CN115216489B

CN115216489B - Genetic transformation method of broadleaf Lepidium meyenii and application thereof

Info

Publication number: CN115216489B
Application number: CN202210712001.3A
Authority: CN
Inventors: 赵淑举; 蒋苏; 柴振光; 李师鹏; 曹子谊; 李爽; 赵丽萍
Original assignee: Qilu Normal University
Current assignee: Qilu Normal University
Priority date: 2022-06-22
Filing date: 2022-06-22
Publication date: 2023-06-13
Anticipated expiration: 2042-06-22
Also published as: CN115216489A

Abstract

The invention provides a genetic transformation method of broadleaf Lepidium meyenii, comprising the following steps: step one, immersing a broadleaf Lespedeza sativa transformation acceptor into an agrobacterium infection solution, and carrying out concussion infection; step two, taking out the infected transformation receptor, absorbing the water on the surface of the tissue, transferring the tissue to a co-culture medium, and performing dark co-culture; and thirdly, inoculating the transformation receptor into a regeneration culture medium for culture. The genetic transformation test is carried out by infecting the calli of the broadleaf Lepidium meyenii and the roots, stems and leaves of seedlings through agrobacterium for the first time, and a novel method is provided for genetic transformation of the broadleaf Lepidium meyenii and research and development of novel varieties of the broadleaf Lepidium meyenii. The application establishes an in-vitro genetic transformation system of the broad-leaf Lepidium meyenii, provides technical support for improving the oil quantity and quality of the broad-leaf Lepidium meyenii through genetic modification of the broad-leaf Lepidium meyenii, and promotes the development and utilization of the broad-leaf Lepidium meyenii as a novel oil crop.

Description

Genetic transformation method of broadleaf Lepidium meyenii and application thereof

Technical Field

The application relates to the field of plant genetic engineering, in particular to a genetic transformation method of broadleaf Lepidium meyenii and application thereof.

Background

With the reduction of fossil petroleum reserves and climate change, the demand for environmentally friendly and renewable vegetable oils in food and industry is becoming more and more urgent. In the case of existing oil crops with limited yield increasing potential, it is becoming more interesting to retrofit existing oil crops and to develop new, high-yielding, multi-functional oil crops.

The broad-leaf Lepidium meyenii Walp is a novel oil crop and has high yield potential. The plant has good cold resistance, can be planted in areas where rapeseeds cannot be planted in winter, and can be planted in a wider area than common oil crops. The broad-leaf unicode is a biennial herbaceous plant, so that the cultivation cost can be reduced, and the broad-leaf unicode is also a good intercropping crop. The prior wide leaf common cole has more application fields, and the seed oil contains some special components, such as high-content erucic acid, which is an important industrial raw material; moreover, the Lepidium fordii is also a common animal feeding plant in coastal saline-alkali soil; in addition, the Lepidium fordii itself has certain medicinal value and health care function.

However, the oil content of the wide leaf Lepidium meyenii serving as a wild oil plant is low and is only about 20% (the oil content of the rapeseeds is 45%). In addition, the seed oil component of the broadleaf cole needs to be further improved in order to meet the special requirements of different industries.

At present, research on the Lepidium at home and abroad mainly focuses on the development and utilization of application value of the Lepidium, and research reports on genetic transformation of Lepidium, especially Lepidium broadleaf, are less. Although genetic transformation of Lepidium fordii is mentioned in the prior art, the method adopted by the method is a flower dip method, and the flower dip method is only used in the transformation process of Arabidopsis thaliana to be more mature so far, other cruciferous plants such as rape, cabbage and the like are tried to be used, but the using method is not mature, and the transformation efficiency is poor. (ref. Cao Yu. Stress tolerance study and genetic transformation of Lepidium fordii [ D ]. University of Shandong, 2010.).

Therefore, there is a need to establish an efficient and feasible in vitro regeneration genetic transformation system for Lepidium fordii.

Disclosure of Invention

The invention aims to provide an efficient and feasible isolated regeneration genetic transformation system for the Lepidium sativum, which lays a good foundation for improving the oil quantity and quality of the Lepidium sativum through genetic modification in the future and promotes the development and utilization of novel oil crops.

In one aspect, the present application provides a genetic transformation method for broadleaf Lepidium meyenii, comprising the steps of:

step one, immersing a broadleaf Lespedeza sativa transformation acceptor into an agrobacterium infection solution, and carrying out concussion infection;

step two, taking out the infected transformation receptor in the step one, transferring the transformation receptor into a co-culture medium, and performing dark co-culture;

and thirdly, inoculating the transformation receptor into a regeneration culture medium for culture.

Further, the broadleaf Lepidium meyenii transformation receptor comprises broadleaf Lepidium meyenii tissue and/or callus obtained by induction of the broadleaf Lepidium meyenii tissue as an explant, and the broadleaf Lepidium meyenii tissue comprises root tissue, stem tissue and/or leaf tissue of the broadleaf Lepidium meyenii;

preferably, the tissue of the Lepidium fordii is the tissue of a seedling growing for 5-10 days, more preferably 7 days;

preferably, the callus is obtained by inducing root tissue of Lepidium fordii as explant.

Further, the agrobacterium is agrobacterium tumefaciens or agrobacterium rhizogenes; preferably, the agrobacterium is agrobacterium tumefaciens; more preferably, the agrobacterium tumefaciens is selected from one or more of EHA105, EHA101, LBA4404, GV3101, AGL 1; more preferably, the agrobacterium tumefaciens is EHA105.

Further, the agrobacterium contains an expression vector; preferably, the expression vector is selected from one or more of pCAMBIA3301, pCAMBIA1300, pCAMBIA1301 and pCAMBIA 3300; more preferably, the expression vector is pCAMBIA3301.

Preferably, the expression vector contains a screening marker gene; more preferably, the selectable marker gene comprises an antibiotic marker gene and/or a fluorescent marker gene; more preferably, the screening marker gene is a fluorescent marker gene, and the fluorescent marker gene can be selected from one or more of GFP, YFP, CFP, BFP.

The fluorescent marker in the application has the functions of assisting an experimenter in rapidly screening and determining plants or calli successfully transferred into the expression vector, and the fluorescent marker screening is carried out before the calli are subjected to dark culture, so that the screening efficiency of the transformed plants can be effectively improved. Among them, a person skilled in the art can obtain a known fluorescent marker gene by purchase or synthesis, and design and synthesize its corresponding primer based on the fluorescent marker gene. The fluorescent marker gene may be one or more selected from GFP, YFP, CFP, BFP, as long as the effect of screening by fluorescent markers can be achieved, and is not particularly limited herein.

In a preferred embodiment, the positive engineering bacteria of Agrobacterium EHA105 transformed with pCAMBIA3301-GFP plasmid are selected as laboratory agrobacteria.

Further, in the third step, the culture temperature is 22-25 ℃, the ratio of the light to dark time per day is 16:8,

when the wide leaf Lepidium meyenii transformation receptor is a wide leaf Lepidium meyenii tissue, the culture time is 8-16 weeks; preferably, 8 to 10 weeks;

when the Lepidium fordii transformation acceptor is callus obtained by induction of Lepidium fordii tissue serving as an explant, the culture time is 3-5 weeks, more preferably 4 weeks.

In a preferred embodiment, the regeneration medium described above: MS+6-BA 1.0mg/L+NAA 0.25 mg/L+sucrose 30 mg/L+agar 6 g/L+cephalosporin 250 mg/L+carbenicillin 250mg/L+basta 2mg/L PH=5.8.

Further, when the broadleaf Lespedeza sativa transformation receptor is a callus obtained by induction of broadleaf Lespedeza sativa tissue serving as an explant, the third step further comprises a step of dark culture, wherein the time of the dark culture is 1-2 weeks, more preferably 2 weeks;

preferably, the dark cultured calli carry a fluorescent marker.

In a preferred embodiment, the medium used in the dark culture is a callus screening medium, which: MS+2, 4-D0.5 mg/L+NAA 0.1 mg/L+sucrose 30 mg/L+agar 6 g/L+cephalosporin 250 mg/L+carbenicillin 250mg/L+basta 5mg/L PH=5.8.

In a preferred embodiment, after the end of co-cultivation, the two transformed recipients are individually subjected to screening cultivation as follows:

(1) callus (the proportion of fluorescence carried by the callus subjected to co-culture is 100%) is used as a transformation receptor, the transformation receptor is inoculated onto a callus screening medium, the callus is subjected to dark culture and induced screening for two weeks, and the callus which has good growth condition and fluorescence is transferred into a regeneration medium to be subjected to culture of induced differentiation of regeneration buds, and the callus is irradiated for 16 hours per day. After 4 weeks of incubation, the transformed recipients with stable GFP fluorescence expression were again detected.

(2) Seedling roots, stems and leaves are used as transformation receptors and are directly inoculated into a regeneration culture medium, the seedlings are irradiated for 16 hours per day, and after the seedlings are cultured for 8 to 10 weeks, the transformation receptors with stable GFP fluorescence expression are detected.

The method can improve the conversion success rate.

Further, the agrobacterium infection solution comprises agrobacterium and an infection culture medium, and the infection solution OD ₆₀₀ The value of (2) is 0.3-0.6; preferably 0.5.

In a preferred embodiment, preparation of a seedling rhizome She Qin dye liquor: adding the agrobacterium collected by centrifugation into an infection culture medium, and mixing and suspending to an appropriate concentration OD ₆₀₀ =0.5, an aggressive liquor was made.

When the broadleaf Lepidium tissue is plant tissue, the infection medium is an infection medium (1), and when the broadleaf Lepidium tissue is callus, the infection medium is an infection medium (2).

The specific formulation of the infection culture medium is as follows:

(1) MS+6-BA 1.0mg/L+NAA 0.25 mg/L+sucrose 30mg/L PH=5.4;

(2) MS+2, 4-D0.5 mg/L+NAA 0.1 mg/L+sucrose 30mg/L PH=5.4.

Further, the vibration infection is carried out, the rotating speed is 10-100 r/min, and the infection time is 10-60 min; preferably, the rotation speed is 50r/min and the infection time is 30min.

Further, the co-culture temperature is 22-25 ℃, and the culture time is 2-3 days; preferably, the co-cultivation temperature is 22℃and the cultivation time is 2 days.

In a preferred embodiment, the co-culture medium described above: wherein, when the broadleaf Lepidium tissue is plant tissue, the co-culture medium is co-culture medium (1), and when the broadleaf Lepidium tissue is callus, the co-culture medium is co-culture medium (2).

The specific formula of the co-culture medium is as follows:

(1) MS+6-BA 1.0mg/L+NAA 0.25 mg/L+sucrose 30 mg/L+agar 8g/L PH=5.4;

(2) MS+2, 4-D0.5 mg/L+NAA 0.1 mg/L+sucrose 30 mg/L+agar 8g/L PH=5.4.

On the other hand, the application also provides application of the genetic transformation method in preparing the Lepidium fordii.

The invention has the following beneficial effects:

1. the genetic transformation test is carried out by infecting the calli of the broadleaf uniceps and the roots, stems and leaves of seedlings through agrobacterium for the first time, and a novel method is provided for genetic transformation of the broadleaf uniceps and research and development of novel varieties of the broadleaf uniceps;

2. the application establishes an efficient and feasible isolated regeneration genetic transformation system of the broadleaf Lepidium meyenii, provides technical support for improving the oil quantity and quality of the broadleaf Lepidium meyenii through genetic modification of the broadleaf Lepidium meyenii, and promotes the development and utilization of the broadleaf Lepidium meyenii serving as novel oil crops.

Drawings

The accompanying drawings, which are included to provide a further understanding of the application and are incorporated in and constitute a part of this application, illustrate embodiments of the application and together with the description serve to explain the application and do not constitute an undue limitation to the application.

FIG. 1 is a diagram of seedlings of Lepidium fordii as transformation recipients;

FIG. 2 is a callus diagram as a transformation recipient;

FIG. 3 is a callus image with stabilized GFP fluorescence after infection;

FIG. 4 is a statistical chart of the browning rate of the calli of the Lepidium meyenii in the screening process;

FIG. 5 is a graph of regenerated adventitious buds that are resistant;

FIG. 6 is a diagram of positive transformed plants after transplanting.

Detailed Description

In order to more clearly illustrate the general concepts of the present application, the following detailed description is made by way of example with reference to the accompanying drawings. In the following description, numerous specific details are set forth in order to provide a more thorough understanding of the present invention. It will be apparent, however, to one skilled in the art that the invention may be practiced without one or more of these details. In other instances, well-known features have not been described in detail in order to avoid obscuring the invention.

The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer.

In the following embodiments, unless specified otherwise, the reagents or apparatus used are conventional products available commercially without reference to the manufacturer.

Wherein, the plasmid is pCAMBIA3301, which is a universal free carrier provided by Chongqing Youbao biotechnology Co., ltd; MS medium is provided by Beijing Soy Bao technology Co., ltd; agrobacterium tumefaciens EHA105 is supplied by Wohan vast, biotechnology Inc.

The culture medium used in the embodiment of the invention is specifically as follows:

(1) MS medium: commercial products

(2) Callus induction medium: MS+2, 4-D0.5 mg/L+NAA 0.1 mg/L+sucrose 30 mg/L+agar 6g/L PH=5.8

(3) Agrobacteria culture liquid medium: yep+kan50mg/l+rif50mg/lph=7.0

(4) Infection medium:

(1) MS+6-BA 1.0mg/L+NAA 0.25 mg/L+sucrose 30mg/L PH=5.4

(2) MS+2, 4-D0.5 mg/L+NAA 0.1 mg/L+sucrose 30 mg/LPH=5.4

(5) Co-culture medium:

(1) MS+6-BA 1.0mg/L+NAA 0.25 mg/L+sucrose 30 mg/L+agar 8g/L PH=5.4

(2) MS+2, 4-D0.5 mg/L+NAA 0.1 mg/L+sucrose 30 mg/L+agar 8g/L PH=5.4

(6) Callus screening medium: MS+2, 4-D0.5 mg/L+NAA 0.1 mg/L+sucrose 30 mg/L+agar 6 g/L+cephalosporin 250 mg/L+carbenicillin 250mg/L+basta 5mg/L PH=5.8

(7) Regeneration medium: MS+6-BA 1.0mg/L+NAA 0.25 mg/L+sucrose 30 mg/L+agar 6 g/L+cephalosporin 250 mg/L+carbenicillin 250mg/L+basta 2mg/L PH=5.8

Example 1 genetic transformation Using rootstock and leaf tissue of Lepidium fordii seedlings as recipients

(1) Acquisition of the transformed receptors

The aseptic seedlings of the broad-leaf Lepidium meyenii in 7 days of growth as shown in figure 1 are selected, the roots, stems and leaves of the aseptic seedlings are cut into tissue sections with the size of about 0.5 cm to 1cm, and the tissue sections are placed in aseptic water for standby.

(2) Preparation of agrobacterium activation and invasion solution

(1) Agrobacterium activation: picking single colony of positive engineering bacteria of agrobacterium EHA105 transformed with pCAMBIA3301-GFP plasmid, inoculating into agrobacterium culture liquid medium, shake culturing at 28deg.C at 240r/min to absorbance OD ₆₀₀ =0.3 to 0.4. The activated Agrobacterium solution was then centrifuged at 4000r/min for 10min at 25℃and the supernatant removed.

(2) Preparation of seedling rhizome She Qin dye liquor: adding the agrobacterium collected centrifugally in the step (1) into an infection culture medium (1), and mixing and re-suspending to an appropriate concentration OD ₆₀₀ =0.5, an aggressive liquor was made.

(3) Infection, co-culture and screening

Immersing the seedling root, stem and leaf transformation receptor obtained in the step (1) into the dyeing solution prepared in the step (2), carrying out infection by shaking at the speed of 50r/min in a shaker, taking out the transformation receptor infected by the agrobacterium tumefaciens bacteria solution after 30min, placing the transformation receptor on sterile filter paper, drying in an ultra-clean workbench, transferring the transformation receptor into a co-culture medium (1) paved with the sterile filter paper, and carrying out dark co-culture at the temperature of 22 ℃ for 2-3 days. After co-cultivation, the roots, stems and leaves of seedlings are directly inoculated into a regeneration culture medium as a transformation receptor, the culture medium is changed every 2 weeks at 22 ℃ and is irradiated for 16 hours every day, the culture is carried out for 8 to 10 weeks, and the transformation receptor with stable GFP fluorescence expression is detected, so that the success of transformation is proved.

(4) Detection of resistant regenerated plants

Positive plants can also be detected by PCR means, the specific method is as follows:

when the transformation receptor differentiates about 1cm of resistant adventitious buds, the adventitious buds are peeled off by forceps and inoculated into MS basic culture medium for rooting induction culture, and after 2-3 weeks, seedling hardening and transplanting are carried out.

Leaf DNA of transformed plants was extracted by SDS method, PCR detection with water and seedlings as negative control, pCAMBIA3301-GFP plasmid as positive control, using specific primers GFP-f: CGTGCTCCACCATGTTATCA; GFP-r: ATGTTGTGTGGAATTGTGAG PCR was performed and the amplified gene fragment was approximately 450bp in size.

Example 2 genetic transformation Using calli of Lepidium fordii root as recipients

(1) Acquisition of the transformed receptors

The aseptic seedlings of the Lepidium fordii which grow for 7 days are selected, the roots of the aseptic seedlings are cut into tissue sections with the size of about 0.5 cm to 0.8cm, the tissue sections are inoculated on a callus induction culture medium, the culture is carried out for 21 days in dark, the callus is transferred to a new callus induction culture medium for 2 times of subculture every 7 days, and the callus with good growth state as shown in figure 2 is used as a genetic transformation receptor.

(2) Preparation of agrobacterium activation and invasion solution

(1) Agrobacterium activation: picking single colony of positive engineering bacteria of agrobacterium EHA105 transformed with pCAMBIA3301-GFP plasmid, inoculating into agrobacterium culture liquid medium, shaking at 28deg.C and 240r/min to absorbance OD ₆₀₀ =0.3 to 0.4. The activated Agrobacterium solution was then centrifuged at 4000r/min for 10min at 25℃and the supernatant removed.

(2) Preparation of rhizome She Qin dye liquor: adding the agrobacterium collected by centrifugation in the step (1) into an infection liquid culture medium (2), and mixing and re-suspending to a proper concentration of OD600 = 0.5 to prepare an infection liquid.

(3) Infection, co-culture and screening

Immersing the callus transformation receptor obtained in the step (1) into the invasion solution prepared in the step (2), carrying out invasion by shaking at the speed of 50r/min in a shaker, taking out the transformation receptor infected by the agrobacterium tumefaciens bacteria solution after 30min, placing the transformation receptor on sterile filter paper, drying in an ultra clean bench, transferring the transformation receptor into a co-culture medium (2) paved with the sterile filter paper, and carrying out dark co-culture at 22 ℃ for 2-3 days. After the co-culture, the transformed calli were subjected to fluorescent observation, recording and statistics using a portable fluorescence detector, and 30 explants were inoculated per disc, 3 times in duplicate. The transformation receptor with the proportion of green fluorescence being 100% is inoculated on a callus screening culture medium, after dark culture induction screening is carried out for two weeks at 22 ℃, the callus is transferred into a regeneration culture medium, and the induction differentiation culture of the regeneration buds is carried out. The regeneration induction differentiation culture conditions were that the callus with stable GFP fluorescence expression was again examined after culturing for 4 weeks under light irradiation for 16 hours per day at 22℃and the transformation was confirmed to be successful as shown in FIG. 3.

(4) Detection of resistant regenerated plants

when the successfully transformed callus is differentiated into about 1cm of resistant adventitious buds, the adventitious buds are peeled off by forceps and inoculated into an MS culture medium for rooting induction culture, and hardening off and transplanting are carried out after 2-3 weeks.

Example 3: genetic transformation using calli of Lepidium fordii cotyledon as receptor

The explants of the induced callus were replaced with cotyledon tissue of Lepidium fordii, and the rest of the treatment was the same as in example 2.

Example 4: genetic transformation using calli of hypocotyl of Lepidium fordii as receptor

The explant of the induced callus was replaced with hypocotyl tissue of Lepidium fordii, and the rest of the treatment was the same as in example 2.

Example 5: genetic transformation efficiency test

In comparative examples 1 and 2, the transformation receptors selected in the two examples were different, one was that the rootstock and leaf of the seedling were directly used as the transformation receptor, and the other was that the root tissue of the seedling was used to induce callus as the transformation receptor. The basic composition of the medium involved in example 1 was MS+6-BA 1.0mg/L+NAA 0.25 mg/L+sucrose 30mg/L, and the basic composition of the medium involved in example 2 was MS+2, 4-D0.5 mg/L+NAA 0.1 mg/L+sucrose 30mg/L. The transformation procedure of example 1 is simple compared to example 2, but the incubation time required for the regeneration stage is longer. In addition, in the application, the seedling root, stem and leaf are adopted as a transformation receptor in the example 1, so that the transformation can be successfully performed, and the transformation efficiency is not different.

TABLE 1

Browning rate per day	For 15 days	For 30 days
			Example 2	10％	70％
Example 3	32％	80％
			Example 4	74％	82％

Comparative examples 2, 3, 4 differ in that explants inducing callus were different, and in examples 2, 3, 4 callus was induced using root, cotyledon and hypocotyl as explants, respectively. As can be seen from the data in Table 1 and FIG. 4, after the infection of agrobacterium, the growth speed of the callus on the callus screening culture medium is obviously delayed, the root and leaf induced callus has no obvious browning phenomenon when being cultured for 15 days, and the hypocotyl induced callus browning rate reaches 74%; at 30 days of culture, the calli were brown to different degrees, with a root calli brown to 70%, hypocotyl calli brown to 82% and leaves calli brown to 80%.

At 15 days of culture, the calli induced by the rootstock and leaf were transferred to a regeneration medium respectively, and after two weeks, the calli induced by the root tissue as an explant was used to start the differentiation process of adventitious buds, green bud spots appeared on the calli, and after 4 weeks, the calli were differentiated to form adventitious buds, as shown in fig. 5. Whereas the callus regeneration capacity of hypocotyls and cotyledons was relatively low, presumably due to severe callus browning during screening. Therefore, callus obtained by taking the root tissue of Lepidium fordii as an explant is the most preferred embodiment of the method as a transformation receptor.

In summary, in the present invention, seedling roots, stems, leaf cut sections or root calli can be genetically transformed as transformation recipients, and regenerated seedlings have been obtained as shown in FIG. 6. The invention establishes an effective scheme of the in-vitro regeneration transformation of the broadleaf lettuce, provides technical support for the quality improvement of the broadleaf lettuce, and promotes the development and utilization of the broadleaf lettuce as a novel oil crop.

The foregoing is merely exemplary of the present application and is not intended to limit the present application. Various modifications and changes may be made to the present application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc. which are within the spirit and principles of the present application are intended to be included within the scope of the claims of the present application.

Claims

1. An in vitro regeneration genetic transformation method of Lepidium fordii, which is characterized by comprising the following steps:

step two, taking out the infected transformation receptor in the step one, transferring the transformation receptor into a co-culture medium, and performing dark co-culture; the co-culture temperature is 22-25 ℃, and the culture time is 2-3 days;

step three, inoculating a transformation receptor into a regeneration culture medium for culture; in the third step, the culture temperature is 22-25 ℃, and the ratio of the light to dark time per day is 16:8; the culture time is 3-5 weeks;

the Lepidium fordii transformation receptor is a callus obtained by taking Lepidium fordii root tissue as an explant for induction; the tissue of the Lepidium fordii is a tissue of seedlings growing for 5-10 days;

the agrobacterium is agrobacterium tumefaciens or agrobacterium rhizogenes; the agrobacterium contains an expression vector; the expression vector contains a screening marker gene, wherein the screening marker gene is a fluorescent marker gene;

the third step further comprises a step of dark culture, wherein the time of the dark culture is 1-2 weeks; the dark cultured calli carry a fluorescent marker.

2. The method of claim 1, wherein the broadleaf Lepidium tissue is tissue of 7-day-old seedlings.

3. The method of claim 1, wherein the agrobacterium is agrobacterium tumefaciens.

4. The method of claim 3, wherein the agrobacterium tumefaciens is selected from one or more of EHA105, EHA101, LBA4404, GV3101, AGL 1.

5. The method of claim 4, wherein the agrobacterium tumefaciens is EHA105.

6. The method of claim 1, wherein the expression vector is selected from one or more of pCAMBIA3301, pCAMBIA1300, pCAMBIA1301, pCAMBIA 3300.

7. The method of claim 6, wherein the expression vector is pCAMBIA3301.

8. The method of claim 1, wherein the fluorescent marker gene is selected from one or more of GFP, YFP, CFP, BFP.

9. The method according to claim 1, wherein in the third step, the culturing time is 4 weeks.

10. The method of claim 1, wherein the dark culture is for a period of 2 weeks.

11. The method according to claim 1, wherein the agrobacteria infection solution comprises agrobacteria and an infection medium, and the agrobacteria infection solution OD ₆₀₀ The value of (2) is 0.3 to 0.6.

12. The method of claim 11, wherein the agrobacterium infestations solution OD ₆₀₀ The value of (2) is 0.5.

13. The method of claim 1, wherein the oscillating infestation is at a rotational speed of 10-100 r/min and a infestation time of 10-60 min.

14. The method of claim 13, wherein the speed of rotation is 50r/min and the time of infestation is 30min.

15. The method of claim 1, wherein the co-cultivation temperature is 22 ℃ and the cultivation time is 2 days.

16. Use of a genetic transformation method according to any one of claims 1 to 15 for the preparation of broadleaf watercress.