CN108728481A - A kind of method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation - Google Patents
A kind of method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation Download PDFInfo
- Publication number
- CN108728481A CN108728481A CN201810400964.3A CN201810400964A CN108728481A CN 108728481 A CN108728481 A CN 108728481A CN 201810400964 A CN201810400964 A CN 201810400964A CN 108728481 A CN108728481 A CN 108728481A
- Authority
- CN
- China
- Prior art keywords
- henan
- china
- rhiizoma dioscoreae
- culture
- 1mgl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Abstract
The invention discloses a kind of methods of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation, belong to field of plant genetic.Technical scheme of the present invention main points are:Using RHIIZOMA DIOSCOREAE from Henan of China minitype stem tuber as transformation receptor, it is infected by Agrobacterium, target gene is imported into RHIIZOMA DIOSCOREAE from Henan of China receptor, it is transferred to after co-cultivation in selective solid differential medium and induces resistant buds, it is transferred to root induction in selective root media again, it is final to obtain RHIIZOMA DIOSCOREAE from Henan of China transformed plant, transformed plant is identified by the method for GUS histochemical stains and PCR, it is final to obtain RHIIZOMA DIOSCOREAE from Henan of China transfer-gen plant.The conversion process of the present invention is easy to operate and the period is short, transformation efficiency 2.5%.
Description
Technical field
The invention belongs to field of plant genetic, and in particular to a kind of method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation.
Background technology
RHIIZOMA DIOSCOREAE from Henan of China(Dioscorea oppositaThunb.)It is Dioscoreaceae Dioscorea herbaceous perennial vine plant, is
Famous one of the four-Huai medicine in China.RHIIZOMA DIOSCOREAE from Henan of China underground stem tuber medicine food is simultaneous excellent, but since it is asexually propagated crop, virosis
Accumulation, which causes serious quality deterioration and yield, reduces [1].Utilize conventional breeding methods Crop Improvement kind period length, difficulty
Greatly.Therefore, RHIIZOMA DIOSCOREAE from Henan of China breed improvement is carried out using genetic transformation means to be of great significance.
There are one section of T-DNA, Agrobacterium that T-DNA is transferred to plant in infecting plant process on the Ti-plasmids of Agrobacterium tumefaciems
Object cell is simultaneously integrated into genome.Agrobacterium-mediated transformation will be connected to the target gene transfer in the areas T-DNA simultaneously using this principle
It is integrated into Plant Genome.Under natural conditions, Agrobacterium can infect the injury of dicotyledon, therefore agriculture bacillus mediated
Method is applied in dicotyledonous Study on Genetic Transformation [2] at first.Hereafter, which is applied in monocotyledon by researcher, initially
Research think that monocotyledon has immunization [3] to Agrobacterium.Until 1984, Hernalsteens J P etc. were successfully used
Agrobacterium infects the callus [4] of monocotyledon asparagus.Subsequent Agrobacterium-mediated genetic transformation is in a variety of unifacial leaves
It succeeds in plant, such as rice [5].
Currently, genetic conversion system has been established in a variety of Dioscoreaceae plants using agrobacterium-mediated transformation, such as shield leaf potato
Chinese yam [6], circle Chinese yam [7], yampi [8], Dioscorea Panthcica [9], salvia chinensis potato [10] etc..But up to the present there are no lost about RHIIZOMA DIOSCOREAE from Henan of China
Pass the relevant report of method for transformation.
The research Chinese herbal medicines of [1] Li Mingjun, Zhang Feng, Chen Mingxia, Yu Xiangli (2003) RHIIZOMA DIOSCOREAE from Henan of China virosis, 34
(11):Attached 3-5.
[2] Zambryski P, Joos H, Genetello C, et al. Ti plasmid vector for
the introduction of DNA into plant cells without alteration of their normal
regeneration capacity.[J]. Embo Journal, 1982, 2(12):2143-2150。
[3] Rao S S, Lippincott B B, Lippincott J A. Agrobacterium adherence
involves the pectic portion of the host cell wall and is sensitive to the
degree of pectin methylation[J]. Physiologia Plantarum, 1982, 56(3):374-380。
[4] Hernalsteens J P, Thiatoong L, Schell J, et al. An Agrobacterium-
transformed cell culture from the monocot Asparagus officinalis.[J]. Embo
Journal, 1984, 3(13):3039。
[5] Hiei Y, Ohta S, Komari T, et al. Efficient transformation of rice
(Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the
boundaries of the T-DNA.[J]. Plant Journal for Cell & Molecular Biology,
1994, 6(2):271-282。
[6] Liu J, Liu X, Qin Y, et al. Genetic transformation mediated by Ri
T-DNA and the accumulation of diosgenin of Dioscrea zigiberensis [J]. Natural
Product Research & Development, 2005, 17(1):59-64。
[7] Nyaboga E, Tripathi J N, Manoharan R, et al. Agrobacterium-
mediated genetic transformation of yam (Dioscorea rotundata): an important
tool for functional study of genes and crop improvement[J]. Frontiers in
Plant Science, 2014, 5:463。
[8] seas research [D] of the aflp analysis of Xu Yun yampis genetic diversity and protocorms genetic conversion system
Southern university, 2014.
[9] genetic transformation [J] plant physiology journals of Gu Yuehua, Li Yan Chinese medicinal plant Dioscorea Panthcica root of hair genes,
2005, 41(6):755-757。
[Primary Study [D] the University Of Hainan of the foundation and genetic transformation of 10] Xia Yun salvia chinensis potato regenerating systems,
2012。
Invention content
The RHIIZOMA DIOSCOREAE from Henan of China heredity easy to operate and shorter the period the technical problem to be solved by the present invention is to provide a kind of conversion process
Its object is to probe into transgenic technology with CaMV 35S promoters and RHIIZOMA DIOSCOREAE from Henan of China somatic embryo phase occurs for the method for conversion
Close Receptor-like protein ki-nase geneDoSERK2Build over-express vector pCAMBIA1301-SERK(Lee's book outstanding person's RHIIZOMA DIOSCOREAE from Henan of China is miniature
Transcript profile sequencing analysis and differential gene expression screening [D] He'nan Normal University during stem tuber induced synthesis, 2017.)With
Interference fragment with CaMV 35S promoters and NOS terminator is cut from intermediate carrier pHANNIBAL and is inserted into plant
On object binary expression vector pART27, silent carrier pART27- is builtSERK(Han Lin woods RHIIZOMA DIOSCOREAE from Henan of China somatic embryos occur withDoSERK2Genetic transformation [D] the He'nan Normal University of gene, 2017.), using this two kinds of recombinant plasmids as conversion carrier, build
Found a kind of genetic transforming method of RHIIZOMA DIOSCOREAE from Henan of China.
The present invention is using RHIIZOMA DIOSCOREAE from Henan of China minitype stem tuber as the receptor of transgenosis, and the circulation-induced technology of the minitype stem tuber is via this
The main inventive Ren Liming armies of application proposed an a kind of application for a patent for invention " circulation-induced Huai Shan on January 17th, 2013
The method of medicine minitype stem tuber "(Number of patent application is:201310016587.0), a large amount of RHIIZOMA DIOSCOREAE from Henan of China may be implemented using this invention
The rapid induction of minitype stem tuber lays the foundation to explore and establishing RHIIZOMA DIOSCOREAE from Henan of China minitype stem tuber genetic conversion system.
The present invention adopts the following technical scheme that solve above-mentioned technical problem, a kind of method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation,
It is characterized in that detailed process is:
A. it is converted and is regenerated using RHIIZOMA DIOSCOREAE from Henan of China minitype stem tuber as explant;
B. the explant is transferred to co-culture in culture medium with Agrobacterium and is co-cultured, the overexpression of target gene will be carried
Carrier pCAMBIA1301-SERKAnd silent carrier pART27-SERKIt is directed respectively into RHIIZOMA DIOSCOREAE from Henan of China receptor;
C. the RHIIZOMA DIOSCOREAE from Henan of China receptor is directly transferred to selective solid differential medium, induction of resistance bud respectively;
D. the resistant buds are transferred to selective solid root media respectively, and root induction obtains RHIIZOMA DIOSCOREAE from Henan of China transformed plant;
E. differentiate by GUS, PCR method and be overexpressed transformed plant, differentiate silence transformed plant by PCR method, it is final to obtain
Transgenosis RHIIZOMA DIOSCOREAE from Henan of China plant.
Further preferably, the explant is the thin slice that RHIIZOMA DIOSCOREAE from Henan of China minitype stem tuber is cut into 1-2mm.
Further preferably, the co-cultivation culture medium prescription is:MS minimal mediums+1mgL-16- benzylaminopurines
+1mg·L-1+ 100 μm of olL of heteroauxin-1Acetosyringone+30gL-1Sucrose+6gL-1Condense fat, pH=6.0;Training altogether
Foster condition is:3d is cultivated in dark place under the conditions of 28 DEG C.
Further preferably, the selective solid differential medium formula is:MS minimal mediums+1mgL-16- benzyls
+ 1 mgL of adenine phosphate-1Heteroauxin+500mgL-1Ticarcillin/Clavulanate Acid+30gL-1Sucrose+6gL-1Condense fat+15mgL-1
Hygromycin/120mgL-1Kanamycins, pH=6.0;Condition of culture is:It is placed in intensity of illumination 2000-3000lx, photoperiod 16h/
D, it is cultivated at 28 DEG C of temperature until resistant buds grow to 1-2cm.
Further preferably, the selective prescription of rooting medium is:MS minimal mediums+2mgL-1Paclobutrazol+
0.05mg·L-1Methyl α-naphthyl acetate+500mgL-1Ticarcillin/Clavulanate Acid+30gL-1Sucrose+6gL-1Condense fat+20mgL-1Hygromycin/
160mg·L-1Kanamycins, pH=6.0.
The method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation of the present invention, it is characterised in that the specific steps are:It will contain to be overexpressed and carry
Body pCAMBIA1301-SERKAgrobacterium EHA105 be inoculated in addition 50mgL-1Rifampin and 50mgL-1Kanamycins
It crosses on LB solid mediums, 28 DEG C of culture 30h, picking single bacterium is fallen in the LB liquid medium containing corresponding antibiotic,
180rmp shake cultures are stayed overnight, and the Agrobacterium being incubated overnight is according to volume ratio 1:100 ratio is transferred to fresh LB liquid training
It supports in base, after cultivating 10h, UV spectrophotometer measuring bacterial concentration OD is used per 1h600, select OD600For 0.5 bacterium solution,
8000rmp, 4 DEG C of centrifugation 10min, collect bacterial sediment, and with MS fluid nutrient medium suspension thallines, centrifugation is primary again, then with containing
100μm·L-1Thalline is resuspended in the MS fluid nutrient mediums of acetosyringone, makes bacterium solution OD again600It is 0.5, the bacterium solution weight after resuspension
It is new to be put into shaking table, 28 DEG C, 180rmp cultures 30min;Aseptically, by RHIIZOMA DIOSCOREAE from Henan of China improved seeds iron rod yam minitype stem tuber
It is cut into the thin slice of 1-2mm, 30min is submerged in processed Agrobacterium bacterium solution, is during which rocked once per 3min, makes explant
It is adequately contacted with bacterium solution, after taking-up, absorbs explant surface bacterium solution with aseptic filter paper, be transferred to and co-culture in culture medium,
The co-cultivation culture medium prescription is:MS minimal mediums+1mgL-1 6- benzylaminopurines+1mgL-1+ 100 μ of heteroauxin
mol·L-1Acetosyringone+30gL-1Sucrose+6gL-1Fat, pH=6.0 are condensed, 3d is cultivated in 28 DEG C of dark places;Transfer later into
In selective solid differential medium, the selection solid differential medium formula is:MS minimal mediums+1mgL-1 6- benzyls
Base adenine phosphate+1mgL-1Heteroauxin+500mgL-1Ticarcillin/Clavulanate Acid+15mgL-1Hygromycin+30gL-1Sucrose+6gL-1Fat is condensed, pH=6.0 are placed at intensity of illumination 2000-3000 lx, photoperiod 16h/d, 28 DEG C of temperature and cultivate, and are replaced per 10d
Fresh culture;When growing to 1-2cm to resistant buds, cuts and transfer on selectable root media, the selection
Prescription of rooting medium is:MS minimal mediums+2mgL-1Paclobutrazol+0.05mgL-1Methyl α-naphthyl acetate+500mgL-1Ticarcillin/Clavulanate Acid
+20mg·L-1Hygromycin+30gL-1Sucrose+6gL-1Fat, pH=6.0 are condensed, final obtain is overexpressed transfer-gen plant.
The method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation of the present invention, it is characterised in that the specific steps are:Silent carrier will be contained
pART27-SERKAgrobacterium EHA105 be inoculated in addition 50mgL-1Rifampin and 50mgL-1The LB solids of spectinomycin
It crosses on culture medium, 28 DEG C of culture 30h, picking single bacterium is fallen in the LB liquid medium containing corresponding antibiotic, 180rmp concussions
Overnight incubation, the Agrobacterium being incubated overnight is according to volume ratio 1:100 ratio is transferred in fresh LB liquid medium, culture
After 10h, UV spectrophotometer measuring bacterial concentration OD is used per 1h600, select OD600For 0.5 bacterium solution, 8000rmp, 4 DEG C
10min is centrifuged, bacterial sediment is collected, with MS fluid nutrient medium suspension thallines, centrifugation is primary again, then with containing 100 μm of L-1Second
Thalline is resuspended in the MS fluid nutrient mediums of acyl syringone, makes bacterium solution OD again600It is 0.5, the bacterium solution after resuspension is reentered into shaking table,
28 DEG C, 180rmp cultures 30min;Aseptically, RHIIZOMA DIOSCOREAE from Henan of China improved seeds iron rod yam minitype stem tuber is cut into 1-2mm's
Thin slice submerges 30min in processed Agrobacterium bacterium solution, is during which rocked once per 3min, keeps explant abundant with bacterium solution
Contact, absorb explant surface bacterium solution with aseptic filter paper after taking-up, be transferred to and co-culture in culture medium, the co-cultivation culture
The formula of base is:MS minimal mediums+1mgL-1 6- benzylaminopurines+1mgL-1+ 100 μm of olL of heteroauxin-1Second
Acyl syringone+30gL-1Sucrose+6gL-1Fat, pH=6.0 are condensed, 3d is cultivated in 28 DEG C of dark places;Switching selectable solid later
In differential medium, the formula of the selection solid differential medium is:MS minimal mediums+1mgL-1 6- benzylaminos are fast
Purine+1mgL-1Heteroauxin+500mgL-1Ticarcillin/Clavulanate Acid+120mgL-1Kanamycins+30gL-1Sucrose+6gL-1Condensation
Fat, pH=6.0 are placed at intensity of illumination 2000-3000lx, photoperiod 16h/d, 28 DEG C of temperature and cultivate, and are replaced per 10d primary new
Fresh culture medium;It when growing to 1-2cm to resistant buds, cuts and transfers on selectable root media, the selection is taken root training
Support base formula be:MS minimal mediums+2mgL-1Paclobutrazol+0.05mgL-1Methyl α-naphthyl acetate+500mgL-1Ticarcillin/Clavulanate Acid+
160mg·L-1Kanamycins+30gL-1Sucrose+6gL-1Fat is condensed, pH=6.0 are final to obtain silencing transgene plant.
The conversion process of the present invention is easy to operate and the period is shorter, transformation efficiency 2.5%.
Description of the drawings
Fig. 1 is RHIIZOMA DIOSCOREAE from Henan of China minitype stem tuber genetic transformation flow chart agriculture bacillus mediated in the method for the present invention;
Fig. 2 is the conversion process that transgenosis RHIIZOMA DIOSCOREAE from Henan of China minitype stem tuber is overexpressed in the present invention, A:Agrobacterium infect after RHIIZOMA DIOSCOREAE from Henan of China
Minitype stem tuber thin slice, B:Co-culture the thin slice after 3d, C:The thin slice of 40d, D are cultivated on selective regenerated solids culture medium:Selection
Property regenerated solids culture medium on cultivate 70d thin slice, E:Resistance regeneration bud is transferred to selective root media, F:Selectivity is taken root
30d regrowths are grown on culture medium;
Fig. 3 is the conversion process of silencing transgene RHIIZOMA DIOSCOREAE from Henan of China minitype stem tuber in the present invention, A:RHIIZOMA DIOSCOREAE from Henan of China after Agrobacterium is infected is micro-
Type stem tuber thin slice, B:Co-culture the thin slice after 3d, C:The thin slice of 40d, D are cultivated on selective regenerated solids culture medium:Selectivity
The thin slice of 70d, E are cultivated on regenerated solids culture medium:Resistance regeneration bud is transferred to selective root media, F:Selectivity is taken root training
It supports and grows 30d regrowths on base;
Fig. 4 is overexpression transfer-gen plant in the present inventionGUSHistochemical stain detects, A:Nontransgenic plants cauline leaf, B:
It is overexpressed transfer-gen plant cauline leaf;
Fig. 5 is the PCR detections that RHIIZOMA DIOSCOREAE from Henan of China is overexpressed transfer-gen plant in the present invention, M:5000Maker, 1:Unconverted plant, 2:
Transfer-gen plant ,+:Recombinant plasmid pCAMBIA1301-SERK;
Fig. 6 is the PCR detections of RHIIZOMA DIOSCOREAE from Henan of China silencing transgene plant in the present invention, M:2000 Maker, 1:Unconverted plant, 2-7:
Transfer-gen plant ,+:Recombinant plasmid pART27-SERK。
Specific implementation mode
The above of the present invention is described in further details by the following examples, but this should not be interpreted as to this
The range for inventing above-mentioned theme is only limitted to embodiment below, and all technologies realized based on the above of the present invention belong to this hair
Bright range.
Embodiment 1
Over-express vector pCAMBIA1301- will be containedSERKAgrobacterium EHA105 be inoculated in addition 50mgL-1Rifampin and
50mg·L-1It crosses on the LB solid mediums of kanamycins, 28 DEG C of culture 30h, picking single bacterium falls within the liquid containing corresponding antibiotic
In body LB culture mediums, 180rmp shake cultures are stayed overnight, and the Agrobacterium being incubated overnight is according to volume ratio 1:100 ratio is transferred to newly
In fresh LB liquid medium, after cultivating 10h, UV spectrophotometer measuring bacterial concentration OD is used per 1h600, select OD600
For 0.5 bacterium solution, 8000rmp, 4 DEG C of centrifugation 10min collect bacterial sediment and are centrifuged again with MS fluid nutrient medium suspension thallines
Once, then with containing 100 μm of L-1Thalline is resuspended in the MS fluid nutrient mediums of acetosyringone, makes bacterium solution OD again600It is 0.5, is resuspended
Bacterium solution afterwards is reentered into shaking table, 28 DEG C, 180rmp cultures 30min;Aseptically, by RHIIZOMA DIOSCOREAE from Henan of China improved seeds iron rod mountain
Medicine minitype stem tuber is cut into the thin slice of 1-2mm, and 30min is submerged in processed Agrobacterium bacterium solution, during which rocks one per 3min
It is secondary, so that explant is adequately contacted with bacterium solution, after taking-up, absorbs explant surface bacterium solution with aseptic filter paper, be transferred to total training
It supports in culture medium, which is:MS minimal mediums+1mgL-1 6- benzylaminopurines+1mgL-1Yin
+ 100 μm of olL of indolylbutyric acid-1Acetosyringone+30gL-1Sucrose+6gL-1Fat, pH=6.0 are condensed, 3d is cultivated in 28 DEG C of dark places;
It transfers later in selectable solid differential medium, the selection solid differential medium formula is:MS minimal mediums+
1mg·L-1 6- benzylaminopurines+1mgL-1Heteroauxin+500mgL-1Ticarcillin/Clavulanate Acid+15mgL-1Hygromycin+30g
L-1Sucrose+6gL-1Fat is condensed, pH=6.0 are placed at intensity of illumination 2000-3000 lx, photoperiod 16h/d, 28 DEG C of temperature and train
It supports, a fresh culture is replaced per 10d;When growing to 1-2cm to resistant buds, cut and selectable root media of transferring
On, the selection prescription of rooting medium is:MS minimal mediums+2mgL-1Paclobutrazol+0.05mgL-1Methyl α-naphthyl acetate+
500mg·L-1Ticarcillin/Clavulanate Acid+20mgL-1Hygromycin+30gL-1Sucrose+6gL-1Fat is condensed, pH=6.0 finally obtained table
Up to transfer-gen plant.
Embodiment 2
Silent carrier pART27- will be containedSERKAgrobacterium EHA105 be inoculated in addition 50mgL-1Rifampin and 50mgL-1It crosses on the LB solid mediums of spectinomycin, 28 DEG C of culture 30h, picking single bacterium falls within the liquid LB trainings containing corresponding antibiotic
It supports in base, 180rmp shake cultures are stayed overnight, and the Agrobacterium being incubated overnight is according to volume ratio 1:100 ratio is transferred to fresh LB
In fluid nutrient medium, after cultivating 10h, UV spectrophotometer measuring bacterial concentration OD is used per 1h600, select OD600It is 0.5
Bacterium solution, 8000rmp, 4 DEG C of centrifugation 10min, collects bacterial sediment, and with MS fluid nutrient medium suspension thallines, centrifugation is primary again, then
With containing 100 μm of L-1Thalline is resuspended in the MS fluid nutrient mediums of acetosyringone, makes bacterium solution OD again600It is 0.5, the bacterium after resuspension
Liquid is reentered into shaking table, 28 DEG C, 180rmp cultures 30min;Aseptically, RHIIZOMA DIOSCOREAE from Henan of China improved seeds iron rod yam is miniature
Stem tuber is cut into the thin slice of 1-2mm, and 30min is submerged in processed Agrobacterium bacterium solution, is during which rocked once per 3min, makes outer
Implant is adequately contacted with bacterium solution, is absorbed explant surface bacterium solution with aseptic filter paper after taking-up, is transferred to co-cultivation culture medium
In, the formula of the co-cultivation culture medium is:MS minimal mediums+1mgL-1 6- benzylaminopurines+1mgL-1Heteroauxin
+100μmol·L-1Acetosyringone+30gL-1Sucrose+6gL-1Fat, pH=6.0 are condensed, 3d is cultivated in 28 DEG C of dark places;Turn later
In the selective solid differential medium of access, the formula of the selection solid differential medium is:MS minimal mediums+1mg
L-1 6- benzylaminopurines+1mgL-1Heteroauxin+500mgL-1Ticarcillin/Clavulanate Acid+120mgL-1Kanamycins+30gL-1
Sucrose+6gL-1Fat is condensed, pH=6.0 are placed at intensity of illumination 2000-3000lx, photoperiod 16h/d, 28 DEG C of temperature and cultivate,
A fresh culture is replaced per 10d;When growing to 1-2cm to resistant buds, cuts and transfers on selectable root media,
The formula of the selection root media is:MS minimal mediums+2mgL-1Paclobutrazol+0.05mgL-1Methyl α-naphthyl acetate+
500mg·L-1Ticarcillin/Clavulanate Acid+160mgL-1Kanamycins+30gL-1Sucrose+6gL-1Fat is condensed, pH=6.0 are finally sunk
Silent transfer-gen plant.
It is overexpressed transfer-gen plantGUSHistochemical stain detects:It is said with reference to Solarbio company GUS dyeing liquid products
Bright book is operated.The cauline leaf that the RHIIZOMA DIOSCOREAE from Henan of China minitype stem tuber without any processing is overexpressed transfer-gen plant is chosen, and is chosen not
RHIIZOMA DIOSCOREAE from Henan of China plant cauline leaf through any processing is negative control, immerses the material into strong dye type GUS dyeing liquors, is protected from light 37 DEG C and kept the temperature
Night after the ethyl alcohol for being 30%, 50%, 70% with volume fraction gradually sloughs chlorophyll, observes color, hasGUSThe material of gene expression
Blue is presented.
It is overexpressed the PCR detections of transfer-gen plant:It is century bio tech ltd's plant genes group with reference to health
DNA extraction kit NuClean Plant Genomic DNA Kit specifications extract RHIIZOMA DIOSCOREAE from Henan of China plant genomic DNA.With weight
Group plasmid pCAMBIA1301-SERKFor positive control, unconverted plant genomic DNA is negative control, used express transgenic plant
Genomic DNA be template, with detection primer sequence:F, 5 '-ATGACGGCTTGGGTTTTC-3 ';R, 5 '-
TCACCTCGGACCAGATAGC-3 ' carries out PCR amplification.Pcr amplification reaction condition is:94 DEG C of pre-degeneration 5min;94 DEG C of denaturation
30s, 52 DEG C of annealing 30s, 72 DEG C of extension 90s, 35 recycle;72 DEG C of extension 10min.It is expected that amplified fragments are 1896bp.
The PCR of silencing transgene plant is detected:It it is century bio tech ltd's plant genes group DNA with reference to health
Extracts kit NuClean Plant Genomic DNA Kit specifications extract RHIIZOMA DIOSCOREAE from Henan of China plant genomic DNA.To recombinate matter
Grain pART27-SERKFor positive control, unconverted plant genomic DNA is negative control, with the genome of silencing transgene plant
DNA is template, with detection primer sequence:F, 5 '-CAGATGATACAGAAAAGCACCG-3 ';R, 5 '-
TAACTTTCGGTAGAGCGGAC-3 ' carries out PCR amplification.Pcr amplification reaction condition is:94 DEG C of pre-degeneration 5min;94 DEG C of denaturation
30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s, 35 recycle;72 DEG C of extension 10min.It is expected that amplified fragments are 658bp.
Embodiment above describes the basic principles and main features and advantage of the present invention, and the technical staff of the industry should
Understand, the present invention is not limited to the above embodiments, and the above embodiments and description only describe the originals of the present invention
Reason, under the range for not departing from the principle of the invention, various changes and improvements may be made to the invention, these changes and improvements are each fallen within
In the scope of protection of the invention.
EQUENCE LISTING
<110>He'nan Normal University
<120>A kind of method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation
<130> 2018
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
<213>Artificial sequence(Artificial sequence)
<400> 1
atgacggcttgggttttc 18
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence(Artificial sequence)
<400> 2
tcacctcggaccagatagc 19
<210> 3
<211> 22
<212> DNA
<213>Artificial sequence(Artificial sequence)
<400> 3
cagatgatacagaaaagcaccg 22
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence(Artificial sequence)
<400> 4
taactttcggtagagcggac 20
Sequence table
<110>He'nan Normal University
<120>A kind of method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation
<141> 2018-04-28
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
atgacggctt gggttttc 18
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
tcacctcgga ccagatagc 19
<210> 3
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
cagatgatac agaaaagcac cg 22
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
taactttcgg tagagcggac 20
Claims (7)
1. a kind of method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation, it is characterised in that detailed process is:
A. it is converted and is regenerated using RHIIZOMA DIOSCOREAE from Henan of China minitype stem tuber as explant;
B. the explant is transferred to co-culture in culture medium with Agrobacterium and is co-cultured, the overexpression of target gene will be carried
Carrier pCAMBIA1301-SERKAnd silent carrier pART27-SERKIt is directed respectively into RHIIZOMA DIOSCOREAE from Henan of China receptor;
C. the RHIIZOMA DIOSCOREAE from Henan of China receptor is directly transferred to selective solid differential medium, induction of resistance bud respectively;
D. the resistant buds are transferred to selective solid root media respectively, and root induction obtains RHIIZOMA DIOSCOREAE from Henan of China transformed plant;
E. differentiate by GUS, PCR method and be overexpressed transformed plant, differentiate silence transformed plant by PCR method, it is final to obtain
Transgenosis RHIIZOMA DIOSCOREAE from Henan of China plant.
2. the method for RHIIZOMA DIOSCOREAE from Henan of China genetic transformation according to claim 1, it is characterised in that the explant is by RHIIZOMA DIOSCOREAE from Henan of China
Minitype stem tuber is cut into the thin slice of 1-2mm.
3. the method for RHIIZOMA DIOSCOREAE from Henan of China genetic transformation according to claim 1, it is characterised in that the co-cultivation culture medium prescription
For:MS minimal mediums+1mgL-16- benzylaminopurines+1mgL-1+ 100 μm of olL of heteroauxin-1Acetosyringone
+30g·L-1Sucrose+6gL-1Condense fat, pH=6.0;Co-cultivation condition is:3d is cultivated in dark place under the conditions of 28 DEG C.
4. the method for RHIIZOMA DIOSCOREAE from Henan of China genetic transformation according to claim 1, it is characterised in that the selectivity solid differentiation training
Foster based formulas is:MS minimal mediums+1mgL-1+ 1 mgL of 6- benzylaminopurines-1Heteroauxin+500mgL-1It is special
Mei Ting+30gL-1Sucrose+6gL-1Condense fat+15mgL-1Hygromycin/120mgL-1Kanamycins, pH=6.0;Cultivate item
Part is:Culture at intensity of illumination 2000-3000lx, photoperiod 16h/d, 28 DEG C of temperature is placed in until resistant buds grow to 1-2cm.
5. the method for RHIIZOMA DIOSCOREAE from Henan of China genetic transformation according to claim 1, it is characterised in that the selectivity root media
Formula is:MS minimal mediums+2mgL-1Paclobutrazol+0.05mgL-1Methyl α-naphthyl acetate+500mgL-1Ticarcillin/Clavulanate Acid+30gL-1Sugarcane
Sugar+6gL-1Condense fat+20mgL-1Hygromycin/160mgL-1Kanamycins, pH=6.0.
6. the method for RHIIZOMA DIOSCOREAE from Henan of China genetic transformation according to claim 1, it is characterised in that the specific steps are:Table will be contained
Up to carrier pCAMBIA1301-SERKAgrobacterium EHA105 be inoculated in addition 50mgL-1Rifampin and 50mgL-1It is mould to block that
It crosses on the LB solid mediums of element, 28 DEG C of culture 30h, picking single bacterium is fallen in the LB liquid medium containing corresponding antibiotic,
180rmp shake cultures are stayed overnight, and the Agrobacterium being incubated overnight is according to volume ratio 1:100 ratio is transferred to fresh LB liquid training
It supports in base, after cultivating 10h, UV spectrophotometer measuring bacterial concentration OD is used per 1h600, select OD600For 0.5 bacterium solution,
8000rmp, 4 DEG C of centrifugation 10min, collect bacterial sediment, and with MS fluid nutrient medium suspension thallines, centrifugation is primary again, then with containing
100μm·L-1Thalline is resuspended in the MS fluid nutrient mediums of acetosyringone, makes bacterium solution OD again600It is 0.5, the bacterium solution weight after resuspension
It is new to be put into shaking table, 28 DEG C, 180rmp cultures 30min;Aseptically, by RHIIZOMA DIOSCOREAE from Henan of China improved seeds iron rod yam minitype stem tuber
It is cut into the thin slice of 1-2mm, 30min is submerged in processed Agrobacterium bacterium solution, is during which rocked once per 3min, makes explant
It is adequately contacted with bacterium solution, after taking-up, absorbs explant surface bacterium solution with aseptic filter paper, be transferred to and co-culture in culture medium,
The co-cultivation culture medium prescription is:MS minimal mediums+1mgL-1 6- benzylaminopurines+1mgL-1+ 100 μ of heteroauxin
mol·L-1Acetosyringone+30gL-1Sucrose+6gL-1Fat, pH=6.0 are condensed, 3d is cultivated in 28 DEG C of dark places;Transfer later into
In selective solid differential medium, the selection solid differential medium formula is:MS minimal mediums+1mgL-1 6- benzyls
Base adenine phosphate+1mgL-1Heteroauxin+500mgL-1Ticarcillin/Clavulanate Acid+15mgL-1Hygromycin+30gL-1Sucrose+6gL-1Fat is condensed, pH=6.0 are placed at intensity of illumination 2000-3000 lx, photoperiod 16h/d, 28 DEG C of temperature and cultivate, and are replaced per 10d
Fresh culture;When growing to 1-2cm to resistant buds, cuts and transfer on selectable root media, the selection
Prescription of rooting medium is:MS minimal mediums+2mgL-1Paclobutrazol+0.05mgL-1Methyl α-naphthyl acetate+500mgL-1Ticarcillin/Clavulanate Acid
+20mg·L-1Hygromycin+30gL-1Sucrose+6gL-1Fat, pH=6.0 are condensed, final obtain is overexpressed transfer-gen plant.
7. the method for RHIIZOMA DIOSCOREAE from Henan of China genetic transformation according to claim 1, it is characterised in that the specific steps are:Silence will be contained
Carrier pART27-SERKAgrobacterium EHA105 be inoculated in addition 50mgL-1Rifampin and 50mgL-1The LB of spectinomycin
It crosses on solid medium, 28 DEG C of culture 30h, picking single bacterium is fallen in the LB liquid medium containing corresponding antibiotic, 180rmp
Shake culture is stayed overnight, and the Agrobacterium being incubated overnight is according to volume ratio 1:100 ratio is transferred in fresh LB liquid medium,
After cultivating 10h, UV spectrophotometer measuring bacterial concentration OD is used per 1h600, select OD600For 0.5 bacterium solution, 8000rmp,
4 DEG C of centrifugation 10min, collect bacterial sediment, and with MS fluid nutrient medium suspension thallines, centrifugation is primary again, then with containing 100 μm of L-1
Thalline is resuspended in the MS fluid nutrient mediums of acetosyringone, makes bacterium solution OD again600It is 0.5, the bacterium solution after resuspension, which is reentered into, shakes
Bed, 28 DEG C, 180rmp cultures 30min;Aseptically, RHIIZOMA DIOSCOREAE from Henan of China improved seeds iron rod yam minitype stem tuber is cut into 1-
The thin slice of 2mm submerges 30min in processed Agrobacterium bacterium solution, is during which rocked once per 3min, makes explant and bacterium solution
Adequately contact absorbs explant surface bacterium solution with aseptic filter paper after taking-up, is transferred to and co-cultures in culture medium, the co-cultivation
The formula of culture medium is:MS minimal mediums+1mgL-1 6- benzylaminopurines+1mgL-1+ 100 μm of ol of heteroauxin
L-1Acetosyringone+30gL-1Sucrose+6gL-1Fat, pH=6.0 are condensed, 3d is cultivated in 28 DEG C of dark places;It transfers later selectable
In solid differential medium, the formula of the selection solid differential medium is:MS minimal mediums+1mgL-1 6- benzyl ammonia
Base purine+1mgL-1Heteroauxin+500mgL-1Ticarcillin/Clavulanate Acid+120mgL-1Kanamycins+30gL-1Sucrose+6gL-1
Fat is condensed, pH=6.0 are placed at intensity of illumination 2000-3000lx, photoperiod 16h/d, 28 DEG C of temperature and cultivate, and one is replaced per 10d
Secondary fresh culture;When growing to 1-2cm to resistant buds, cuts and transfer on selectable root media, the selection life
The formula of root culture medium is:MS minimal mediums+2mgL-1Paclobutrazol+0.05mgL-1Methyl α-naphthyl acetate+500mgL-1Ticarcillin/Clavulanate Acid
+160mg·L-1Kanamycins+30gL-1Sucrose+6gL-1Fat is condensed, pH=6.0 are final to obtain silencing transgene plant.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810400964.3A CN108728481A (en) | 2018-04-28 | 2018-04-28 | A kind of method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810400964.3A CN108728481A (en) | 2018-04-28 | 2018-04-28 | A kind of method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation |
Publications (1)
Publication Number | Publication Date |
---|---|
CN108728481A true CN108728481A (en) | 2018-11-02 |
Family
ID=63939491
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810400964.3A Pending CN108728481A (en) | 2018-04-28 | 2018-04-28 | A kind of method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108728481A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112575010A (en) * | 2020-12-14 | 2021-03-30 | 云南农业大学 | Reference gene for fluorescence quantification of different tissues of Chinese yam as well as primer and application thereof |
CN116064575A (en) * | 2022-08-23 | 2023-05-05 | 河南师范大学 | Chrysanthemum transcription factor CmbHLH18 and application thereof in resisting chrysanthemum black spot |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101792774A (en) * | 2010-04-12 | 2010-08-04 | 浙江师范大学 | Agrobacterium tumefaciens-mediated dioscorea zingiberensis transgene method |
WO2011046177A1 (en) * | 2009-10-14 | 2011-04-21 | クミアイ化学工業株式会社 | Signal peptide contained in mannose specific lectine precursor, nucleic acid to code for said signal peptide, and use thereof |
CN102127566A (en) * | 2010-12-17 | 2011-07-20 | 湖南农业大学 | Genetic transformation method for artemisia annua |
CN103039364A (en) * | 2013-01-17 | 2013-04-17 | 河南师范大学 | Method for circularly inducing micro tubers of rhizoma dioscoreae |
CN103070075A (en) * | 2013-02-04 | 2013-05-01 | 河南师范大学 | Method for directly inducing miniature tubers from Chinese yam segments |
-
2018
- 2018-04-28 CN CN201810400964.3A patent/CN108728481A/en active Pending
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2011046177A1 (en) * | 2009-10-14 | 2011-04-21 | クミアイ化学工業株式会社 | Signal peptide contained in mannose specific lectine precursor, nucleic acid to code for said signal peptide, and use thereof |
CN101792774A (en) * | 2010-04-12 | 2010-08-04 | 浙江师范大学 | Agrobacterium tumefaciens-mediated dioscorea zingiberensis transgene method |
CN102127566A (en) * | 2010-12-17 | 2011-07-20 | 湖南农业大学 | Genetic transformation method for artemisia annua |
CN103039364A (en) * | 2013-01-17 | 2013-04-17 | 河南师范大学 | Method for circularly inducing micro tubers of rhizoma dioscoreae |
CN103070075A (en) * | 2013-02-04 | 2013-05-01 | 河南师范大学 | Method for directly inducing miniature tubers from Chinese yam segments |
Non-Patent Citations (4)
Title |
---|
李俊华等: "铁棍山药微型块茎遗传转化体系的建立", 《植物学报》 * |
韩林林: "怀山药体细胞胚胎发生与DoSERK2基因的遗传转化", 《中国学位论文全文数据库》 * |
韩林林等: "农杆菌介导的怀山药叶片瞬时表达方法的建立", 《河南师范大学学报(自然科学版)》 * |
顾月华等: "中药植物黄山药发根基因的遗传转化", 《植物生理学通讯》 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112575010A (en) * | 2020-12-14 | 2021-03-30 | 云南农业大学 | Reference gene for fluorescence quantification of different tissues of Chinese yam as well as primer and application thereof |
CN116064575A (en) * | 2022-08-23 | 2023-05-05 | 河南师范大学 | Chrysanthemum transcription factor CmbHLH18 and application thereof in resisting chrysanthemum black spot |
CN116064575B (en) * | 2022-08-23 | 2023-08-22 | 河南师范大学 | Chrysanthemum transcription factor CmbHLH18 and application thereof in resisting chrysanthemum black spot |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101528934B (en) | Methods for producing transgenic plants | |
CN107974455B (en) | Rubber powdery mildew endogenous promoter WY7 and application thereof | |
CN102485897A (en) | Method for changing petal colors by using cotton gene GbF3H | |
CN107164374A (en) | A kind of artificial synthesized promoter SP2 of plant drought-inducible and application | |
CN110699379B (en) | Agrobacterium-mediated genetic transformation method for inducing callus by taking sorghum mature embryo as explant | |
CN115637269A (en) | Polycistron spacer region element and application thereof in plant breeding | |
CN108728481A (en) | A kind of method of RHIIZOMA DIOSCOREAE from Henan of China genetic transformation | |
CN106148400A (en) | A kind of Agrobacterium tumefaciens mediated tomato conversion method | |
CN105039391A (en) | Method of establishing genetic transformation of mature embryos of agrobacterium tumefaciens mediated Dongnong winter wheat No.1 | |
CN105255938A (en) | Agrobacterium rhizogenes mediated genetically modified Erigeron breviscapus hairy root transformation method | |
Pérez et al. | Banana (Musa sp.) | |
CN106755063B (en) | Agrobacterium-mediated salt-tolerant peppermint stem segment transformation system | |
CN110106171A (en) | Long-chain non-coding RNA and its application in regulation plant frigostabile | |
CN100381574C (en) | Gentic transforming method of perennial rye grass | |
CN105886527A (en) | Agrobacterium tumefaciens mediated transformation system for efficiently obtaining transgenic plants of paspalum vaginatum and application thereof | |
CN107034231B (en) | Gene transformation method of Chinese chestnut | |
CA2784550A1 (en) | Method of transforming cells | |
CN102206662B (en) | miR399 fusion gene, construction method thereof and application thereof in plant breeding | |
CN101831429B (en) | Promoter and expression mode identification of rice endosperm specific expression gene | |
Arencibia et al. | Sugarcane (Saccharum spp.) | |
CN110699377A (en) | Peanut transgenic method | |
CN115216489B (en) | Genetic transformation method of broadleaf Lepidium meyenii and application thereof | |
CN117187294B (en) | Application of BnaC5.ACBP4 gene in improving flooding resistance of plants | |
CN108034666A (en) | Sea-buckthorn GPD1 genes | |
CN110106172A (en) | A kind of long-chain non-coding RNA and its application in regulation plant frigostabile |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181102 |
|
RJ01 | Rejection of invention patent application after publication |