CN116144700A - Application of rice OsbZIP53 gene or protein encoded by rice OsbZIP53 gene in improving rice yield - Google Patents

Abstract

The invention discloses application of a rice OsbZIP53 gene or a protein encoded by the gene in improving rice yield, and relates to the technical field of bioengineering. Compared with wild plants, the grain length, grain width and thousand grain weight of the transgenic rice are increased by knocking out the OsbZIP53 gene in the rice; and the OsbZIP53 gene is overexpressed in rice, so that the grain length, grain width and thousand grain weight of the rice are reduced, and the OsbZIP53 gene can regulate and control the grain type and yield of the rice and has the potential of production and application.

Description

Application of rice OsbZIP53 gene or protein encoded by rice OsbZIP53 gene in improving rice yield

Technical Field

The invention relates to the technical field of bioengineering, in particular to application of a rice OsbZIP53 gene or a protein encoded by the gene in improving rice yield.

Background

In the biological processes of dormancy and germination of seeds, growth and development of plants, biological and abiotic stress responses and the like, different genes generally have different space-time expression specificities and stress induction responses, and the expression of the genes is accurately regulated and controlled by transcription factors. The basic leucine zipper (basic leucine zipper, bZIP) protein is an important transcription factor, is widely distributed in plants and participates in regulating various biological processes.

Grain weight is an important property for determining rice yield, and the transcription factor OsbZIP47 is involved in regulating the size and weight of rice grains. Transgenic plants overexpressing OsbZIP47 had elongated kernels, while OsbZIP47 mutant kernels widened. Research shows that the CC-type glutaredoxin WG1 can directly interact with the OsbZIP47 and recruit a transcription co-inhibitor ASP1 to inhibit the transcription activity of the OsbZIP 47; whereas E3 ubiquitin ligase GW2 ubiquitinates WG1 and regulates the protein stability of WG 1. Thus, GW2-WG1-OsbZIP47 forms a pathway regulating rice seed development (Hao J Q, wang D K, wu Y B, et a1.The GW2-WG1-OsbZIP47 pathway controls grain size and weight in rice [ J ]. Molecular Plant,2021, 14 (8): 1266-1280.). RISBZ1 (i.e., osbZIP 58) plays an important role in rice filling, affecting free lysine content in seeds and storage protein accumulation. It has also been found that OsbZIP58 is capable of regulating expression of six starch synthesis genes OsAGPL3, wx, osSSIIa, SBE1, osBEIIb and ISA2 by directly combining with their promoters, thereby regulating starch biosynthesis in rice endosperm. Mutant osbZIP58 seeds have abnormal morphology, reduced total starch and amylose content, higher short-chain ratio and lower medium-chain ratio of amylopectin (Wang J C, xu H, zhu Y, liu Q, et al OsbZIP58, a basic leucine zipper transcription factor, regulates starch biosynthesis in rice endosperm [ J ]. Journal of Experimental Botany,2013, 64 (11): 3453-3466.). In addition, zinc finger protein OsLOL1 interacts with OsbZIP58 and activates expression of kaurene oxidase gene OsKO2 through OsbZIP58, affecting GA biosynthesis, thereby promoting endosperm aleurone layer cell apoptosis (programmed cell death, PCD) and seed germination. OsbZIP76 has no transcriptional activation activity, but can interact with nuclear factor Y family transcription factors OsNF-YB1 and OsNF-YB9 respectively, regulate development of rice endosperm and participate in accumulation of stored substances together. The endosperm cells of the mutant osbZIP76 progress earlier and exhibited phenotypes similar to osnf-yb1, such as reduced grain size and reduced amylose content (Niu B, deng H, li T, et al OsbZIP76 interacts with OsNF-YBs and regulates endosperm cellularization in rice (Oryza sativa) [ J ]. Journal of Integrative Plant Biology,2020, 62 (12): 1983-1996.).

Several members of the basic leucine zipper family have been reported to be involved in regulating grain size and weight, while OsbZIP53 has not been reported to regulate rice grain type and grain weight.

Disclosure of Invention

The invention provides application of a rice alkaline leucine zipper protein family transcription factor OsbZIP53. In particular to application of rice OsbZIP53 gene or coded protein thereof in improving rice yield. The nucleotide sequence of the rice OsbZIP53 protein coding gene OsbZIP53 is shown as SEQ ID NO. 1.The constructed plant overexpression vector pCubi1390-OsbZIP53 is expressed in wild type Japanese sunny, and the rice grain length and thousand seed weight of a T3 generation plant of a transgenic plant are found to be obviously reduced compared with the corresponding indexes of the wild type plant, while the rice grain length and thousand seed weight of a T3 generation plant line of an OsbZIP53 gene CRISPR editing line are obviously increased compared with the corresponding indexes of the wild type plant. Therefore, the rice OsbZIP53 protein coding gene OsbZIP53 is a potential target point which can be used as a target point for improving rice yield in genetic engineering, and has important application value.

The specific technical scheme is as follows:

the invention provides application of a rice OsbZIP53 gene or a coded protein thereof in improving rice yield.

The invention also provides application of the rice OsbZIP53 gene or the encoded protein thereof in regulating and controlling grain length, grain width and grain weight of rice grains.

The nucleotide sequence of the CDs region of the OsbZIP53 gene is shown as SEQ ID NO.2, and the amino acid sequence of the protein encoded by the OsbZIP53 gene is shown as SEQ ID NO. 3.

The invention also provides a method for improving the yield of rice, and OsbZIP53 gene is silenced or knocked out in rice crops. The nucleotide sequence of the CDs region of the OsbZIP53 gene is shown as SEQ ID NO. 2.

Specifically, the method comprises the following steps:

(1) Constructing an OsbZIP53 gene silencing or knockout vector;

(2) Introducing the OsbZIP53 gene silencing or knocking-out vector constructed in the step (1) into a rice cell, silencing or knocking-out the OsbZIP53 gene with a CDs region nucleotide sequence shown as SEQ ID NO.1, and culturing to obtain a transgenic plant.

Preferably, the vector is pCAMBIA1300.

When the recipient plant is transformed, an agrobacterium-mediated transformation method can be adopted, and the agrobacterium genetic engineering bacteria can be an agrobacterium EHA105 strain. And (2) transferring the OsbZIP53 gene silencing or knockout vector into agrobacterium genetic engineering bacteria to infect rice cells.

The recipient plant is rice. The variety of the rice may be japonica rice Nipponbare (Nipponbare) or medium flower 11 (ZH 11), but is not limited to Nipponbare or medium flower 11.

Preferably, the source of agrobacterium-infected cells is rice seed-induced callus. In addition to rice seed-induced callus, tissue sample-induced callus obtained from rice plants, or other means of growing plants after transgenesis, are also contemplated.

The invention has the beneficial effects that:

compared with wild plants, the grain length, grain width and thousand grain weight of the transgenic rice are increased by knocking out the OsbZIP53 gene in the rice; and the OsbZIP53 gene is overexpressed in rice, so that the grain length, grain width and thousand grain weight of the rice are reduced, and the OsbZIP53 gene can regulate and control the grain type and yield of the rice and has the potential of production and application.

Drawings

FIG. 1 is a graph of identification of hygromycin by transgenic lines, wherein CK-: wild type strain of Japanese sunny; CK+: a hygromycin-containing gene vector.

FIG. 2 is a diagram showing the gene structure of the OsbZIP53 gene and the mutation type of the knockout mutant.

FIG. 3 is a graph showing the expression level of OsbZIP53 gene in an over-expressed strain, wherein p < 0.01.

FIG. 4 is a graph of expression pattern analysis (B) and subcellular localization (A).

FIG. 5 is a graph of the granulometry and thousand kernel weight of OsbZIP53 gene knockout (A) and over-expression (B) strains.

Detailed Description

Example 1

CRISPR/Cas9 knockout vector construction

According to the genomic sequence (sequence is shown as SEQ ID NO. 1) of OsbZIP53 (LOC_Os 06g 50310) provided by the RiceData (ricedata= rice gene database) website, a target site containing NGG (PAM) with higher specificity is selected through the CRISPR-P (http:// CRISPR. Hzau. Edu. Cn /) website. To reduce off-target effects, the specificity of the target site sequence was detected using Gramene (http:// www.gramene.org /) website. Finally, determining a target site sequence (ACAGCGGCACGGTTACCCGA) positioned on an exon of the OsbZIP53 gene as an editing target, designing a primer OsbZIP53-CasF/R, and constructing a vector. Vectors and methods for use are described in references (MA X L, ZHANG Q Y, ZHU Q L, et al 2015.A Robust CRISPR/Cas9 System for Convenient, high-Efficiency Multiplex Genome Editing in Monocot and Dicot plants. Molecular plant,8 (8): 1274-1284.DOI: 10.1016/j.molp.2015.04.007.).

The primer sequences were as follows:

OsbZIP53-CasF：GGCACAGCGGCACGGTTACCCGA：

OsbZIP53-CasR：AAACTCGGGTAACCGTGCCGCTG。

2. construction of overexpression vector

An OsbZIP53 overexpression vector was constructed using the plant binary expression plasmid pCAMBIA1300-UBI (vast organism). The primer OsbZIP53-OX-F/R is designed, cDNA of Japanese sunny is used as a template, and the full-length CDS sequence of the OsbZIP53 gene is amplified (the nucleotide sequence is shown as SEQ ID NO.2, and the amino acid sequence of the coded protein is shown as SEQ ID NO. 3). Simultaneously, the pCAMBIA1300-UBI vector is digested by KpnI and PstI, a linearization fragment is obtained after recovery, and the full-length CDS of the OsbZIP53 is connected with the linearization vector by using T4 ligase. And (3) enzyme digestion and sequencing verification to obtain a correct over-expression vector: pCAMBIA1300-UBI-OsbZIP53. Transforming pCAMBIA1300-UBI-OsbZIP53 into Agrobacterium tumefaciens EHA105 to obtain pCAMBIA1300-UBI-OsbZIP53 agrobacterium tumefaciens bacterial liquid.

The primer sequences were as follows:

OsbZIP53-OX-F：GGTACCATGGATGACGGGGACCTCGAT；

OsbZIP53-OX-R：CTGCAGTCATTTCTTTTCAGAATTTG。

3. construction of OsbZIP53 over-expression strain by agrobacterium transformation method

In order to obtain the knockout and over-expression material of the OsbZIP53, an agrobacterium-mediated genetic transformation method is adopted, the OsbZIP53 over-expression vector is transferred into a wild type Japanese sunny (Nip) variety, and the OsbZIP53 knockout vector is transferred into a wild type Zhonghua 11 (ZH 11) variety. The specific operation steps are as follows:

1) Rice callus culture: about 20g of mature and full seeds are selected and husked. In the super clean bench, the solution is washed twice with sterile water. Soaking in 75% ethanol for 2min, cleaning the seeds with sterile water for 2 times, and sterilizing once. Adding sodium hypochlorite disinfectant to soak the seeds, and sealing and placing the seeds on a shaking table to shake for 20min. Then cleaning the mixture on an ultra-clean bench with sterile water until no foam exists. The sterilized seeds are placed on sterile filter paper, and the surface moisture is dried in an ultra clean bench. And uniformly spreading the seeds on an N6B5 culture medium by using sterilized tweezers, and culturing in a dark room at 28 ℃. In order to reduce the seed contamination rate, care should be taken not to contaminate the culture medium with bacteria throughout the operation.

2) Agrobacteria-infected callus: and respectively transferring the plasmid containing the knocked-out, over-expressed and sGFP fusion tag into agrobacterium, and centrifugally collecting the cultured bacterial liquid. The cells were resuspended with PHI suspension. Adjusting the concentration to OD ₆₀₀ 0.08-0.1. Acetosyringone (As) was added at 0.2% (v/v). Collecting callus with good growth state, placing into a sterile culture flask, adding about 40mL of prepared PHI agrobacterium suspension, standing at room temperature for 20min, and shaking every 5min. Pouring out the suspension, placing the callus on sterile paper, and placing on an ultra clean bench to blow dry. Finally, transferring the callus to a culture dish filled with new sterile paper, sealing with a sealing film, and placing in a darkroom environment at 19 ℃ for 3 days.

3) Resistant callus screening: the co-cultured calli described above were transferred to N6B5 selection medium containing 500mg/L cefotaxime, 400mg/L carbenicillin and 50mg/L hygromycin.

4) Differentiation and rooting: most of the calli were browned about 10 days after screening and transferred to differentiation medium containing 50mg/L hygromycin B and 250mg/L carbenicillin. Seedlings growing about 2cm on the differentiation medium were transferred to rooting medium containing 50mg/L hygromycin B and 200mg/L carbenicillin. All of the above operations were performed in a sterile super clean bench.

5) Strengthening seedlings and transplanting: culturing for about two weeks, selecting young seedling with a height of about 10 cm and developed root system, washing the culture medium with warm water, and transplanting to a greenhouse.

The OsbZIP53 over-expressed strain was PCR-detected with hygromycin primers (hygF/hygR). The results show that 7 hygromycin is identified as positive in 13 randomly selected transgenic plants, and preliminary shows that the pCAMBIA1300-UBI-OsbZIP53 over-expression vector has been successfully transferred into rice plants (figure 1).

The primer sequences were as follows:

hygF：5′-GTGCTTGACATTGGGGAGTT-3′；

hygR：5′-GATGTTGGCGACCTCGTATT-3′。

28 OsbZIP53 knockout transgenic lines are obtained through CRISPR/Cas9 technology, 27 positive lines are detected through amplifying hygromycin gene fragments (primer hygF/hygR) (figure 2), target fragments containing target sites are amplified through primers Cr-bZIP53-F/R for knockout type detection after multiple generations of planting, and two homozygous OsbZIP53 knockout lines are obtained: the insertion base (+C) is named Cr-OsbZIP53-1, and the deletion base C (-C) is named Cr-OsbZIP 53-2.

The primer sequences were as follows:

Cr-bZIP53-F：5′-CCTCAAGGATACGGAGCACC-3′；

Cr-bZIP53-R：5′AAAGTCACAGGAGTTCATAA-3′。

example 2

Identification of the OsbZIP53 expression level of the over-expression strain.

Collecting hygromycin positive transgene T0 water substituteAnd (3) planting seeds of rice plants in fields for 5-10 months in 2022 to form a T2 generation plant line, extracting total RNA from young leaves when the rice is in a tillering stage, and performing reverse transcription to form cDNA for qRT-PCR (same as above). And detecting the expression condition of the OsbZIP53 gene in different T2 generation rice strains by adopting qRT-53F and qRT-53R primers. The qRT-PCR reagent was PowerUpTMSYBRTMGreen Master Mix and the PCR instrument was Thermal Cycle Dice Real Time System. Takes an action gene as an internal reference, adopts 2 ^-ΔΔCT The relative expression level of the target gene was measured by the method. Three biological replicates were performed. The results show that the expression level of the OsbZIP53 gene of the transgenic line No. Ox-OsbZIP53-7 in the T2 generation transgenic line is obviously higher than that of the OsbZIP53 gene in the wild type line, and the transgenic line is an OsbZIP53 over-expression line (figure 3).

The primer sequences were as follows:

qRT-53F：CTGGAGGAGGAGGTTGTTCA；

qRT-53R：TGAACAACCTCCTCCTCCAG。

example 3

Subcellular localization of gene OsbZIP53.

To explore subcellular localization of OsbZIP53, the present experiment constructed the full length of OsbZIP53 CDS on vector pAN580 (BioVector plasmid vector strain cell protein antibody gene collection-NTCC classical culture collection) with Green Fluorescent Protein (GFP) tag, namely OsbZIP53-pAN580-GFP. The control blank vectors Empty-pAN580-GFP and OsbZIP53-pAN580-GFP were transiently expressed in rice protoplasts, respectively. The experiment locates the nuclei of the Marker: the pCFP-Ghd7 plasmid was co-transferred with the OsbZIP53-pAN580-GFP vector plasmid into rice protoplasts as a positive control. pCFP-Ghd7 plasmid sources and construction see (Gao H, jin MN, zheng XM (2014) Days to head 7, a major)

titative locus determining photoperiod sensitivity and regional adaptation in rice.Proc Natl Acad Sci USA.111(51)：16337-16342.)。

1) Preparing rice seedling, shading for about 10 days, collecting leaves, and standing in ddH adding condition ₂ O on a petri dish.

2) Root and leaf were removed and the remaining seedlings were cut into fine pieces.

3) The minced fragments were transferred to a 50mL small conical flask, and a 0.6M concentration mannitol solution was poured into the conical flask, wrapped with tinfoil paper, and allowed to stand for 15min.

4) Mannitol is filtered by a screen, filter residues are put back into an original conical flask, 20mL of newly prepared enzymolysis liquid (added with carbenicillin) is added, and the mixture is shaken for 4 to 6 hours at 28 ℃ and 80rpm in the dark.

5) Filtering the enzymolysis liquid, collecting filter residues into an original conical flask, adding 15mL of W5 (adding carbenicillin) and shaking for about 10s, filtering and collecting protoplasts in a new 50mL centrifuge tube. This step was repeated 2-3 times. The collected protoplast was placed in a centrifuge at 1500rpm and centrifuged for 5min to collect the protoplast, and the supernatant was discarded.

6) The W5 solution was poured into the collected protoplasts, approximately 15mL, gently mixed, placed in a centrifuge, and centrifuged at 1500rpm for 5min. The supernatant was discarded, the operation was repeated 2 times, and the washing was continued as required by the experiment.

7) The protoplasts were resuspended by adding an appropriate amount of W5 solution (0.8-1.5 mL).

8) Sequentially adding 10 mu L of plasmid and 100 mu L of protoplast into a centrifuge tube, lightly flicking the bottom of the tube, mixing, adding 100 mu L of newly prepared PEG4000 solution, mixing the bottom of the flick tube, and standing for half an hour at room temperature.

9) Adding 450 mu L W5 solution, gently flicking the tube wall, mixing, centrifuging at 1500rpm for 3min, collecting protoplast, gently sucking the supernatant with the gun head, and keeping the gun head from touching the protoplast.

101 mL of the W5 solution was added to gently flick and the protoplasts were mixed. Placing in a darkroom at 28deg.C, and standing for about 24 hr.

11 1500rpm, centrifuged for 1min, the supernatant discarded, leaving 100 μl for subsequent experimental observations.

Experimental results showed that OsbZIP53 was expressed in both the nucleus and cytoplasm, and was localized mainly in the nucleus (fig. 4A).

Example 4

Expression characteristics of the gene OsbZIP53 in different organs of rice.

Extracting RNA of rice roots (35 days), stems (35 days), leaf sheaths (35 days), leaves (35 days), young ears (5-8 cm) and grouted seeds (12 days), and reversely transcribing into cDNA for qRT-PCR analysis. The specific operation method is the same as in example 1.The rice constitutive expression genes Actin (ActinF and ActinR) are taken as internal references, cDNA templates from different rice tissues are amplified by adopting qRT-53F and qRT-53R primers, and the expression condition of the OsbZIP53 gene in different tissues is detected. The results showed that OsbZIP53 was constitutively expressed and the expression level in grouted rice seeds was significantly higher than that in other tissues (fig. 4B).

The primer sequences were as follows:

ActinF：GAAATGGAGACTGCCAAGACC；

ActinR：TTGGCAATCCACATCTGCTG。

example 5

And (5) researching phenotypic characters.

The T2 generation transgenic strain is planted in a field environment in 5-10 months, and conventional sunlight and water and fertilizer management is performed. To maturity, 10 strains of wild type Nippon plants (Nip) and OsbZIP53 overexpressing strain (designated OsbZIP 53_OE) were collected, and grain length, grain width and thousand kernel weight were counted (FIG. 5); 10 strains of wild type medium flower 11 strain (ZH 11) and OsbZIP53 knockout strain (designated OsbZIP 53_CR) were collected, and the grain length, grain width and thousand kernel weight were counted (FIG. 5). The results showed that both the grain length and grain width of the OsbZIP 53-CR strain were greater than that of the wild-type strain (fig. 5A); the OsbZIP53_oe strain had a smaller grain length than the wild-type strain and a slightly smaller grain width than the wild-type strain (fig. 5B). In addition, the thousand seed weight of the OsbZIP53_cr strain was increased compared to the wild-type middle flower 11 strain (fig. 5A), and the thousand seed weight of the OsbZIP53_oe strain was decreased compared to the wild-type japan strain (fig. 5A). The OsbZIP53 can regulate rice grain type and yield, and has potential for production and application.

Claims (9)

1. Application of rice OsbZIP53 gene or coded protein thereof in improving rice yield.

2. Application of rice OsbZIP53 gene or protein encoded by the gene in regulation of grain length, grain width and grain weight of rice grains.

3. The use according to claim 1 or claim 1, wherein the nucleotide sequence of the CDs region of the OsbZIP53 gene is shown in SEQ ID No.2, and the amino acid sequence of the protein encoded by the OsbZIP53 gene is shown in SEQ ID No. 3.

4. A method for increasing rice yield, characterized in that the OsbZIP53 gene is silenced or knocked out in rice plants.

5. The method of claim 4, wherein the nucleotide sequence of the CDs region of the OsbZIP53 gene is shown in SEQ ID No. 2.

6. The method of claim 4, comprising the steps of:

(1) Constructing an OsbZIP53 gene silencing or knockout vector;

(2) Introducing the OsbZIP53 gene silencing or knocking-out vector constructed in the step (1) into a rice cell, silencing or knocking-out the OsbZIP53 gene with a CDs region nucleotide sequence shown as SEQ ID NO.2, and culturing to obtain a transgenic plant.

7. The method of claim 6, wherein the vector is pCAMBIA1300.

8. The method of claim 6, wherein step (2) comprises infecting rice cells after transferring the OsbZIP53 gene silencing or knockout vector into agrobacterium genetically engineered bacteria; the agrobacterium genetic engineering bacteria are agrobacterium EHA105 strains.

9. The method of claim 8, wherein the source of agrobacterium-infected cells is rice seed-induced callus.

Images