CN101831438A - Wheat introgression line response abiotic stress regulatory gene tazf13 and application thereof - Google Patents

Abstract

The invention discloses a wheat introgression line response abiotic stress (salinization, drought and the like) regulatory gene tazf13 and plant expression vectors pSTART/tazf13 and pCambia3301-bar/tazf13 containing the gene tazf13. The invention also discloses the application of the gene tazf13 and the plant expression vectors containing the gene tazf13 in the culture of abiotic stress resistance (salinization resistance). Experiments prove that the abiotic stress resistance (salinization resistance) of expression transgenosis plants is improved obviously.

Description

It is response abiotic stress regulatory gene tazf13 and application thereof that wheat gradually oozes

Technical field

The invention belongs to technical field of biological genetic engineering, relating in particular to that wheat gradually oozes is response abiotic stress (salt, drought etc.) regulatory gene tazf13 and application thereof.

Background technology

Wheat is a kind of important crops, the annual sown area of China's wheat also reaches more than 4.3 hundred million mu, its production status is directly connected to the raising of development of Chinese economy and living standards of the people, but abiotic stresses such as arid, salt marsh, low temperature have a strong impact on it and grow and output, the anti-contrary new variety of wheat of seed selection, thereby development and use salinization soil enlarge wheat class cultivated area, improve unit output, become when previous very urgent task.

Except traditional breeding way, utilize new technology such as genetic and cell engineering can fast and stable ground to obtain to have the new variety of wheat of good anti-adversity ability.Utilize transgenic technology that new degeneration-resistant correlation function gene is transferred in the wheat, with this efficient exploitation resistant transgenic new variety of wheat, being used in arid or the plantation of salinification area is a technology with broad prospect of application.Its prerequisite is, must systematically understand the degeneration-resistant mechanism of wheat, separates efficiently and degeneration-resistant relevant gene.

For many years, the research of relevant plant stress-resistance mechanism aspect has obtained bigger progress, has cloned and the plant stress genes involved, for the molecular mechanism of further illustrating plant drought provides theoretical clue and foundation.Some experiments show, with in plant itself and the other biological with degeneration-resistant relevant gene transferred plant in, its allos transcribe can the render transgenic plant with translation product anti-adversity ability change.The functional gene that is used to transform comprises two classes: a class is the functional gene relevant with plant stress-resistance, directly improves the anti-adversity ability of plant by the method for expressing excessively or gene is pounded out; Another kind of is the regulatory gene relevant with the plant stress-resistance signal path, this genoid is expressed equally in plant can improve plant stress tolerance, and effect may be more obvious.

At present, found that some can significantly change the gene of plant stress-resistance ability, wherein transcription factor is paid close attention to by increasing people as the hinge in the plant stress-resistance signal path.Studies show that, these gene transformation in plant, can obviously be improved the drought-resistant ability of plant.

Zinc finger albumen is the very important transcription factor of a class, growth plant, all play the effect of outbalance in growth and the metabolic process, existing in recent years test shows, some zinc finger protein involved in plant is to the response process of multiple abiotic stress, regulates and control and coerces transcribing of genes involved.This class zinc finger protein comprises C2H2 type zinc finger protein, A20 class zinc finger protein etc., but the relevant effect of RanBP class transcription factor in the plant stress-resistance process do not appear in the newspapers as yet.

Summary of the invention

At the deficiencies in the prior art, the purpose of this invention is to provide a kind of degeneration-resistant regulatory gene---it is response abiotic stress regulatory gene (it is RanBP zinc finger protein class transcription factor gene tazf13 that wheat gradually oozes) and application thereof that wheat gradually oozes.

Technical program of the present invention lies in gradually oozing from wheat somatic hybrid is that the mountain is melted No. 3 to separate and obtained grow wheat zinc finger protein allelic variation gene a---tazf13, make up dicotyledons expression vector pSTART/tazf13 transformation mode plant Arabidopis thaliana, function with identified gene, and structure monocotyledons expression vector pCambia3301-bar/tazf13 transforms common wheat (stone wheat 18), identify the effect of this gene in wheat is degeneration-resistant, improve the resistance of farm crop.

Wheat provided by the invention gradually ooze be response abiotic stress (salt, drought etc.) regulatory gene (it is RanBP zinc finger protein class transcription factor gene that wheat gradually oozes) name to be called that wheat somatic hybrid gradually oozes be that zinc finger protein gene tazf13 is melted on the mountain No. 3, the nucleotide sequence of described gene cDNA is shown in SEQ ID No.1.

The present invention also provides plant expression vector pSTART/tazf13 or the pCambia3301-bar/tazf13 that contains above-mentioned wheat zinc finger protein gene tazf13.

Gene tazf13 of the present invention and contain the plant expression vector pSTART/tazf13 of described gene tazf13 or the application of pCambia3301-bar/tazf13 in cultivating resisting abiotic stress (salt tolerant) plant.Wherein said plant optimization is common wheat or Arabidopis thaliana.

With gene transfered plant cell of the present invention, make its overexpression in plant just can obtain salt resistance ability by the render transgenic plant.

Gene of the present invention can be widely used in cultivates degeneration-resistant new crop varieties, and can be and deeply illustrate plant stress-resistance mechanism theoretical foundation is provided.

Beneficial effect of the present invention: utilize existing plant gene engineering technology, the present invention clones first and obtained that wheat gradually oozes is that the new gene tazf13 of response abiotic stress is melted on the mountain No. 3, and the method that mediates by agrobacterium tumefaciens changes this gene over to Arabidopis thaliana, prove that through comparative analysis the salt resistance ability of transfer-gen plant obviously strengthens.And, in wheat, this gene being carried out expression by wheat growth point conversion method, the result shows that the increment of transfer-gen plant root under salt stress is greater than wild-type

Description of drawings

The amplification of Fig. 1 tazf13 full length gene cDNA sequence

Wherein: the M:DNA molecular weight standard is DL2000 herein

The sxemiquantitative RT-PCR that Fig. 2 tazf13 goes down the hill to melt in No. 3 and the Jinan 177 in multiple processing analyzes.

Fig. 3 tazf13 transgenic arabidopsis plant RT-PCR identifies.

Wherein: pST: the empty carrier contrast; OE: cross express transgenic plant (down together).

The growing state of Fig. 4 tazf13 transgenic arabidopsis plant seedling phase on different concns NaCl substratum.

Coerce the sxemiquantitative RT-PCR result of marker gene in Fig. 5 tazf13 transgenic arabidopsis plant.

Fig. 6 tazf13 transgenic wheat plant T0 identifies for PCR

Wherein: the M:DNA molecular weight standard, herein for being λ DNA HindIII+EcoRI, C+: plasmid positive control, C-: wild plant contrast (down together).

Fig. 7 tazf13 transgenic wheat plant T1 identifies for PCR

Fig. 8 tazf13 transgenic wheat plant T2 identifies for PCR

Fig. 9 tazf13 transgenic wheat plant Real-time identifies.

The growing state of Figure 10 tazf13 transgenic wheat plant seedling phase on 200mM NaCl substratum.

Embodiment

The clone that No. 3 tazf13 are melted on embodiment 1, salt tolerant new variety mountain

1.1 the processing of vegetable material

1) with wheat seed (melt No. 3 on the mountain) 4 ℃ of vernalization 20 days

2) handled seed 2-3 minute with 70% alcohol.

3) discard alcohol, with aseptic washing 3-5 time, each fully vibration mixing.

4) soak seed with sterilized water, lucifuge, 25 ℃, 40-60rpm/min, shaking table overnight incubation.

5) seed is faced up, be placed in on the fully wetting filter paper of sterilized water, lucifuge is sprouted.

6) after 3 days seed transferred to and cultivate in the basket, 1/2Hoagland, water planting places 23 ℃, grows to one heart stage of two leaves between the cultivation of long day.

1.2 wheat RNA extracts

1) the 30-50mg RNA that very low temperature is freezed is transferred to rapidly in the mortar of using the liquid nitrogen precooling after extracting sample weighing, use pestle tissue abrasion, constantly add liquid nitrogen therebetween, until be ground into powder (not having tangible visible particle) if there be not to grind the yield and the quality that thoroughly can influence RNA.

2) Powdered RNA is extracted sample and carefully and fast transfer in the 2ml centrifuge tube of liquid nitrogen precooling, add an amount of 1.5mlRNAiso Reagent, the concussion mixing, this moment, lysate was transparence, and room temperature left standstill 5 minutes.

3) 12,4 ℃ of 000g are centrifugal 5 minutes.

4) carefully draw supernatant liquor, move in the new 2ml centrifuge tube and (be sure not to draw precipitation).

5) add chloroform (1/5 volume of RNAiso Reagent), cover tight centrifuge tube lid, firmly concussion (the chloroform boiling point is low, volatile, should prevent during vibration that the centrifuge tube lid from flicking suddenly).After treating that fully emulsified solution is milky white shape (no noted phase separation phenomena), room temperature left standstill 5 minutes again.

6) 12,4 ℃ of 000g are centrifugal 15 minutes.

7) the careful centrifuge tube that takes out from whizzer, this moment, homogenate was divided into three layers, that is: colourless supernatant liquor, intermediary white protein layer and have lower floor's organic phase of color.The absorption supernatant liquor is transferred in another new 1.5ml centrifuge tube and (must guard against sucking-off white middle layer).

8) in supernatant liquor, add isopyknic Virahol, behind the abundant mixing of the centrifuge tube that turns upside down, under 15～30 ℃, left standstill 10 minutes.

9) 12,4 ℃ of 000g are centrifugal 10 minutes.Generally after centrifugal, white precipitate can appear in the test tube bottom.

10) careful supernatant discarded, along the ethanol 1ml (being sure not to touch precipitation) of centrifugal tube wall adding 75%, turn upside down gently and wash centrifuge tube tube wall, 12 lentamente, 4 ℃ of 000g carefully discard ethanol (in order to control the salt ion content among the RNA better, the Ex-all ethanol of should trying one's best) after centrifugal 5 minutes.

11) drying at room temperature precipitation 2～5 minutes (cannot centrifugal or heat drying, otherwise RNA will be difficult to dissolving, relevant RNA dissolving can be with reference to the related description among the Troubleshooting), add an amount of RNase-free water dissolution precipitation, available in case of necessity liquid-transfering gun is blown and beaten precipitation gently, treats that RNA precipitation is used for follow-up test after the dissolving fully or in-80 ℃ of preservations.

12) RNA quality examination: a) calculate content and the purity of RNA by the absorption value of measuring OD260, OD280, OD230; B) whether 1% agarose gel electrophoresis detection RNA degrades; C) whether RNA directly carries out PCR and detects and to exist DNA to pollute.

1.3cDNA the rapid amplifying of first chain

1) preparation following template ribonucleic acid/primer mixed solution in the Microtube pipe, full dose 6 μ l.

Template ribonucleic acid (total RNA) 5 μ g

Oligo(dT)18primer(50μM) 1μl

RNase?free?dd?H ₂O Up?to?13.5μl

2) 70 ℃ of insulations after 10 minutes rapidly at chilling on ice more than 2 minutes.

3) the centrifugal several seconds makes the denaturing soln of template ribonucleic acid/primer be gathered in Microtube pipe bottom.

4) the following inverse transcription reaction liquid of preparation in above-mentioned Microtube pipe.

Above-mentioned template ribonucleic acid/primer denaturing soln 13.5 μ l

5×M-MLV?buffer 4μl

DNTP Mixture (each 10 μ M) 1 μ l

RNase?inhibitor(40U/μl) 0.5μl

Rtase?M-MLV(RNase?H-)(200U/μl) 1μl

5) 42 ℃ are incubated 1 hour.

6) 70 ℃ of insulations cooled on ice after 15 minutes, the cDNA solution that obtains can be directly used in the synthetic or pcr amplification of 2nd-Strand cDNA etc., and 1 μ l～5 μ l are used in the suggestion of the usage quantity of cDNA solution during pcr amplification.

1.4tazf13 5 ' and 3 ' end clone

1), obtain partial sequence design two pairs of gene specific primers (sequence is as follows) of tazf13 according to the detected result of gene chip:

tazf13-GSPS：5′GGTACAACAATGCTTGGACG3′

Tazf13-GSPA:5 ' TTGCCTTCAGAAACACTTGC3 ' primer sequence

2) melting No. 3 full-length cDNA libraries with the mountain is masterplate, is the 5 ' sequence of primer amplification tazf13 with primer T3 on the carrier library and tazf13-GSPA, is the 3 ' sequence of primer amplification tazf13 with primer T7 on the carrier library and tazf13-GSPS.

3),, be masterplate amplification total length with the first chain cDNA respectively at initiation codon upstream and termination codon downstream design primer (sequence is as follows) with the splicing of 5 ' and 3 ' terminal sequence.

Primer 1:GGCTTCTGCTAGGATGGAAGACCGT

Primer 2: TAGTTGCTTGATGAGTCTGGCTTAC

1.5tazf13 full-length clone

1) primer sequence: see 1.4 parts.

2) PCR reaction system (20 μ L):

10×buffer 2μl

Template (the first chain cDNA product) 1 μ l

dNTPs(2.0mM?each) 0.5μl

Primer1(5μM) 1μl

Primer2(5μM) 1μl

High-fidelity Taq enzyme (STRATAGEN, Cat No:600380) 0.5 μ l

ddH ₂O 14μl

3) the 3.PCR response procedures is: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 30sec, 55 ℃ of renaturation 30sec, 72 ℃ are extended 1min, circulate 35 times; 72 ℃ are extended 7min.

4) 4. be connected with the T carrier after the recovery of amplified fragments, transformed into escherichia coli, choose positive colony order-checking.The results are shown in Figure 1.

The expression analysis of embodiment 2, tazf13

2.1 coerce down the extraction of RNA

No. 3 and Jinan 177 normal seed germination are melted in the mountain, and the Hoagland nutrient solution is cultured to two leaves, and (about 3 time-of-weeks) begin to carry out arid (18%PEG), salt stress (200mM NaCl) during one heart stage, cold, ABA handles.After handling different time, the Trizol method is extracted the seedling root, leaf RNA is the same.

2.2 reverse transcription obtains cDNA

It is the same that reverse transcription produces cDNA.

2.3PCR reaction and electrophoresis

1) with cDNA is template, carries out the PCR reaction.Primer is as follows:

RT-1：GGTACAACAATGCTTGGACG

RT-2：TTGCCTTCAGAAACACTTGC

2) PCR system:

ddH ₂O 12.6μl

10×Taq?buffer(Mg2+) 2μl

RT-1(5μM) 1μl

RT-2(5μM) 1μl

dNTP(2mM?each) 1μl

Taq?polymerase(5U/μl) 0.2μl

Template (reverse transcription cDNA) 1 μ l

Total?Volume 20μl

3) PCR program:

95℃?5min；25～30cycles?95℃?30s，60℃?30s，72℃?30s；72℃?5min.

Determine the cycle number of PCR according to the amplification situation of confidential reference items Actin, adjust the add-on of cDNA template.

4) 1% agarose gel electrophoresis.The results are shown in Figure 2.

The structure of embodiment 3, dicotyledons expression vector

Plant expression vector pSTART is the binary vector that contains 35S promoter and NPTII gene, contains the recognition site of restriction enzyme XbaI and SmaI on its multiple clone site.The primer that contains XbaI and SmaI recognition sequence in view of the above in the design of goal gene initiation codon upstream and termination codon downstream, with high-fidelity Taq enzymatic amplification goal gene, system is with 1.5.

With restriction enzyme XbaI and SmaI carrier pSTART and goal gene amplified production segment being carried out enzyme respectively cuts.The carrier of complete degestion reclaims through glue after electrophoretic separation on 1% sepharose, links to each other with the goal gene amplified fragments that enzyme is cut.

Enzyme is cut system,

1) plasmid or gene amplification product XbaI and SmaI double digestion

10×Buffer 2μl

Plasmid or gene amplification product 1～2 μ l

XbaI 0.5μl

SmaI 0.5μl

Add ddH ₂O is to cumulative volume 20 μ l

Cut more than 2 hours in 30 ℃ of thermostat water bath enzymes.Enzyme is cut product carry out 1% agarose gel electrophoresis.Under ultraviolet transilluminator, downcut big fragment of pSTART and goal gene band, reclaim with clean blade.

2) carrier segments of cutting through enzyme and target gene fragment are carried out 16 ℃ with 1: 4 ratio of mol ratio and are connected and spend the night.

3) connect product heat shock method transformed into escherichia coli DH5 α competent cell, transformed bacteria on the LB solid plate that contains Kan 50 μ g/ml 37 ℃ cultivated about 16 hours.

4) evaluation of recon

A. the carrier special primer is synthetic

In order to identify the direction of insertion of goal gene, according to carrier special primer of 35S promoter sequences Design, sequence is as follows: GTT GGG GTT TCT ACA GGA CGT

B. the PCR of recombinant plasmid checking

The single bacterium colony of the resistance of picking on the kan substratum is inoculated in 5ml respectively and contains in the LB liquid nutrient medium of Kan 37 ℃ of shaking culture and spend the night, and alkaline denaturation extracts plasmid, carries out pcr amplification, system same 1.5 with the downstream primer of carrier special primer and gene.The PCR reaction conditions is as follows: pre-94 ℃ of 5min of sex change, and 35 circulations are: 94 ℃ of 30sec, 55 ℃ of 30sec, 72 ℃ of 1min, last, 72 ℃ are extended 10min.The PCR product is identified with 1.0% agarose gel electrophoresis.

C. plasmid enzyme restriction is identified

The upgrading grain carries out XbaI and the SmaI enzyme is cut, and it is the same that enzyme is cut system.1% agarose gel electrophoresis detects the fragment that whether contains expection molecular weight size, the correct structure of checking carrier.

The structure of embodiment 4, monocotyledons expression vector

Plant expression vector pCambia3301-bar contains the ubiquitin promoter expression vector, contains the recognition site of restriction enzyme SacI and BamHI on its multiple clone site.The primer that contains SacI and BamHI recognition sequence in view of the above in the design of goal gene initiation codon upstream and termination codon downstream, with high-fidelity Taq enzymatic amplification goal gene, with restriction enzyme SacI and BamHI carrier pCambia3301-bar and goal gene amplified production segment are carried out enzyme respectively and cut.The carrier of complete degestion reclaims through glue after electrophoretic separation on 1% sepharose, links to each other with the goal gene amplified fragments that enzyme is cut.The transformed into escherichia coli competence is carried out PCR with primer tttagccctgccttcatacg on the carrier and gene downstream primer and is identified that carry out enzyme with SacI and BamHI and cut checking, methods involving is with embodiment 3

Embodiment 5, the competent preparation of Agrobacterium and conversion

5.1 the competent preparation of Agrobacterium EHA105

1) goes up the single bacterium colony of picking agrobacterium tumefaciens from YEP flat board (containing 50 μ g/ml Rifampins), be inoculated in and contain 50 μ g/ml

2) in the YEP liquid nutrient medium of Rifampin, 200rpm/min, 28 ℃ of overnight incubation.

3) getting 2ml incubated overnight liquid is inoculated in 50ml and contains in the identical antibiotic YEP liquid nutrient medium and be cultured to OD under the same conditions ₆₀₀Reach 0.5.

4) bacterium liquid ice bath 30min, 4 ℃, the centrifugal 10min of 5000rpm collects thalline.

5) thalline is resuspended among the NaCl of 10ml 0.15mol/L of ice bath centrifugal collection thalline.

6) resuspending is divided in 1.5ml with 200 μ l/ pipes with bacterium liquid in the CaCl2 solution of 1ml 20mmol/L ice precooling

7) in the Eppendorf pipe, put quick-frozen 1min in the liquid nitrogen ,-70 ℃ of preservations are standby.

5.2 freeze-thaw method transforms agrobacterium tumefaciens EHA105

1) at room temperature melts two pipe Agrobacterium competent cells, add 1 μ g expression vector plasmid DNA and 1 μ g empty carrier respectively, ice bath 30min behind the mixing.

2) put liquid nitrogen flash freezer 1min, move to 37 ℃ of temperature rapidly and bathe 3min.

3) the YEP 800 μ l of adding antibiotic-free, 3hr are cultivated in 28 ℃ of concussions.

4) the centrifugal 30s of 7000rpm collects thalline, is applied on the YEP flat board that contains 50 μ g/ml Rifampins, 50 μ g/ml Kan, is inverted dark the cultivation 2-3 days for 28 ℃.

5.3 thalline PCR identifies

Thalline PCR method and program are the same.

Embodiment 6, Arabidopis thaliana transform and screening

6.1 Arabidopis thaliana plantation

Get Arabidopis thaliana (Colombia's wild-type) seed, place in the plate that is lined with filter paper, with the wetting filter paper of a small amount of distilled water, carry out vernalization treatment in 4 ℃ of refrigerators, be seeded in the seedling pan after 3-5 days, be positioned over (16h illumination in the growth cabinet, 22 ℃/8h dark, 18 ℃), 6-8 is after week in growth, treats to be used for when bolting is bloomed to transform.

6.2 Arabidopis thaliana transforms

1) transform the day before yesterday, get 2ml activatory Agrobacterium and be added to and contain in the corresponding antibiotic 200ml YEP substratum, incubated overnight is to OD ₆₀₀=1.0-1.2.

2) centrifugal collection thalline, and be resuspended in the dip-dyeing solution (5% sucrose, 0.04%Silwet L-77), make OD ₆₀₀=0.8.

3) inflorescence was immersed dip-dyeing solution 30 seconds, the swing inflorescence makes and forms a skim on the inflorescence therebetween.

4) cover inflorescence with preservative film, secretly cultivate after one day and throw off preservative film, continue to put growth cabinet and make its growth.

5) contaminated once with identical method again every 5-7 days.

6) gather in the crops seed after about one month.

7) conversion of empty carrier is the same.

6.3 it is screening that Arabidopis thaliana transforms positive strain

1) Shou Huo T0 for seed disinfection after (75% ethanol 5min, detergent wash 10-15min, aseptic water washing 3-5 time), be laid on the MS screening culture medium that contains 50 μ g/mL Kan.

2) 4 ℃ of vernalization 48h move on to culturing room's (16h illumination/8h dark, 22 ℃ of constant temperature) growth 7-10 days.The green seedling of resistance is moved on to continued growth in the soil.

When 3) etc. the most petals of plant have born pods, the plant individual plant has been tied up, so that individual plant is gathered in the crops T1 for seed with marline.

4) repeating step 1)-3), the T1 of individual plant results is continued containing that the enterprising row filter of MS substratum of card for seed, the single independent strain system that inserts that selects the resistance ratio and be 3: 1 transplants, and individual plant results seed obtains T2, continue repeating step 1)-3), no longer separate on that resistance substratum of card for single-strain seed until T2, the T2 that so far obtains isozygotying is used for follow-up further research for plant.The homozygotic screening method of empty carrier is the same.

5) total RNA and the reverse transcription that extracts empty carrier contrast and different transgenic lines synthesizes cDNA.

6) pcr amplification: the first chain cDNA with above-mentioned differing materials is a template, carries out the RT-PCR checking and shows that tazf13 is normal expression in transformed plant.The results are shown in Figure 4.

Embodiment 7, the analysis of commentaries on classics tazf13 arabidopsis thaliana salt-tolerance

7.1 the plant salt resistance is analyzed

1) with the commentaries on classics tazf13 Arabidopis thaliana seed of empty carrier contrast, two strain systems after sterilization (method is the same), the shop is gone into not contain in any MS substratum of coercing composition and is sprouted;

2) seedling that will sprout 7 days is transferred to vertical cultivation in the MS substratum that contains 100mM and 150mM NaCl, observes growth of seedling difference.Not contain any MS substratum of coercing composition is that results of comparison is seen Fig. 5.

7.2 change degeneration-resistant relevant Marker genetic analysis in the tazf13 Arabidopis thaliana seedling

1) Arabidopis thaliana seed disinfection, sprouting, cultivation (method is the same);

2) contrast and transgenic line are untreated and handle the plant of 6h with NaCl, extract total RNA, and reverse transcription forms cDNA, carry out RT-PCR and analyze.Method the results are shown in Figure 5 with embodiment 2.

Embodiment 8, wheat transform and the transfer-gen plant screening

8.1 the sprouting of wheat seed

1) gets full intact wheat seed and sterilize,, use 0.1%HgCl again with 70% alcohol immersion 30sec ₂Soak 15min.Constantly rock seed between soak period, thorough to guarantee surface sterilization, use aseptic water washing 4-5 time then.

2) sterilization back seed is placed in the aseptic culture dish, adds under an amount of sterilized water 15-35 ℃ dark condition and sprouts.

8.2 the conversion of wheat

1) transform the day before yesterday, get 2ml activatory Agrobacterium and be added to and contain in the corresponding antibiotic 200ml YEP substratum, incubated overnight is to OD ₆₀₀=1.0-1.2.

2) centrifugal collection thalline, and be resuspended in the dip-dyeing solution (containing 0.2%AS), make OD ₆₀₀=0.8.

3) coleoptile and the spire of peeling off standby etiolated seedling with blade makes it to expose shoot tip meristem, and slightly dampens its vegetative point cell with dissecting needle point.

4) the thalline dip-dyeing solution for preparing is slowly dripped on the vegetative point top that aseptic seedling is exposed with the 1ml syringe, soak and slowly infiltrate.

5) under the dark condition, temperature is controlled at 17-28 ℃ and cultivates 2-4d altogether, grows young leaves again to the plant top.

6) wash plant off thalline with clear water, be transplanted in the flowerpot that the sterilization vermiculite is housed, keep optimal temperature (18-23 ℃) and humidity, the plant greenhouse pot culture of will surviving at last.

8.3 it is screening that wheat transforms positive strain

1) the CTAB method is extracted the genomic dna of wheat, and carrier primer and gene downstream primer carry out pcr amplification and detect

2) (wherein T1-1 to T1-8 derives from T0-135 to grow seedling after the T1 of positive plant results plants for seed, T1-9 to T1-19 derives from T0-140, T1-20 to T1-25 derives from T0-247, T1-26 to T1-37 derives from T0-248, T1-38 to T1-50 derives from T0-355, T1-51 to T1-54 derives from T0-358, T1-55 to T1-61 derives from T0-425, T1-62 to T1-77 derives from T0-440, T1-78 to T1-93 derives from T0-451, T1-94 to T1-107 derives from T0-549, T1-108 to T1-121 derives from T0-614), proceed genome PCR and detect, to T2 generation (T2-OE1-1 to T2-OE1-1 derives from T1-21, and T2-OE3-1 to T2-OE3-5 derives from T1-91).The results are shown in Figure 6,7,8

3) RNA that extracts wild plant and transfer-gen plant carries out real-time PCR detection, the results are shown in Figure Fig. 9

Embodiment 9, the analysis of commentaries on classics tazf13 wheat salt tolerance

The commentaries on classics tazf13 wheat seed of contrast, two strains system after sterilization (method is the same), is sprouted, be transferred to afterwards in the Hoagland nutrient solution and cultivated 10 days, method sees 1.1;

The seedling that sprouted 10 days is transferred in the Hoagland nutrient solution that contains 150mM NaCl cultivates, observe growth of seedling difference.The results are shown in Figure 10.

Sequence table

＜110〉Shandong University

＜120〉gradually to ooze be response abiotic stress regulatory gene tazf13 and application thereof to wheat

<141>2010-5-10

<160>1

<210>1

<211>819

<212>cDNA

＜213〉wheat

＜221〉gradually to ooze be response abiotic stress regulatory gene tazf13 to wheat

<222>(1)…(819)

<400>1

 

atggcttctg?ctaggatgga?agaccgtgga?gcgttcggga?ccaagaggtc?gcgcaatgac 60

gtgtctgtat?gggagggtga?ctggaattgt?cttcagtgtg?gtaatgtcaa?cttcagtttt 120

agaaatgttt?gcaaccgtgg?agcctgtggt?gcacctcgtc?catcaccgag?tccaagccca 180

agaatgatgc?cagcgctcgc?tggtggtgga?tatgatcggt?cgcctctatt?ttacggtagc 240

actggtgccc?ccccgcctca?cattcctctt?ggatcagcta?gctatggtgc?tccatatccg 300

catgttggaa?tgcggtatgg?ttatggtcca?ccagttggac?ctcatggctc?atatggtctc 360

agttcttatg?gccaacctgg?tccaatgggg?gggatgggtt?atgcccacgg?acctgagttg 420

ggtcgatatg?gacctgagtt?gggtcgatac?ggctatggat?ttagaggatc?tccaatgccg 480

gtttctagcc?catggtctca?tggagcatta?gtggaaaata?ataacagcac?tgcttcacga 540

aagcggcgtg?gaggcccaca?tggactgtct?gagggtgact?gggaatgccc?caagtgtggt 600

aatgtaaatt?ttgccttcag?aaacacttgc?aacatgaaga?aatgtggaga?accaaggccg 660

actcctggag?ctaattcgag?ctcgtcgtct?cgcaaagaca?aagatacccc?agaagggagc 720

tggacctgtc?cggagtgcaa?taacctgaac?taccccttcc?gcacagtgtg?caatcggaaa 780

gggtgctcat?gtagtaagcc?agactcatca?agcaactag 819

Claims (5)

1. One grow wheat gradually to ooze be response abiotic stress regulatory gene tazf13, it is characterized in that: the nucleotide sequence of described gene cDNA is shown in SEQ ID No.1.
2. 2. the plant expression vector pSTART/tazf13 or the pCombin3301-bar/tazf13 that contain the described gene TaZF13 of claim 1.
3. 3. the application of the described gene TaZF13 of claim 1 in cultivating the resisting abiotic stress plant.
4. 4. described plant expression vector pSTART/TaZF13 of claim 2 or the pCombin3301-bar/tazf13 application in cultivating the resisting abiotic stress plant.
5. 5. as claim 3 or 4 described application, it is characterized in that: described plant is common wheat or Arabidopis thaliana.

Images