CN104878026B - Application of the LRK2 genes in improving rice and resisting arid ability - Google Patents

Abstract

A kind of application of the recombinant vector the invention discloses LRK2 genes or containing LRK2 genes in Rice Drought Resistence ability is improved.The nucleotide sequence of LRK2 genes is as shown in SEQ ID NO.1；The amino acid sequence of the expressing protein of LRK2 genes is as shown in SEQ ID NO.2；Recombinant vector containing LRK2 genes is the expression vector obtained by LRK2 genes are inserted in expression vector.Specifically, the recombinant vector is to insert LRK2 genes in pCAMBIA1300S expression vectors, using 2 times of 35S as promoter, using KpnI and SalI as 2 × 35S of expression vector pCAMBIA1300S obtained by restriction enzyme site::LRK2.

Description

Application of the LRK2 genes in improving rice and resisting arid ability

Technical field

The invention belongs to biological technical field, and in particular to a kind of LRK2 genes are in improving rice and resisting arid ability Using.

Background technology

Rice is as one of Three major grain crops in the world, and the world population of nearly half is using rice as staple food.China also has Nearly 65% population is using rice as staple food.But worldwide decrease in precipitation and skewness to the Influence of production of rice very Greatly.Agricultural water accounts for the 68% of national water total amount, and rice water consumption accounts for the sixty percent (Ministry of Agriculture 2008 of Water Consumption in Agriculture Public data).However, mainly due to the skewness of rainfall pattern change and paddy growth season rainfall between year border, drought stress It is still the most important single factor of influence for restricting Rice Production, it is even more so in the remote mountain areas situation away from river. The year two thousand thirty China human mortality is up to 1,600,000,000, and to meet grain demand, agricultural water will have huge breach, and water scarcity will turn into The bottleneck of 21 century China's grain security, China's water resources condition can not support the further development of traditional rice at all.Therefore, Enhancing rice drought tolerance is the active demand for reducing water resources consumption in Rice Production to reduce output, has spy to China Not important meaning.

However, rice drought tolerance is a Comprehensive Traits, it is suitable comprising many aspects such as development, physiology, biochemistry and molecules Answering property changes, such as the change grown of root, the regulation and control of guard cell, infiltration adaptation, photosynthetic change, protectiveness Synthesis of albumen and anti-oxidant albumen etc..The complexity of these regulatory pathways causes that understanding of the people to them is seldom, and they are still It is so the focus studied at present.There is larger interaction in rice drought tolerance, have along with people are understood drought-enduring mechanism with environment Limit, makes the drought-enduring Advances in Breeding of rice slow.But, many genes still are proved to have played important function in drought-enduring, and And experimental determination is shown, the genetic transformation of some of genes can improve paddy drought resistance, such as：In arabidopsis and rice DREB1A is overexpressed, patience of the plant to arid, high salt and low temperature can be improved.This item purpose achievement in research can not only deepen to water The understanding of rice drought-resisting regulating mechanism, and there is important theory and practice directive significance to crop molecular breeding.

Plant richness leucine Receptor-like protein ki-nase (leucine-rich-repeat receptor kinases, LRKs) Be widely present in eucaryote, identified respectively in arabidopsis and rice more than the 216 and 300 of this gene subfamily into Member.LRK plays extensive adjustment effect in growth and development of plants and Resistant reaction, some the receptoroid kinases bases cloned at present Because being mainly derived from arabidopsis, they are respectively in separate living tissue formation, the differentiation of brassinosteroid signal transduction, vascular bundle, organ Important work is played in the bioprocess such as size and morphology Control, cell propagation, somatic embryo generation and plant response to traume With.Rich leucine Receptor-like protein ki-nase is by signal peptide, extracellular rich leucine receptor domain, transmembrane region and intracellular kinase domain 4 Part forms, and these kinases be located on cell membrane, experiences arid, low temperature, high salt and signal caused by growing etc., and swash Downstream signal carrier living, triggers a series of signal transductive process.Such as Hong etc. be separated to from Arabidopsis plant it is a kind of similar The protein kinase gene RPKI of acceptor, it in the root of plant, stem, leaf and can be expressed in spending, and in arid or the high salt side of body Compel lower energy Enhanced expressing.Identified LRK genes are few in number in rice, mainly have：Xa21,Xa26,OsSERK1 Deng most of receptoroid kinase functions are not yet verified in rice.

The content of the invention

The new application of recombinant vector the technical problem to be solved in the present invention is to provide LRK2 genes or containing LRK2 genes.

In order to solve the above-mentioned technical problem, the present invention is provided and realized especially by following technical scheme：

Recombinant vector the invention provides LRK2 genes or containing LRK2 genes is improving the application of Rice Drought Resistence ability.

The nucleotide sequence of described LRK2 genes is as shown in SEQ ID NO.1.

The amino acid sequence of the expressing protein of described LRK2 genes is as shown in SEQ ID NO.2.

The described recombinant vector containing LRK2 genes is to insert described LRK2 genes in expression vector, obtained table Up to carrier.

In the present invention, described application is by described LRK2 channel genes purpose plants, and it is big to obtain drought-resistant ability In the genetically modified plants of the purpose plant.Described LRK2 genes are imported by the recombinant vector containing LRK2 genes In purpose plant.

Molecular cloning reagent：Wizard Plus SV Minipreps DNA Purification System(Promega Biological Co., Ltd), love pursues progress PCR purification kits (love pursue progress Bioisystech Co., Ltd), Shanghai life work glue reclaim reagent Box (Shanghai Sheng Gong Co., Ltds), Efficiency Competent Cells reagent preparation box (Shanghai GeneRay biologies Co., Ltd), PrimeSTAR^TMHS DNA Polymerase (precious bioengineering (Dalian) Co., Ltd), 2 × Taq Master Mix (Nanjing Bo Erdi bio tech ltd), Taq DNA Polymerase (TIANGEN biology (Beijing) Co., Ltd), Trans2K (precious bioengineering (Dalian) is limited for Plus DNA Marker (Quan Shijin Bioisystech Co., Ltd), various restriction enzymes Company and Promega Co., Ltds), T4DNA Ligase (Promega Co., Ltds).Total RNA extraction reagent box RNeasy Plant Mini Kit(QIAGEN)；Reverse Transcriptase kit superscript III Reverse Transcriptase, RNase-Free DNase set(QIAGEN)；Plasmid extraction kit (promega) high-fidelity enzyme primestar Taq (Takara)；Restriction enzyme (Takara/promega) primer synthesizes and determined dna sequence：By Invitrogen (Shanghai) trade Easy Co., Ltd and Shanghai outstanding person Lee's biology Co., Ltd complete.

1st, in the present invention：Paddy DNA extract, can according to Sheu et al. (1996) .Sheu, J.J., Yu, T.S., Tong,W.F.and Yu,S.M.(1996)Carbohydrate starvation stimulates differential expression of rice alpha-amylase genes that is modulated through complicated transcriptional and posttranscriptionalprocesses.J.Biol.Chem.271,26998–27004。

It is for example, following：

(1) take fresh rice leaves to be put in 1.5ml centrifuge tubes, add 200 μ l lysates.

(2) leaf is worn into homogenate as far as possible with grinding rod, beneficial to cracking.

(3) centrifuge tube is put into 65 DEG C of baking ovens and incubates 30min, fully mixed once per 10min.

(4) centrifuge tube is taken out from baking oven, adds 65 μ l 5M KAC solution, gentle mixing of turning upside down, then place In -20 DEG C of ice bath 5min.

(5) 300 μ l chloroforms are added, acutely vibration mixes, and 12000rpm, centrifuges 10min.

(6) the μ l of supernatant about 300 are taken, are added in new sterile 1.5ml centrifuge tubes, add 180 μ l isopropanols, up and down top It is gentle to mix, 10min, 12000rmp are placed at room temperature, centrifuge 5min, it is seen that the fritter sediment (containing DNA) of bottom of the tube, abandon Supernatant.

(7) ethanol of 800 μ l 70% is added, fully mixes, places 10min at room temperature.

(8) 12000rmp, 5min is centrifuged, abandons supernatant, and the ethanol of residual is sucked with pipette tips, centrifuge tube is placed on drying Place, 150-200 μ l PCR H are added after being completely dried in pipe₂O, dissolving DNA, it is stored in -20 DEG C.

2nd, design of primers

Retrieve ncbi database and search rice Nipponbare genome, oryza sativa l. RK2 gene orders are obtained, according to carrier PCAMBIA1300S restriction enzyme site design primer.Primer is as follows：

LRK2-1300-KpnI-F：GTCGGTACCATGCAGCCACCTCATTCTTCATGCAAC；

LRK2-1300-SalI-R：CAGGTCGACTCAGTCGGAGCCTACACTGTCCAG.

3rd, vector construction

Method includes PCR amplifying target genes, the purifying of PCR primer, the extraction of escherichia coli plasmid, digestion, connects, greatly The conversion of enterobacteria, positive bacterium colony PCR identifications, plasmid enzyme restriction identification, sequencing and fungi preservation etc..

LRK2 CDS is cloned from total cDNA using round pcr, design of primers is as above shown in (step 2).With restricted interior Enzyme cutting KpnI and SalI carry out double digestion to genetic fragment and expression vector respectively, and the product after digestion carries out gel extraction respectively (see step 4).Product after recovery is attached, converted, positive clone identification, sequencing and sequence analysis, finally expressed Carrier：pCAMBIA1300S-2×35S::LRK2.

4th, gel extraction

Step mule is operated by Biospin Gel Extraction Kit Cat#BSC02M l, is purified.

(1) with clean, sharp scalpel, the Ago-Gel containing target DNA fragment is cut, and be put into 1.5mL In centrifuge tube.

(2) 1 is pressed:3 (gel quality milligram numbers：Melt glue volume microlitre number) ratio add Extraction Buffer.

(3) in 55 DEG C of warm bath of water bath with thermostatic control, until gel melts.

(4) mixed liquor is transferred completely into Spin column, 1min is centrifuged in 6000rpm/min.

(5) into Spin column, add 500 μ L Extraction Buffer, 1min centrifuged in 12000rpm/min, And discard liquid in adapter.

(6) add 750 μ L Wash Buffer into Spin column, centrifuge 1min in 12000rpm/min, and discard and connect Liquid liquid in pipe.

(7) 1min is centrifuged in 12000rpm/min again, Spin column then are transferred into sterile 1.5mL centrifuges Guan Zhong.

(8) 30 μ L PCR H are added into Spin column₂O stands 5min at room temperature.

(9) target DNA fragment is contained in solution in 12000rpm/min centrifugation 1min, 1.5mL centrifuge tubes.

5th, connect

General to use 4 DEG C, connection, coupled reaction system are as follows overnight：

Reaction system volume (totally 10 μ L)

The μ L of digestion carrier (pCAMBIA1300S-2 × 35S) 1

The μ L of LRK2 genetic fragments 3

10x Ligation Buffer 1μL

T4 DNA Ligase 0.3μL

dd H₂O 4.7μL。

6th, prepared by E. coli competent

(1) bacterial strain is taken, is rule on LB culture mediums, 37 DEG C of overnight incubations.

(2) monoclonal bacterium colony is chosen on LB flat boards, is inoculated in 5mL or so LB fluid nutrient mediums, 37 DEG C, 250rpm Overnight incubation.

(3) by bacterium solution with 1:50 ratio is inoculated in 50mL LB fluid nutrient mediums, 37 DEG C, 250rpm culture 1-2h, directly To bacterium solution OD600 between 0.5-0.6.

(4) bacterium solution is transferred in 50mL centrifuge tubes, precooling 30min.

(5) 4 DEG C, 4000rpm centrifugations 10min.Abandon supernatant.

(6) 5mL SSCS solution, suspension cell are added.

(7) it is dispensed into 1.5mL centrifuge tubes (in advance to the cold), often the μ L of pipe 100.

(8) liquid nitrogen flash freezer, -80 DEG C of preservations are then shifted.

7th, Escherichia coli convert

(1) competence is taken out from -80 DEG C, is melted on ice, connection product is added and gently beaten with rifle, ice bath 30min。

(2) 42 DEG C of thermal shock 90s, are transferred on ice at once.Ice bath 10min.

(3) 500 μ L LB fluid nutrient mediums are added, 37 DEG C of 180rpm cultivate 1h.

(4) it is coated on LB solid mediums and (contains antibiotic), super-clean bench drying.

(5) put upside down in 37 DEG C of biochemical cultivation cases, overnight incubation.

8th, positive clone identification and sequencing

(1) PCR is identified

PCR identifications, 10 μ L systems (as follows) are done with TIANGEN Taq DNA Polymerase.Looked on the flat board of conversion Single bacterium colony, carry out numbering, with 10 μ L pipette tips gently touch single bacterium colony, put and be gently mixed in PCR pipe, as mould Plate.

PCR reaction systems：

DNA profiling 1ul

2x Taq Buffer 1μL

Primer 1(10umol/L)0.5μL

Primer 2(10umol/L)0.5μL

dd H₂O is mended to 10 μ L；

Program：

PCR programs：

(2) digestion is identified

Shake bacterium：The clone that PCR is accredited as the positive is selected, carries out shaking bacterium.Bacterium is connected in LB+Kan fluid nutrient mediums, 37 DEG C, 200rpm incubator overnight cultures.Extraction plasmid (sees below step 9), digestion is carried out with restriction enzyme, with 1% Agarose (TAE) electrophoresis detection, is compareed with the carrier of non-digestion, if two bands occurs in result：One and purpose fragment Size is the same, and one more slightly larger than carrier, illustrates for positive colony.The carrier built is delivered into Shanghai English fine horse biology skill Sequencing portion of art Co., Ltd is sequenced.

Digestion system：

37 DEG C of endonuclease reaction 3hours.

9th, mini-scale plasmid extracts

(1) Escherichia coli bacteria liquid that 1-5mL is incubated overnight.1min, 12000rpm are centrifuged, and remove supernatant.

(2) 250 μ L suspension are added, again suspension cell.

(3) 250 μ L lysates are added, are gently overturned up and down, becomes to liquid and clarifies, add 10 μ alkali proteases, are mixed Uniform.Static 1min.

(4) 350 μ L neutralizers, point to mixed Uniform, centrifugation 10min 12000rpm are added.

(5) supernatant is taken to be transferred to inside pillar, centrifugation 1min 12000rpm.

(6) waste liquid is abandoned, 750 μ L is added and washes paint solution, centrifugation 1min 12000rpm.

(7) 250 μ L of waste liquid addition are abandoned and wash Pan's liquid, repetition (6)-secondary.

(8) by posts transfer into new centrifuge tube, 100 μ L or so PCR H are added₂O, static 5min.Centrifuge 1min, 12000rpm.It is stored in -20 DEG C.

According to 1~step 9 of above-mentioned steps, the recombinant vector containing LRK2 genes is obtained.

Application of the present invention is that in described LRK2 channel genes purpose plants, will obtain drought-resistant ability higher than described The genetically modified plants of purpose plant.

LRK2 genes of the present invention are imported in purpose plant by the recombinant vector containing LRK2 genes.

In application of the present invention, the purpose plant is monocotyledon or dicotyledon, and the unifacial leaf is planted Thing is specially rice.

Method of the present invention is that in described LRK2 channel genes purpose plants, will obtain drought-resistant ability higher than described In the genetically modified plants of purpose plant.

In method of the present invention, described LRK2 genes are imported by the recombinant vector containing LRK2 genes In purpose plant.

In method of the present invention, the recombinant vector containing LRK2 genes is to insert described LRK2 genes In expression vector, obtained expression vector.

Recombinant vector provided by the invention is to insert described LRK2 genes in pCAMBIA1300S expression vectors, with 2 35S again is promoter, using KpnI and SalI as the expression vector obtained by restriction enzyme site.

The present invention utilizes the expression vector agriculture bacillus mediated it is demonstrated experimentally that recombinant vector of the structure containing LRK2 genes Method is transferred in rice Nipponbare, obtains transgenic paddy rice strain, and compared with wild type Nipponbare rice, transgenic paddy rice strain resists Non-irrigated ability increase.

Brief description of the drawings

The embodiment of the present invention is described in further detail below in conjunction with the accompanying drawings.

Fig. 1 is LRK2 overexpression vector structure figures；

(A) positive colony PCR is identified；(B) No. 2 plasmid enzyme restriction identifications；

M：DNA quality standard things；CK：Positive control；U2：No. 2 plasmids of non-digestion；D2:No. 2 plasmids after digestion；

Fig. 2 is positive transgenic plant PCR identifications, and specially LRK2 transgenosis is identified；

M：DNA quality standard things；CK：Positive control；

Fig. 3 is that transfer-gen plant RT-PCR is analyzed, specially LRK2 transfer-gen plants RT-PCR；

Fig. 4 is LRK2 transgenic line situations；

A, LRK2 vector constructions figure；

B, two transgenic lines M2, M6 of blade semi-quantitative analysis LRK2 expression conditions；

C, realtime PCR analyze two transgenic lines M2, M6 LRK2 expression conditions；

LRK2 transgenic lines are overexpressed so as to confirm to have obtained；

Fig. 5 is after 20%PEG simulating droughts are handled 5 days, 12 days 8 days, and transgenic line shows obvious with raising drought resisting Ability；

CK：Nipponbare compares, two transgenic lines of M2, M6；

Fig. 6 is root development situation, i.e. transgenic line is by promoting Rice lateral root development to improve drought-resistant ability；

CK：Nipponbare compares, two transgenic lines of M2, M6；

Left figure is the growing state of aerial part after 8 days after 20%PEG processing, and right figure is root after 8 days after 20%PEG processing Growing state.

Embodiment

With reference to embodiment, the present invention is described further, as described below, is only the preferable implementation to the present invention Example, is not limited the present invention, any person skilled in the art is possibly also with the disclosure above Technology contents be changed to the equivalent embodiment changed on an equal basis.It is every of the invention without departing from the present invention program content, foundation Technical spirit to any simple modification made for any of the above embodiments or equivalent variations, all fall within protection scope of the present invention.

Embodiment 1, carrier construction

1) primer used in carrier construction：

LRK2-1300-KpnI-F：GTCGGTACCATGCAGCCACCTCATTCTTCATGCAAC；

LRK2-1300-SalI-R：CAGGTCGACTCAGTCGGAGCCTACACTGTCCAG；

2) recombinant vector

The acquisition of A.LRK2 genes：

1. rice total dna is extracted, as above described in step 1.

2. using DNA as template, LRK2-1300-KpnI-F and LRK2-1300-SalI-R is primer, and PCR expands LRK2 bases Because of segment.

PCR system：

B. structure figure as shown in figure 1,

1. PCR amplification genes segment (as above)；

2. PCR primer reclaims；

3. pCAMBIA1300S carriers and gene segment digestion；

Digestion system：

37 DEG C of endonuclease reaction 3hours.

4. digestion products gel extraction (ibid, gives birth to work glue reclaim kit) using Shanghai；

5. connect；

Linked system：

4 DEG C of overnight coupled reactions.

6. convert (as above step 7)；

7. positive bacterium colony PCR identifications；

PCR system：

PCR programs：

LRK2-1165-F agctgtcatcagaaataggcaag

LRK2-1884-R aagttcaggctattcagttcacc

8. shake bacterium extraction plasmid (as above step 9)；

9. digestion is identified；

Digestion system：

37 DEG C of endonuclease reaction 3hours.

10., Song Ying fine horses company sequencing.See gene order.

The acquisition and identification of embodiment 2, transgenic paddy rice

1st, prepared by Agrobacterium competence

(1) -80 DEG C of taking-up GV3101 bacterial strain, rules on the LB culture medium flat plates added with 50Hg/mLRif, 28 DEG C of cultures 2d。

(2) picking monoclonal 1-10, it is inoculated in the LB fluid nutrient mediums that 250mL contains 50 μ g/mLRif,

18 DEG C of culture is cultivated to OD_=0.6.

(3) 4 DEG C of centrifugations 15min, 5000rpm, abandon supernatant.

(4) 250mL PCR H are added₂O (in advance to the cold), 4 DEG C of centrifugations 15min, 5000rpm, abandons supernatant.

(5) 125mL PCR H are added₂O (in advance to the cold), 4 DEG C of centrifugations 15min, 5000rpm, abandons supernatant.

(6) 50mLPCR H are added₂O (in advance to the cold), 4 DEG C of centrifugations 15niin, 5000rpm, abandons supernatant.

(7) glycerine of 25mL 10% (in advance to the cold) is added, 4 DEG C of centrifugations 15min, 5000rpm, abandons supernatant.

(8) 5mL10% glycerine (in advance to the cold), packing 50 μ L/ pipes are added.

(9) liquid nitrogen flash freezer, -80 DEG C of preservations.

2nd, the electric shocking method conversion of Agrobacterium：

(1) -80 DEG C of taking-up competence, melts on ice.Add 1 μ L plasmids to be transformed.

(2) after mixing, it is added in the electric shock cup of precooling, does shock treatment.

(3) in the cup that shocks by electricity add 1mL precoolings LB fluid nutrient mediums, then displace electric shock after product, 28 DEG C 120rpm cultivates 1.5h.

(4) it is coated on the LB solid mediums containing corresponding antibiotic.28 DEG C of biochemical cultivation case 2d.

3rd, the acquisition of transgenic paddy rice

Rice acceptor：Nipponbare.

Required culture medium (liquid)：

Mature embryo callus induction culture medium：NB+2mg/L 2,4-D, pH=5.8, plant gel 3g/L；

Agrobacterium activation medium：YEP, pH=7.0；

Agrobacterium expands culture medium：YEB+200 μM of AS, pH=7.0；

Agrobacterium, which suspends, infects liquid：NB+2mg/L 2,4-D+200 μM of AS, pH=5.4；

Callus co-cultures culture medium with Agrobacterium：NB+2mg/L 2,4-D+200 μM of AS, pH=5.4, plant gel 3g/ L；

Transgenosis callus screening and culturing medium：NB+2mg/L 2,4-D+500mg/L Cef+150mg/L G418 or 50mg/L Hyg, pH=5.8, plant gel 3g/L；

Transgenosis callus differential medium：MS+0.5mg/L NAA+2mg/L 6-BA+0.5mg/L KT+75mg/L G418 Or 25mg/L Hyg+125mg/L Cef, pH=5.8, plant gel 3g/L；

Tissue culture regeneration seedling rooting culture medium：1/2MS+35mg/L G418 or 15mg/L Hyg+50mg/L Cef, pH= 5.8 plant gel 1.5g/L.

Operating procedure (needs sterile working)：

1. choose full bright and clean rice Nipponbare mature embryo, mechanical dejacketing, hypochlorite disinfectant 40min, uniform shakedown On mature embryo callus induction culture medium, about ten days or so, callus generated from embryo position, fine and close hard；

2. removing radicle and endosperm, callus is transferred on new callus culture medium and continues to cultivate, one week or so, callus life Length is vigorous, fine and close, dissipates and is layered on culture medium into irregular shape；

3. by Agrobacterium (EHA105) the YEP culture medium activation cultures containing purposeful plasmid vector, YEB is then inoculated in Culture medium expands overnight incubation, when bacterium solution OD600nm values reach 0.6-0.8,4 DEG C, 5000rpm, centrifuges 10min, collects bacterium Body cell, supernatant is abandoned, then add Agrobacterium and suspend and infect liquid, vibration makes the abundant respin of somatic cells, by agrobacterium suspension Go in sterile conical flask, shaking table 100rpm, cultivate 2h；

4. callus is placed in agrobacterium suspension, after shaking table 100rpm, 20min, then static 10min, callus group is pulled out Knit, be positioned on aseptic filter paper, draw excessive moisture, about 30min, pour into co-cultivation culture medium；

5. callus co-cultures 2-3d with Agrobacterium, callus is taken off into bacterium number time with the sterile water wash containing 500mg/L Cef Until liquid is limpid, shaking table slight oscillatory can be used during cleaning, is positioned on aseptic filter paper and dries after de- bacterium, draw superfluous water Point, then be equably layered on the screening and culturing medium containing corresponding antibiotic and screen, about one week or so, there is browning in callus, together When also grow kanamycin-resistant callus tissue, whole screening lasts about 30 days；

6. shifting the callus that newly grows to differential medium, after a couple of days, callus growth is vigorous, and starts green point occur；

7. the position of callus greening gradually differentiates seedling and gradually grown up, but general unrooted；

8. the seedling differentiated is transferred in the long bottle of glass equipped with root media and carries out culture of rootage, after a couple of days i.e. It can take root；

9. treating that seedling survives, and after riotous growth, the capping of vial is opened, and pour into a little sterilized water hardening；

10. finally taking out the tissue culture regeneration seedling survived, the culture medium of root is cleaned, is inserted in rice nutrition liquid and continues Culture.

4th, transgenic positive plant is identified

Operated according to TIANGEN Taq DNA Polymerase specifications.

According to carrier pBI121::Gus gene primers (table 1) on GUS.Use GUS-pBI121-BamHI-F With GUS-499-R or GUS-545-F and GUS-pBI121-PstI-R, using tissue culture regeneration seedling DNA as template, and with non-transgenosis Rice Nipponbare DNA makees negative control, enters performing PCR amplification.PCR programs are：94 DEG C of pre-degeneration 3min；94 DEG C denaturation 30s, 55 DEG C Anneal 30s, 72 DEG C of extension 50s, repeats 35 circulations；72 DEG C of fully extension 5min；Reaction terminates rear electrophoresis detection PCR primer.

Table 1 is according to the primer of gus gene sequences Design

Using agriculture bacillus mediated transgenic technology, gene overexpression vector is transferred to rice Nipponbare.The group obtained Regeneration plant extraction leaf texture DNA is trained, with carrier pCambia1300 hygromycin phosphotransferase gene specific primers Hyg- 1300-301- and Hyg-1300-741-R (being shown in Table 2) enters performing PCR, and negative control is non-transgenic rice Nipponbare leaf texture DNA.Electrophoresis detection PCR primer, most of regrowths can amplify and be expected band (about 400bp) of the same size, rather than Transfer-gen plant does not amplify respective strap then, and part electrophoresis result is as shown in Figure 2.Analyze the band light and shade of different strains not Caused by one the reason for, is probably PCR reaction templates DNA addition difference.

Table 2

Remarks explanation：

LRK2-1165-F, LRK2-1884-R are used for the identification of transgenic positive plant.

OsActin-2-F, OsActin-2-R are used for reference gene when sxemiquantitative is identified.

LRK2-1165-F	AGCTGTCATCAGAAATAGGCAAG
		LRK2-1884-R	AAGTTCAGGCTATTCAGTTCACC
OsActin-2-F	GGAACTGGTATGGTCAAGGC
		OsActin-2-R	AGTCTCATGGATACCCGCAG

In the present invention, two higher strains of LRK2 expression quantity are selected, labeled as M2, M6.

Embodiment 3,

The related experiment reagent and step of simulating drought processing：

Conventional medication：CaCl₂Purchased from Jinhua Pharmaceuticals Ltd；PEG6000 is purchased from Sigm companies.

PEG600020% solution：400gPEG6000 is weighed, adds running water into 2L graduated cylinders, is put into 65 DEG C of baking oven dissolvings 3-6 hours, and stir to being completely dissolved, save backup at room temperature.

1M CaCl₂Solution：Weigh the anhydrous CaCl of 111g₂It is dissolved into appropriate amount of deionized water, is settled to 1000mL.

Experimental method

Choose full wild type Nipponbare and overexpression transgenic line (M2, M6) rice paddy seed progress rice drought is non- The experiment of biotic, Nipponbare seed is as a control group.

1. seed is carried out into surface sterilization (70% alcohol 10min, 10%NaClO 30min), rinsed several times with running water, 4 DEG C of vernalization 3-5d；

2. seed is placed in into vernalization (changing water daily) in 37 DEG C of incubators, show money or valuables one carries unintentionally within 3 days or so；

3. the seed to show money or valuables one carries unintentionally is inserted on 96 orifice plates with tweezers and (is cut aperture below and supply rice absorbing moisture) and carries out mark Note, is placed in 0.1mM CaCl₂In solution and move into water planting 3-4 days in illumination box.Specific condition of culture：Illumination, 28 DEG C, 16h；Dark, 25 DEG C, 8h；

4. when young rice seedlings growth (root long about 3-4cm) in order, the more consistent seedling 15-20 strains of growing way are chosen, point Do not insert on 96 orifice plates in 4*5 hole, be positioned over rice and take root and cultivate in bottle；

5. the PEG6000 solution of various stress optimum concentrations is added in bottle and adds 0.1mM CaCl₂Solution

Each rice seedling aerial part and root long and taken pictures 6. the record processing date, before measurement processing, be put in illumination cultivation Water planting in case.Specific condition of culture：Illumination, 28 DEG C, 16h；Dark, 25 DEG C, 8h；Observation rice seedling is paid attention to during Stress treatment Character mutation, while pay attention to level change in blake bottle, add in time corresponding Stress treatment liquid (PEG6000 solution) and CaCl₂Solution；

7. after pending a period of time, when experimental group goes out more significant difference with control group Phenotypic Expression, record date is simultaneously clapped According to.

Specific such as Fig. 5,6, according to the figure, we can learn：Under identical simulating drought condition of culture, LRK2 is overexpressed Strain M2, M6 have the stronger ability for resisting arid.

Finally, it is also necessary to it is noted that listed above is only several specific embodiments of the invention.Obviously, this hair It is bright to be not limited to above example, there can also be many deformations.One of ordinary skill in the art can be from present disclosure All deformations for directly exporting or associating, are considered as protection scope of the present invention.

Claims (2)

1.LRK2 genes or application of the recombinant vector in Rice Drought Resistence ability is improved containing LRK2 genes, it is characterised in that： By promoting Rice lateral root development to improve drought-resistant ability；

The nucleotide sequence of described LRK2 genes is as shown in SEQ ID NO.1；

The amino acid sequence of the expressing protein of described LRK2 genes is as shown in SEQ ID NO.2；

The described recombinant vector containing LRK2 genes is the expression obtained by described LRK2 genes are inserted in expression vector Carrier.

2. LRK2 genes according to claim 1 or recombinant vector containing LRK2 genes are in Rice Drought Resistence ability is improved Application, it is characterised in that：The recombinant vector is to insert described LRK2 genes in pCAMBIA1300S expression vectors, with 2 times of 35S is promoter, using KpnI and SalI as expression vector pCAMBIA1300S-2 × 35S obtained by restriction enzyme site:: LRK2。