CN112708625B - Lilium regale inducible promoter PG1 and application thereof - Google Patents

Abstract

The invention discloses a lily-of-Min inducible promoter PG1, the nucleotide sequence of the lily-of-Min inducible promoter PG1 is shown as SEQ ID NO. 1, and the invention proves that the lily-of-Min promoter PG1 responds to several plant hormones, biological and abiotic stresses through related technical researches of molecular biology and genetic engineering; the fusion expression frame constructed by the lily promoter PG1 and the beta-glucosidase gene is transferred into tobacco for expression, the glucuronidase activity of the transgenic tobacco is quantitatively detected by fluorescence, and the result shows that the activity of the glucuronidase of the transgenic tobacco is obviously enhanced after abscisic acid, salicylic acid, fusarium oxysporum, black sporidium oryzae, compact alternaria and injury stress treatment, and the lily promoter PG1 is induced by a plurality of plant hormones, biological and abiotic stress factors, so that the transgenic tobacco has wide application prospect in genetic engineering of antibiotic or abiotic stress.

Description

Lilium regale inducible promoter PG1 and application thereof

Technical Field

The invention relates to the fields of molecular biology and related research of genetic engineering, in particular to a lily inducible promoter PG1 and application thereof.

Background

The promoter is a DNA sequence located in the upstream region of the gene to regulate gene transcription, is an important cis-regulatory factor, and determines the time-space accuracy and transcription efficiency of gene transcription, thereby regulating the expression of downstream genes. The promoter composition includes a core promoter and an upstream promoter element. The core promoter consists of a transcription initiation site, a TATA box and a 5' utr sequence. Upstream promoter elements include CAAT boxes, GC boxes and some constitutive and specific elements that bind to the corresponding protein factors to increase transcription efficiency. Promoters of plant genes can be classified into constitutive promoters, inducible promoters and tissue-specific promoters according to the expression mode. Tissue-specific promoters often drive gene expression only in certain specific organs or tissue sites, exhibiting fertility-regulating properties. Inducible promoters generally do not initiate gene transcription or have very low transcriptional activity, which is markedly increased under certain specific signal stimuli. The specific expression of the tissue-specific promoter is not absolute, e.g., most fruit-specific promoters have ethylene response elements present at the same time and can also be regarded as ethylene inducible promoters.

Plant genetic engineering is a method of introducing exogenous genes into recipient cells, integrating them with recipient chromosomes, and altering the genetic characteristics of recipient plants. It not only can overcome the reproductive isolation between species, but also can greatly accelerate the plant breeding process. In genetic engineering, the expression of a foreign gene must be driven by a promoter. Most of the traditional genetic engineering uses constitutive promoters which are expressed with high intensity throughout the life cycle of the plant, resulting in excessive accumulation of gene products and consequent metabolic disorders which may even lead to severe dysplasia. The application of the inducible promoter reduces the accumulation of metabolites such as heterologous proteins and the like generated during the expression of exogenous genes and the waste of plant energy, thereby stabilizing the metabolic balance of plants. The inducible promoter not only can avoid the excessive consumption of plant energy caused by the continuous expression of the target gene, but also can eliminate the damage caused by the accumulation of gene products to plants, and becomes a research hotspot of plant genetic engineering in recent years (Sun Fangfang, song Hongyuan. Research progress of plant inducible promoters. Southern gardening, 2014, 25 (02): 51-56).

Inducible promoters are generally designated by an induction signal, such as light-inducible promoters, heat-inducible promoters, wound-inducible promoters, hormone-inducible promoters, and fungal-inducible promoters. The expression of the exogenous gene driven by the inducible promoter is controlled by specific physical or chemical signals, and the characteristic enables the expression of the exogenous gene to be controlled more finely, so that the research on the inducible promoter is one of the hot spots of plant molecular biology and genetic engineering research. Utilizing chromosome walking technology to obtain lily flowerLilium regale) A kind of electronic devicePR10-5The promoter of 1489 bp is amplified from the gene end and connected with GUS reporter gene to transfer tobaccoNicotiana tabacum) The result shows that the lilyPR10-5The promoter is a multiple stress inducible promoter. Gibberellin, abscisic acid and ethylene pairsPR10-5The activity of the promoter has positive regulation function, wherein gibberellin has the strongest induction effect on the promoter; after abiotic stress treatment such as salt stress and injury stress, GUS activity of transgenic tobacco is obviously enhanced, which indicates that the salt stress and injury stress are positively regulated and controlledPR10-5Activity of the promoter; fusarium oxysporumFusarium oxysporum) Sclerotinia sclerotiorum (L.) KuntzeSclerotinia sclerotiorum) Botrytis cinereaBotrytis cinerea) Pairs of infectionsPR10-5The induction of GUS activity was also very pronounced (Chen R, he H, yang Y, et al Functional characterization of a pathogenesis-related protein family gene,LrPR10-5, from Lilium regalewilson, australas Plant Path, 2017, 46 (3): 1-9). From powdery mildew germOidium heveae) A WY7 promoter is obtained by separation in genome, the WY7 promoter is connected with a reporter gene GUS to be transferred into tobacco for transient expression and is subjected to proper adversity treatment, and the GUS gene expression driven by the WY7 is induced under low temperature and salt stress, which shows that the WY7 promoter is induced by low temperature and salt stress factors (Wang Y, wang C, rajaofera N, et al, WY7 is a newly identified promoter from the rubber powdery mildew pathogen that regulates exogenous gene expression in both monocots and dicots. PloS one, 2020, 15(6):e0233911）。

Disclosure of Invention

The invention aims to provide an inducible promoter PG1 which is derived from lily of Min river and has a nucleotide sequence shown as SEQ ID NO. 1.

The invention also aims to apply the promoter in genetic engineering, namely, the promoter is used as an inducible expression promoter for regulating the specific high-efficiency expression of exogenous genes in transgenic receptor plants under biotic and abiotic stress.

The invention relates to an inducible promoter fragment which is separated and the expression activity is identified, and the invention clones an inducible promoter from lily of Minjiang, and the promoter is 904bp long. The inducible promoter fragment isolated and cloned by the invention replaces the CaMV 35s promoter on the pBI121 vector, and the inducible promoter drives the reporter geneGUSThrough the expression frame of agrobacterium tumefaciens @Agrobacterium tumefaciens) The expression of the exogenous gene in tobacco of a mode plant is mediated, and the expression characteristic of the inducible promoter is revealed through further experiments, so that a foundation is laid for the later-period utilization of the promoter to regulate and control the efficient and specific expression of the exogenous gene in the transgenic plant. The inventors named this promoter PG1.

Driving the PG1 promoter of the present inventionGUSThe expression cassette of the gene is transferred into tobacco, transgenic tobacco plants are treated by adopting a plurality of plant hormones, biological and abiotic stresses, and fluorescent quantitative analysis of GUS activity is carried out, and the detection result shows that the PG1 promoter responds to the expression cassette by adopting the plant hormones, the biological and abiotic stresses, such as abscisic acid, salicylic acid and fusarium oxysporumFusarium oxysporum) Compact Alternaria alternataAlternaria compact) Black spore mould of riceNigrospora oryzae) Injury stress can obviously induce the activity of the promoter PG1.

The promoter PG1 can be applied to the induction expression of exogenous genes in genetic engineering, and the specific operation is as follows:

(1) Extracting genome DNA from tender tissue of lily by adopting specific primers for amplifying PG1, amplifying PG1 by polymerase chain reaction (polymerase chain reaction, PCR), connecting the PG1 to pGEM-T vector, and sequencing to obtain clone with correct sequence;

(2) Cutting pGEM-T-PG1 vector by restriction enzyme, and recovering the promoter fragment; simultaneously adopting proper restriction enzyme to cut out constitutive expression promoters on plant expression vectors, and obtaining large vector fragments through glue recovery; then the PG1 fragment obtained is reacted with pBI121-GUSThe vector segments are connected to construct a plant induction expression vector; and transferring the constructed plant induction expression vector into a receptor plant through the mediation of agrobacterium tumefaciens. When the transgenic plant is subjected to fusarium oxysporum, alternaria pachyrhizus, black spore mould of rice and injury stress, the target gene driven by the promoter PG1 can induce and up-regulate the expression level, and in addition, the abscisic acid and salicylic acid in vitro and in vivo can also induce the high-level expression of the target gene.

The invention provides a novel promoter for inducing expression in plant genetic engineering application. In genetic engineering, a plant overexpression vector is commonly used as a 35S promoter from cauliflower mosaic virus, the promoter is a constitutive expression promoter, the expression of a target gene is generally constant at a certain level, and the expression levels of different tissues and parts are not obviously different, so that the expression of a foreign gene transferred into a plant is not controlled, and a large amount of protein is accumulated and energy is wasted. The inducible promoter can improve the expression quantity of the gene when the plant is influenced by external stress or chemical factors, and can reduce the expression of the target gene after stress or chemical treatment is removed, so that the inducible promoter can ensure the effects of protecting the plant and resisting external stimulus when the plant is stressed by adversity, and otherwise, the energy of the plant is not wasted in a proper environment. In addition, in the application of genetic engineering, the inducible promoter can not only avoid the excessive consumption of plant energy caused by the continuous expression of a target gene, but also eliminate the damage of the accumulation of gene products to plants. Several hormones (abscisic acid and salicylic acid), abiotic stress (injury) and biotic stress (fusarium oxysporum, alternaria pachyrhizi and black spore mould) obviously induce the expression activity of the PG1 promoter in the invention, so the invention has wide application prospect in genetic engineering for resisting biotic or abiotic stress.

Drawings

FIG. 1 shows the results of detection of the gel recovery products of the promoters PG1 (panel A) and pBI121 vector (panel B) of the present invention;

FIG. 2 shows pBI121-PG1-GUSThe positive cloning detection result of the transformed escherichia coli, wherein the positive control is a PCR reaction taking pGEM-T-PG1 plasmid as a template, and the negative control is a PCR reaction taking sterile water as a template;

FIG. 3 is a partial pBI121-PG1-GUSPCR screening results of transgenic tobacco, wherein the positive control was obtained with plasmid pBI121-PG1-GUSPCR reaction as template; WT: PCR reactions were performed using non-transgenic tobacco (wild type) total DNA as template.

FIG. 4 is a standard curve of GUS enzyme activity assay of the present invention;

FIG. 5 shows pBI121-PG1-GUSGUS activity of transgenic tobacco after abscisic acid and salicylic acid treatment, wherein the control is pBI121-PG1-GUSGUS activity of transgenic tobacco;

FIG. 6 shows pBI121-pBI121-PG1-GUSGUS activity of transgenic tobacco after injury treatment, wherein the control is pBI121-PG1-GUSGUS activity of transgenic tobacco;

FIG. 7 shows pBI121-PG1-GUSGUS activity of transgenic tobacco after inoculation of fusarium oxysporum, alternaria pachyrhizus and black spore mould of rice, wherein the control is pBI121-PG1 of normal growthGUSGUS activity in transgenic tobacco.

Detailed Description

The present invention will be further illustrated by the following figures and examples, but the scope of the invention is not limited to the description, and the methods in this example are all performed according to the conventional methods unless otherwise specified, and the reagents used are the conventional reagents or the reagents configured according to the conventional methods unless otherwise specified.

Example 1: cloning and sequence analysis of lily inducible promoter PG1

Using extracted genomic DNA of Lilium regale as a template, the sequence of promoter PG1 was cloned by PCR using specific primers (the upstream primer: 5 'GCCCCATAGACCCTACCAAGTAGTA 3' ', the downstream primer: 5' CAGGGGCAGAGGTGAC3 '', the reaction system (20. Mu.L) was composed of 0.5. Mu.g of genomic DNA of Lilium regale, 2. Mu.L of 10 XAdvantage 2 PCR Buffer, 1.8. Mu.L of dNTP Mix (10 mM each), 0.2. Mu.L of upstream primer (10. Mu.M), 0.2. Mu.L of downstream primer (10. Mu.M), 0.2. Mu.L of Advantage 2 PCR Polymerase Mix, 14.6. Mu.L of PCR-Grade water, PCR reaction conditions: 94℃5min, 94℃30s,63℃30s,72℃50s,32 cycles, and 8. Mu.L of agarose gel electrophoresis were performed after the end of 5min.

The PCR product has only one DNA band, TA cloning is directly carried out on the PCR product, the used kit is pGEM-T vector system (Promega), and the reaction system and the operation process are as follows: 1.5. Mu.L of the PCR product was taken, 1. Mu.L of pGEM-T vector (50 ng/. Mu.L) and 2.5. Mu.L of 2X Ligation solution I were added in this order, and after mixing, the mixture was allowed to stand at 16℃overnight for reaction. The ligation product was transferred into E.coli DH 5. Alpha. Competence by heat shock transformation. Positive clones were screened with LB solid medium containing ampicillin (Amp). Several single colonies were selected, and after shaking, clones with multiple cloning sites inserted into PG1 were detected with specific primers for amplifying PG1. And sequencing the obtained positive clone, wherein the length of the finally obtained promoter PG1 is 904bp. The promoter cis-acting element was predicted by PLANTCARE, and the cis-acting element associated with stress in the promoter sequence was predicted.

Example 2: PG1-GUSExpression vector construction

pBI121 having multiple cloning sitesHindIIIBamThe HI cleavage site was added to the specific primers of the amplified promoterHindIIIBamRecognition sites for HI. The E.coli plasmid pGEM-T-PG1 inserted with PG1 and the plant expression vector pBI121 plasmid were extracted by using SanPrep column type plasmid DNA miniprep kit (Shanghai Kogyo) and 1. Mu.L was used for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmids. By restriction enzymesHindIIIBamH I double cleavage (5. Mu.L System), reaction System and manipulation of plasmids pGEM-T-PG1 and pBI121, respectivelyThe method comprises the following steps: mu.L of pGEM-T-PG1 and pBI121 plasmids were taken separately, and 10. Mu.L of 10 XH buffer and 5. Mu.L of the plasmid were added in sequenceBamHI、5μL HindIII、60μL ddH ₂ O, after mixing evenly, centrifuging for a short time, and standing at 37 ℃ overnight for reaction. All the digested products were subjected to agarose gel electrophoresis, then the promoter fragment and the large pBI121 vector fragment were separately subjected to gel recovery using a SanPrep column type DNA gel recovery kit (Shanghai Kogyo), and 1. Mu.L of the recovered product was taken and the size and concentration of the recovered fragment were detected by agarose gel electrophoresis, and the results are shown in FIG. 1.

The recovered promoter DNA fragment and pBI121 vector fragment were ligated together using T4 DNA Ligase (TaKaRa), and the reaction system (20. Mu.L) was operated as follows: 10. Mu.L of PG1 DNA fragment was taken and 2. Mu.L of pBI121 vector DNA, 2. Mu.L of 10 XT 4 DNA Ligase Buffer, 1. Mu. L T4 DNA Ligase and 5. Mu.L of ddH were sequentially added ₂ O, after mixing evenly, centrifuging for a short time, and then carrying out a water bath at 16 ℃ for overnight reaction. The ligation product was then transferred into E.coli DH 5. Alpha. Using heat shock transformation and positive clones were selected using solid medium containing 50mg/L kanamycin. Selecting single colony shaking bacteria, using bacterial liquid as a template, carrying out PCR by using a specific primer of an amplification promoter PG1, selecting clones successfully connected with PG1 and pBI121, adding glycerol into the obtained positive strain, and storing at-80 ℃ for later use.

Extracting and purifying pBI121-PG1 in the escherichia coli DH5 alpha by adopting SanPrep column type plasmid extraction kit-GUSA plasmid. The plant expression vector pBI121 constructed above was then frozen and thawed with liquid nitrogen-PG1-GUSTransfer into competent cells of Agrobacterium tumefaciens LBA4404 prepared. The operation steps are as follows: mu.g of pBI121-PG1 was taken-GUSThe plasmid was added to a centrifuge tube containing 200. Mu.L of competent cells, gently mixed and ice-incubated for 5min, then transferred into liquid nitrogen and frozen for 1min, then rapidly placed in a 37℃water bath for 5min and ice-incubated for 2min, and then 500. Mu.L of LB liquid culture was added for shaking culture at 28℃for 4h. The activated Agrobacterium was spread on LB solid medium containing 50mg/L kanamycin, and cultured upside down at 28 ℃. Selecting single colony and shaking bacteria, then carrying out PCR reaction by using specific primers for amplifying PG1, and detecting pBI121-PG1-GUSWhether or not to transfer into Agrobacterium. For positive clones shown in FIG. 2, addAdding glycerol, and storing at-80deg.C.

Example 3: agrobacterium-mediated plant genetic transformation and transgenic plant selection

The transgenic acceptor in this experiment was tobacco, tobacco seeds were soaked in 75% alcohol for 30s, washed with sterile water and then with 0.1% HgCl ₂ Soaking for 8min, washing with sterile water for several times, seeding on 1/2 MS culture medium, dark culturing at 28deg.C for 5-8d, germinating, transferring to illumination incubator (25deg.C, 16h/d illumination), and subculturing with MS culture medium once per month.

The composition contains pBI121-PG1 stored in a refrigerator at-80deg.C-GUSThe bacterial liquid of the agrobacterium LBA4404 of the plasmid is taken out, 10 mu L of the bacterial liquid is inoculated into 1mL of LB liquid medium containing 20mg/L rifampicin and 50mg/L kanamycin, and the culture is carried out at 28 ℃ under shaking at 200rpm until the bacterial liquid is turbid. mu.L of the bacterial liquid is absorbed and evenly spread on LB solid medium containing 20mg/L rifampicin and 50mg/L kanamycin, and the bacterial liquid is inversely cultured at 28 ℃ until bacterial lawn grows. Scraping 3-5 loop thallus Porphyrae with inoculating loop, inoculating into 40mL MGL culture medium containing 25mg/mL acetosyringone, shake culturing at 28deg.C and 220rpm until OD ₆₀₀ About 0.6. Cutting the leaves of the aseptic tobacco tissue culture seedling into about 1cm ² Leaf discs with the size are soaked in MGL culture medium containing suspended agrobacterium tumefaciens, and shake culture is carried out at 25 ℃ for 15min. The bacterial liquid on the surface of the leaf disc is sucked by sterile filter paper and then transferred into a tobacco co-culture medium for dark culture at 22 ℃ for 2 days. The leaf discs after co-cultivation were transferred to tobacco screening medium and cultured in an illumination incubator (25 ℃,16h/d illumination). The differentiated tobacco seedlings were cut out and subcultured on rooting medium containing 50mg/L kanamycin and 300mg/L cephalosporin for about 3 weeks.

The genome DNA of the leaves of the transgenic tobacco plants is extracted by adopting a CTAB method, and 1 mu L of genome DNA is taken for agarose gel electrophoresis to detect the integrity and the concentration. PCR reaction is carried out by using genomic DNA of transgenic plants as templates and specific primers of amplification promoter PG1. After the PCR was completed, 8. Mu.L of the product was used for agarose gel electrophoresis to detect positive transgenic plants. The amplification result of partial transgenic tobacco plants is shown in figure 3, and 29 positive transgenic plants are screened from the lily-Min inducible promoter PG1 transgenic tobacco.

Example 4: GUS (guide rail) fluorescence quantitative detection of transgenic tobacco

The method of fluorescence quantitative analysis of transgenic tobacco leaf GUS activity was referred to by Jefferson et al (Jefferson R. Assaying chimeric genes in plants: the GUS gene fusion system Plant Mol Biol Rep.1987, 5 (4): 387-405) by the reaction mechanism: GUS can react with a substrate 4-MUG to catalyze and generate 4-MU, the 4-MU generates fluorescence under the conditions of 365-nm excitation wavelength and 455nm emission wavelength, and the generated fluorescence value can be quantitatively measured by a fluorescence spectrophotometer.

The pretreated tobacco leaves were placed in a mortar containing liquid nitrogen and ground to a powder, 400. Mu.L of GUS extraction buffer was added, and the homogenate was transferred to a 1.5mL centrifuge tube and centrifuged at 12000 g for 10min at 4 ℃. After centrifugation, the supernatant was collected in a new centrifuge tube. 1mL of the 4-MUG solution (1 mmol/L) was pre-heated in a 2.0mL centrifuge tube at 37℃for 10min. 50. Mu.L of the supernatant was added to the preheated GUS reaction buffer, shaken rapidly and 200. Mu.L of the reaction mixture was immediately placed in 1.8mL of stop buffer (run time less than 30 s) as a 0 spot for the enzymatic reaction (blank control for the fluorometric assay), and the remaining liquid was allowed to continue at 37℃and the time was started. 200. Mu.L of the reaction mixture was taken at 15min, 30min and 45min, and added to 1.8mL of stop buffer for fluorescence measurement. The fluorescence value of each sample was measured using a fluorescence spectrophotometer at an excitation wavelength of 365nm and an emission wavelength of 455 nm. 4-MU standard curve was prepared: the 1mM 4-MU mother solution was diluted with reaction terminating solution into different gradient solutions of 5nM, 10nM, 20nM, 40nM, 60nM,80nM and 100nM, respectively, and the fluorescence value of each gradient solution was measured at an excitation wavelength of 365nM and an emission wavelength of 455nM, and a standard curve was drawn using the measured fluorescence value and the concentration of 4-MU as a blank control with the reaction terminating solution (as shown in FIG. 4). 10 μl of the supernatant was used to determine the protein content of the samples using the modified coomassie brilliant blue method. The amount of enzyme catalyzing 4-MUG to 1pmol 4-MU in one minute was taken as one activity unit, and the GUS enzyme activity was calculated as the enzyme activity per μg of total protein, expressed as 4-MUpmol/min/μg (protein). GUS activity of transgenic tobacco was calculated by standard curve.

In order to detect the response of the lily of the regale lily promoter PG1 to plant hormones, biotic stress and abiotic stress, leaves of transgenic tobacco are treated with several plant hormones, biotic stress and abiotic stress factors respectively, GUS activity before and after treatment is measured by the method, and GUS activity of leaves of transgenic tobacco which is not treated is used as a control for normal growth. As shown in FIG. 5, GUS activity of the PG1 transgenic tobacco leaves of the Minjiang lily promoter is obviously up-regulated after treatment of abscisic acid and salicylic acid, and the abscisic acid is salicylic acid in view of the induction degree of the promoter activity. GUS activity of transgenic tobacco after victim treatment is shown in FIG. 6, and the damage to the abiotic stress factor significantly up-regulates the activity of promoter PG1. Leaves of transgenic tobacco inoculated with the three pathogenic fungi Fusarium oxysporum, alternaria pachyrhizi, nigrospora oryzae all significantly upregulated the activity of promoter PG1 (FIG. 7), from the induction level, alternaria pachyrhizi Nigrospora Nigromaculatum Fusarium. The experimental results show that the Min lily promoter PG1 responds to treatment of several plant hormones, abiotic stress and biotic stress, and abscisic acid, salicylic acid, fusarium oxysporum, alternaria compacta, nigrospora oryzae and wound stress can obviously up-regulate GUS activity driven by PG1. Obviously, the lily of the regale promoter PG1 is a plant hormone, biotic stress and abiotic stress factor inducible promoter, and can be applied to plant stress resistance genetic engineering.

Sequence listing

<110> university of Kunming engineering

<120> an inducible promoter PG1 of Minjiang lily and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 904

<212> DNA

<213> Minjiang lily (Lilium regale Wilson)

<400> 1

tttttacccc gttggggcct ttttaataag gggattctat ttttctggat aaggccccat 60

agaccctatc caagtattgg aattggggat aaccactaag gtgggtaccg gttattatcc 120

ctaataggcc atcgggtgga taagggcccg gttggtaatt ggataaatta agggcttggt 180

ggtggttccc ccaatacggc taacttcttc gggtatgaaa acgtattcgg aattcatcgg 240

ggatacccag tttttagata agggatttcc cttgggctat attaagggga ctaagggatt 300

caacccagag ggcatacgac cagattccaa gaagttggct gaaggaagat tccttcccgg 360

ttccccgttc cgccggggaa gttcaccttc gccggaggtt cgcattgttt tcgggccgcc 420

ataggaggag gccccttatt cgcctccagc caggattccg gttcgcaagg attattcgga 480

gccgcaaggg gtggttagat tcttggggtg ttttgtaagg gtaaggtttt ttggaagggt 540

aaggtttttt atcctccccc caaaggtttt tattaagtta aaggattctt accaaaatta 600

gggaaggacc atttgggttt ttccaaccag gattggtaat acaaggccat tttaattaat 660

tggggggaaa tccattcacc tattttgggg aaattttaaa aaataaatta aagaaattcc 720

aattttaaat tttttttttt taaaatatga tgaatcatct atatcacgca ttatgtaagg 780

gtacttctag aaaattcaaa aaagaaacaa agaaggagaa cccaaacatg aaaactatgg 840

caagccagcc tacccaccct tgtcctcaag tcaaccctct gcccctgaaa aaaagaaccc 900

aatg 904

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence (Artifical)

<400> 2

gccccataga ccctatccaa gta 23

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence (Artifical)

<400> 3

caggggcaga gggttgac 18

Claims (2)

1. An inducible promoter PG1 is derived from lily of Min, and the nucleotide sequence of the inducible promoter PG1 is shown in SEQ ID NO. 1.

2. The inducible promoter PG1 of claim 1 in the presence of abscisic acid, salicylic acid, injury, fusarium oxysporumFusarium oxysporum) Compact Alternaria alternataAlternaria compacta) Or black spore mould of riceNigrospora oryzae) The application of exogenous gene expression in transgenic acceptor plant is regulated under stress.

Images