等: "菘蓝两种外植体愈伤组织诱导研究 ", 《生物技术通报》 *
黄玉香: "马蓝药效物质形成关键基因的挖掘与功能研究", 《中国博士学位论文全文数据库 农业科技辑》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109971744A (en) * 2019-02-22 2019-07-05 中国人民解放军第二军医大学 Albumen and the application of a kind of acanthaceous indigo BcTSA gene and its coding
CN109971744B (en) * 2019-02-22 2022-03-11 中国人民解放军第二军医大学 Malan blue BcTSA gene and encoded protein and application thereof

Similar Documents

Publication Publication Date Title
CN101457235B (en) Method for converting lucerne by vacuum penetrating aided agrobacterium-mediation
CN108374012A (en) Rubber tree powdery mildew endogenesis promoter WY51 and application thereof
CN103966258A (en) Agrobacterium tumefaciens mediated cabbage type oilseed rape genetic transformation method
CN107974454A (en) Rubber tree powdery mildew endogenesis promoter WY193 and application thereof
CN107974455A (en) Rubber tree powdery mildew endogenesis promoter WY7 and application thereof
CN104561089B (en) A kind of breeding method of Transgenic melon tissue-cultured seedling and application
CN107760681A (en) Promoter WY195 and application thereof
CN105132457B (en) A kind of method of fast genetic transformation clover
CN104004783A (en) Method for improving cotton transgenosis efficiency
CN107475287B (en) Eggplant genetic transformation method
CN104087611B (en) A kind of agriculture bacillus mediated Jatropha curcas genetic transforming method
CN106636099B (en) A kind of citrusfruit specificity promoter and application
CN109234308A (en) A kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation
CN102174565A (en) Method for fast genetic transformation of rice
CN1149918C (en) Method for transferring agrobacterium mediated plant germination seed gene
CN102559748B (en) Simple and convenient agrobacterium tumefaciens-mediated sugarcane transgene method
CN110358791A (en) Mung bean genetic transforming method
CN105255938A (en) Agrobacterium rhizogenes mediated genetically modified Erigeron breviscapus hairy root transformation method
CN109984041A (en) It is a kind of using blade as the azalea transgenic method of explant
CN102533809B (en) Jujube glutathione peroxidase gene
CN113234750B (en) Method for quickly obtaining transgenic plant taking isatis tinctoria transgenic root as explant
CN103215307B (en) Genetic transformation method of agrobacterium-induced plum blossom mature cotyledon regeneration system
CN104593410A (en) Agrobacterium rhizogenes mediated strawberry gene transferring method
CN108728481A (en) A kind of method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation
CN114703198A (en) Cloning and application of tomato transport protein SlZIF1

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20190118