CN112126655A

CN112126655A - Application of Asian cotton GaNCED3 gene in improving drought resistance of plants

Info

Publication number: CN112126655A
Application number: CN202011098618.8A
Authority: CN
Inventors: 蔡肖; 张建宏; 江振兴; 迟吉娜; 刘存敬; 唐丽媛; 张素君; 李兴河; 王海涛
Original assignee: Institute Of Cotton Hebei Academy Of Agriculture And Forestry Sciences Hebei Special Economic Crop Research Institute Academy Of Agriculture And Forestry Sciences
Current assignee: Institute Of Cotton Hebei Academy Of Agriculture And Forestry Sciences Hebei Special Economic Crop Research Institute Academy Of Agriculture And Forestry Sciences
Priority date: 2020-10-14
Filing date: 2020-10-14
Publication date: 2020-12-25

Abstract

The invention discloses an application of an Asian cotton GaNCED3 gene in improving the drought resistance of plants. Belongs to the technical field of plant genetic engineering. The invention also provides a method for cultivating the transgenic plant for improving the drought resistance, namely, a target nucleotide sequence is introduced into a receptor plant through a plant over-expression vector pBI121-GaNCED3, the activity of GaNCED3 in the receptor plant is increased, the content of GaNCED3 in the target plant is increased, or the expression of a GaNCED3 coding protein is promoted, and the drought resistance of the obtained transgenic plant is higher than that of a control receptor plant. The drought resistance of the invention is improved in that the germination rate, the green seedling rate and the root length of the transgenic plant seeds are higher than those of the receptor plant under the drought stress simulated by mannitol, and the malondialdehyde content of the transgenic plant leaves is less than that of the receptor plant and the accumulation amount of free proline is greater than that of the receptor plant under natural drought.

Description

Application of Asian cotton GaNCED3 gene in improving drought resistance of plants

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to application of an Asian cotton GaNCED3 gene in improving drought resistance of plants.

Background

Drought is one of the major factors affecting plant growth and development. Cotton is an important economic crop in China. Under the condition of extremely severe national water resource situation, the drought resistance of cotton needs to be improved to maintain the sustainable development of the cotton industry and stabilize the national cotton yield. The cultivation of drought-resistant cotton material by gene engineering means is an effective way to solve the problem. The plant drought-resistant reaction mechanism is complex, and relates to various drought-resistant mechanisms and signal transmission paths, and although some genes related to cotton drought resistance are cloned at present, the number of the genes is limited, and a plurality of unknown important genes are required to be explored.

9-cis-epoxycarotenoid dioxygenase (NCED) is a key rate-limiting enzyme in the synthesis process of ABA and is proved to be widely involved in the growth and development process of plants and the response to abiotic stress. The method excavates the drought-related NCED gene in cotton, is applied to cultivating drought-resistant cotton materials, and has important significance for genetic improvement of cotton by using genetic engineering means.

Therefore, the problem to be solved by those skilled in the art is how to provide a gene and protein with drought resistance function, and a method for improving plant drought resistance.

Disclosure of Invention

In view of the above, the invention provides an application of an Asian cotton GaNCED3 gene in improving the drought resistance of plants.

In order to achieve the purpose, the invention adopts the following technical scheme:

a drought resistance regulating gene GaNCED3 has a nucleotide sequence shown in SEQ ID NO: 1 is shown in the specification; the amino acid sequence of the expression protein is shown as SEQ ID NO: 2, respectively.

The invention also provides a biological material containing the GaNCED3, wherein the biological material is an expression vector, a cloning vector or an engineering bacterium.

Preferably: the expression vector includes:

a: the ratio of GaNCED 3-V-F: GAGTAAGGTTACCGAATTCTCTTCATTTGCCTAAGCAACAATCAC, SEQ ID NO: 3 and GaNCED 3-V-R: TGAGCTCGGTACCGGATCCTAGACTCCTTGTATGCAATCCGG, SEQ ID NO: 4 as a primer, and using the leaf cDNA treated by PEG for 2h as a template to carry out PCR amplification to obtain a PCR product with the length of 300bp, wherein the nucleotide sequence of the PCR product is shown as SEQ ID NO: 5 is shown in the specification; the PCR product and the pTRV-RNA2 vector are subjected to double enzyme digestion by using restriction enzymes Eco RI and BamHI to construct a recombinant plasmid pTRV2-GaNCED3 capable of inhibiting the expression of GaN CED3 coding protein;

or the like, or, alternatively,

b: with GaNCED 3-F: GAACACGGGGGACTCTAGAATGGCTTCATCAACAGCAGC, SEQ ID NO: 6 and GaNCED 3-R: TGAACGATCGGGGAAATTCGAGCTCTTAGGCCTGTTTTTCCAAGTCC, SEQ ID NO: 7 as a primer, using the leaf cDNA treated by PEG for 2h as a template to carry out PCR amplification, and adopting restriction enzymes XbaI and ScaI to double-enzyme-cut the PCR product and a pBI121 vector to construct a drought-resistant gene GaNCED3 overexpression vector pBI121-GaNCED 3.

The invention also provides application of the GaNCED3 or the biological material in improving drought resistance of plants, wherein the plants are monocotyledons or dicotyledons.

The invention also provides application of the GaNCED3 or the biological material in preparing transgenic plants, wherein the plants are monocotyledons or dicotyledons.

The invention also provides application of the GaNCED3 or the biological material in plant breeding, wherein the plant is a monocotyledon or a dicotyledon.

Preferably: the breeding aim is to improve the drought resistance of the plant, and the dicotyledonous plant is cotton or arabidopsis; the cotton is Asian cotton.

The invention also provides a method for improving the drought resistance of plants, which comprises the following steps: overexpressing said GaNCED3 in plants; wherein the plant is a monocotyledon or a dicotyledon; the dicotyledonous plant is cotton or arabidopsis; the cotton is Asian cotton.

The present invention also provides a method of identifying a plant, which is a monocot or dicot plant comprising GaNCED3 as described above, or a monocot or dicot plant comprising a biological material as described above, or a monocot or dicot plant obtained by the method as described above, comprising the steps of: determining whether the plant comprises the above-described GaNCED 3; the detection is qPCR detection, and the detection primer sequence is as follows: GaNCED3-qPCR-F: 5'-TTCTGAATCCGAGCAAGTGA-3', SEQ ID NO: 8; GaNCED 3-qPCR-R5'-CTTTGGCGAATCCTGACACT-3', SEQ ID NO: 9.

preferably: qPCR reaction procedure: 94 ℃ for 3 min; the 35 cycle program comprised 94 ℃, 30 s; 30s at 60 ℃; 72 ℃ for 1 min; finally, extending for 5min at 72 ℃; reaction system: the total volume is 20 μ l, including 2 XTaq PCRMix 10 μ l, GaNCED 3-qPCR-F0.5 μ l, GaNCED 3-qPCR-R0.5 μ l, template 2.0 μ l, ddH₂O 7.0μl。

According to the technical scheme, compared with the prior art, the invention discloses and provides the application of the Asian cotton GaNCED3 gene in improving the drought resistance of plants, and the technical effects are as follows:

the invention clones Asian cotton GaNCED3 gene, and performs function verification of GaNCED3 gene drought resistance by constructing GaNCED3 transgenic Arabidopsis and constructing GaNCED3 gene silencing cotton plant by VIGS technology. Experiments prove that: the drought resistance of the Arabidopsis plant with GaNCED3 over-expression is enhanced; GaNCED3 silences cotton plants with reduced drought resistance.

The over-expression of the GaNCED3 gene is beneficial to obtaining new plant germplasm with improved drought resistance, and provides a new idea for drought resistance breeding.

The GaNCED3 provided by the invention is a protein with drought resistance function, can be applied to drought resistance breeding of cotton or other plants, and has important application value; meanwhile, the disclosure of the GaNCED3 drought resistance function enriches the understanding of the functions and action mechanisms of the NCED genes of cotton.

The target nucleotide sequence is introduced into a receptor plant through a plant over-expression vector pBI121-GaNCED3, the activity of GaNCED3 in the receptor plant is increased, the content of GaNCED3 in the target plant is increased, or the expression of a protein coded by GaNCED3 is promoted, and the drought resistance of the obtained transgenic plant is higher than that of a control receptor plant.

The drought resistance of the invention is improved in that the germination rate, the green seedling rate and the root length of the transgenic plant seeds are higher than those of the receptor plant under the drought stress simulated by mannitol, and the malondialdehyde content of the transgenic plant leaves is less than that of the receptor plant and the accumulation amount of free proline is greater than that of the receptor plant under natural drought.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a diagram showing the relative expression of GaNCED3 in each organ of a tissue sample.

FIG. 2 is a schematic diagram showing the expression change of GaNCED3 gene under PEG-simulated drought stress.

FIG. 3 is a schematic diagram showing the phenotypic changes of plants after 2 weeks of inoculation of the VIGS resuspended cells provided by the present invention.

FIG. 4 is a schematic diagram showing the detection of the expression level of GaNCED3 gene 2 weeks after the inoculation of the VIGS resuspended cells provided by the present invention.

FIG. 5 is a schematic diagram of the drought resistant phenotype of VIGS-silenced plants provided by the present invention under drought stress of 10 d.

FIG. 6 is a schematic diagram of physiological index analysis of GaNCED3 silenced plants under drought stress.

FIG. 7 is a schematic diagram of the analysis of the expression of stress-related genes in GaNCED3 silenced plants under drought stress.

FIG. 8 is a schematic diagram of antibiotic screening of transgenic Arabidopsis thaliana T0 generation seeds provided by the present invention.

FIG. 9 is a schematic diagram of qPCR detection of transgenic Arabidopsis T1 generation partial plants provided by the present invention. Wherein, MarKer: DL2000, lanes 1-7: the transgenic lines OE-1 to OE-7 have an nptII gene 677bp fragment.

FIG. 10 is a schematic diagram showing the effect of overexpression of GaNCED3 gene on seed germination and seedling growth of Arabidopsis thaliana under the stress of mannitol with different concentrations.

FIG. 11 is a schematic diagram showing germination rate and green seedling rate of transgenic and wild type Arabidopsis seeds provided by the present invention cultured for 12d under different mannitol concentrations.

FIG. 12 is a schematic diagram showing the root length analysis of transgenic and wild type Arabidopsis seedlings provided by the present invention on a control medium and a medium supplemented with 300mM mannitol.

FIG. 13 is a schematic diagram showing the growth of transgenic and wild type Arabidopsis thaliana under natural drought according to the present invention.

FIG. 14 is a schematic diagram of analysis of physiological indexes of different Arabidopsis lines under control and natural drought treatment provided by the present invention.

FIG. 15 is a schematic view of the expression analysis of drought-resistant related genes in different Arabidopsis lines under control and natural drought treatment provided by the present invention.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The embodiment of the invention discloses application of an Asian cotton GaNCED3 gene in improving drought resistance of plants.

In the examples, test materials and reagents:

1.1 the test material is commercially available Asian cotton-stone series sub-No. 1, planted and stored by the Cotton research institute of agriculture and forestry academy of sciences of Hebei province.

1.2 DNA polymerase

HS DNA Polymerase, various restriction enzymes, cDNA reverse transcription and real-time fluorescence quantitative PCR kits are purchased from TaKaRa company, a plant total RNA extraction kit, a gel recovery and purification kit, a rapid DNA extraction detection kit and a plasmid extraction kit are purchased from Tiangen Biotechnology (Beijing) Co., Ltd, and a cloning vector and escherichia coli competence are purchased from Beijing all-purpose gold biotechnology Co., Ltd. Primer synthesis and sequencing was performed by seoul national science and technology limited, su.

Example 1

Cloning and expression analysis of GaNCED3 Gene

2.1 Total RNA extraction and cDNA first Strand Synthesis

The delinted stone-series No. 1 seeds are sown in wet sand and cultured in an incubator at 27 ℃, and the photoperiod is 16h of light/8 h of darkness. After 5 days, the cotton seedlings were transferred to a hydroponic box containing 1/2Hoagland nutrient solution, and the culture conditions were unchanged. When 3 true leaves of cotton seedling are treated, PEG simulated drought stress treatment is carried out, the treatment method comprises adding 17% PEG6000(w/v) into water culture nutrient solution, and respectively shearing young and tender leaves and roots of cotton seedling for 0, 1, 2, 3 and 5hTotal RNA is extracted by using an RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit. cDNA Synthesis Using reverse transcription kit PrimeScript^TMRT reagent Kit, then reference fluorescent quantitative PCR Kit TB Green^TM Premix Ex Taq^TMII illustrates performing real-time fluorescent quantitative PCR (RT-qPCR).

2.2 cloning of the GaNCED3 Gene

According to the sequence of a Cotton Asian genome Cotton _ A _12895 gene (GenBank Accession XM _ 017784246.1), a primer GaNCED3-T3-F is designed: 5'-ATGGCTTCATCAACAGCAGC-3', SEQ ID NO: 10; GaNCED 3-T3-R: 5'-TTAGGCCTGTTTTTCCAAGTCC-3', SEQ ID NO: 11. and (3) performing PCR amplification by using the leaf cDNA treated by PEG of Shijiya No. 1 for 2h as a template, and connecting the PCR product to a cloning vector pEASY-T3 for sequencing.

The result shows that the DNA fragment with the fragment size of 1794bp is obtained from Asian gossypium hirsutum line No. 1 through PCR amplification, the 1-1794 position of the sequence of the DNA fragment contains the complete ORF reading frame (ATGGCTTCATCAACAGCAGCATCAGTGGCTAGTGGGAGCTGTTGTGTTAAGGTTAAACTCCCTGTTTCAACTCCTCAGTCTTCGTCTTCTTCTTCTTCTTGTATTGGTTTTAAAAAGCGCTACATTTCATGTTCTTTGCAAACCCCTTCAATTCTTCATTTGCCTAAGCAACAATCACCAGCTTTTCCACCATCACCTTCTTCTACTCCTCCAACGAAAAACACCGAGAAAACTACTCAATCCCAACAATGGAATCCTTTGCAAAGAGCGGCGGCTATGGCTTTAGATGCGGTGGAGAATGCTTTGGTTTCTCATGAGCGTCAACATCCTTTGCCGAAAACAGCTGACCCTGGTGTACAAATTTCCGGTAACTTTGCTCCGGTCCCTGAACAAACTGTTAAACAAAGGCTTCCCGTTATTGGAACAATCCCGGATTGCATACAAGGAGTCTACGCTCGAAACGGTGCCAACCCGCTTCATGAACCGGTGGCTGGACACCATTTCTTCGATGGGGATGGGATGGTTCATGCGGTTCAGTTCAAAAATGGCTCAGCTAGCTATGCTTGTAGGTTCACTGAAACCAACCGTTTGGTTCAAGAACGAGCTTTTGGGCGTCCTGTTTTCCCTAAAGCCATAGGTGAACTCCATGGTCATTCAGGCATAGCTAGACTGTTACTTTTCTATGCTCGAGGTTTATGTGGACTCGTTGATCCAAGCCATGGCACTGGTGTTGCTAACGCGGGACTTGTTTACTTCAACGGCCACCTTCTAGCCATGTCTGAAGATGATTTGCCGTACCATGTTCGTATTACTCCATCTGGTGACTTGAAAACCATTGGCAGATACGATTTTGATGGTCAGTTGAAATCCACAATGATTGCTCACCCCAAAGTTGATCCACAAACTGGTGAATTCTTTGCTCTTAGCTATGATGTTATCCAAAAACCGCATCTCAAGTACTTCAAAATTTCACCCGGTGGTAAGAAATCACCTGATGTTGAAATCCCAGTTGATGGTCCAACAATGATGCACGACTTCGCCATCACTGAAAATTTTGTGGTGATACCAGACCAACAAGTTGTTTTCAAATTGGGTGAAATGGTTCATGGTGGTTCACCCGTTGTGTATGATCAGAACAAGGTATCAAGGTTTGGGGTATTGAACAAGAATGCCATTGATGCTTCTGGGATTAAATGGATTGAAGCACCTGATTGCTTTTGTTTCCATCTTTGGAATGCTTGGGAAGAACCAGAAACTAACGAAGTTGTTGTGATTGGTTCTTGCATGACACCCCCAGATTCCATTTTCAATGAATGTGAAGAGAATCTCAAGAGTGTTCTGTCTGAAATTAGATTGAATTTGAAGACCGGGAAATCGACTCGCCGTGCCATTATTTCTGAATCCGAGCAAGTGAACTTGGAAGCAGGGATGGTGAACAAGAATTTACTGGGAAGAAAGACTCGGTTTGCATATTTAGCTCTAGCTGAGCCTTGGCCTAAAGTGTCAGGATTCGCCAAAGTCGATCTCTCGACCGGGGAAGTTAACAAGTATATCTATGGAGATCAAAGGTATGGTGGTGAGCCTTTGTTCTTCCCTCGAAACCCCCATTCGGAGAACGAAGACGACGGCTATATTTTAGCCTTCGTTCACGACGAGAAGGCTTGGAAATCGGAACTGCAAATTGTGAACGCCATGGACTTAAAGCTAGAAGCCACGGTTCAACTTCCGTCTCGAGTTCCATACGGTTTTCATGGAACATTCATAAGCTCAAAGGACTTGGAAAAACAGGCCTAA, SEQ ID NO: 1) and encodes 597 amino acid residues (MASSTAASVASGSCCVKVKLPVSTPQSSSSSSSCIGFKKRYISCSLQTPSILHLPKQQSPAFPPSPSSTPPTKNTEKTTQSQQWNPLQRAAAMALDAVENALVSHERQHPLPKTADPGVQISGNFAPVPEQTVKQRLPVIGTIPDCIQGVYARNGANPLHEPVAGHHFFDGDGMVHAVQFKNGSASYACRFTETNRLVQERAFGRPVFPKAIGELHGHSGIARLLLFYARGLCGLVDPSHGTGVANAGLVYFNGHLLAMSEDDLPYHVRITPSGDLKTIGRYDFDGQLKSTMIAHPKVDPQTGEFFALSYDVIQKPHLKYFKISPGGKKSPDVEIPVDGPTMMHDFAITENFVVIPDQQVVFKLGEMVHGGSPVVYDQNKVSRFGVLNKNAIDASGIKWIEAPDCFCFHLWNAWEEPETNEVVVIGSCMTPPDSIFNECEENLKSVLSEIRLNLKTGKSTRRAIISESEQVNLEAGMVNKNLLGRKTRFAYLALAEPWPKVSGFAKVDLSTGEVNKYIYGDQRYGGEPLFFPRNPHSENEDDGYILAFVHDEKAWKSELQIVNAMDLKLEATVQLPSRVPYGFHGTFISSKDLEKQA, SEQ ID NO: 2), and the protein is named as GaNCED 3.

2.3 expression Pattern of the GaNCED3 Gene

Designing a gene specific primer GaNCED3-qPCR-F, 5'-TTCTGAATCCGAGCAAGTGA-3', SEQ ID NO: 8; and GaNCED3-qPCR-R: 5'-CTTTGGCGAATCCTGACACT-3', SEQ ID NO: 9. the expression pattern of the GaNCED3 gene in Shilianya No. 1 was examined. The GhHIS3 gene is used as an internal reference, and primers are as follows: GhHis 3-F: 5'-TCAAGACTGATTTGCGTTTCCA-3', SEQ ID NO: 12; GhHis 3-R: 5'-GCGCAAAGGTTGGTGTCTTC-3' SEQ ID NO: 13, three replicates.

2.3.1 expression Pattern of the GaNCED3 Gene in different tissues

The tissues were selected as cotyledons, hypocotyls, radicles, leaves, stems, roots, petals, ovules (-3, 0 and 3DPA) and fibers (5, 10, 15, 20 and 25DPA) at different developmental stages. DPA (Days post anthesis) represents days after flowering.

The results showed that GaNCED3 was expressed in the highest amount in 5DPA fibers, the second in petals and the lowest in ovules in the reproductive organs. In the vegetative organ, the gene GaNCED3 was expressed in higher amounts in the root and stem, and in the leaf, the expression was the lowest (see FIG. 1). This suggests that GaNCED3 may play an important role in improving drought resistance.

2.3.2 expression Change of GaNCED3 Gene under drought stress

And extracting total RNA in leaves and roots of plants subjected to drought treatment for 0, 1, 2, 3 and 5h, carrying out reverse transcription on cDNA, and analyzing expression change of GaNCED3 under different drought treatment times by RT-qPCR. The result shows that the GaNCED3 gene is up-regulated by drought induction. Among them, the gene is obviously up-regulated in roots of different time of stress treatment, wherein the expression amount is the highest in roots of 3h of stress treatment and reaches 27.6 times of that in control roots (see figure 2). This suggests that GaNCED3 may play an important role in cotton drought response.

Example 2

GaNCED3 gene silencing can reduce drought resistance of cotton plants

1. Construction of GANCED3 gene VIGS silencing vector

The leaf cDNA treated with PEG for 2h is taken as a template, and GaNCED3-V-F and GaNCED3-V-R are taken as primers for PCR amplification to obtain a PCR product with the length of 300 bp.

GaNCED3-V-F:5’-GAGTAAGGTTACCGAATTCTCTTCATTTGCCTAAGCAACAATCAC-3’，SEQ ID NO：3；

GaNCED3-V-R:5’-TGAGCTCGGTACCGGATCCTAGACTCCTTGTATGCAATCCGG-3', SEQ ID NO: 4; in which underlining is illustratedGAATTCAndGGATCCrestriction enzymes EcoRI and BamHI recognition sequences are shown, respectively, and GAGTAAGGTTACC and TGAGCTCGGTACC are protecting bases.

And carrying out double enzyme digestion on the PCR product by using restriction enzymes EcoRI and BamHI, and recovering the enzyme digestion product. The pTRV-RNA2 vector was digested with restriction enzymes EcoRI and BamHI, and the vector backbone was recovered. And connecting the enzyme digestion product with a vector framework, constructing a recombinant plasmid, and carrying out sequencing verification on the recombinant plasmid.

As a result, the recombinant plasmid was designated pTRV2-GaNCED3 by replacing (TCTTCATTTGCCTAAGCAACAATCACCAGCTTTTCCACCATCACCTTCTTCTACTCCTCCAACGAAAAACACCGAGAAAACTACTCAATCCCAACAATGGAATCCTTTGCAAAGAGCGGCGGCTATGGCTTTAGATGCGGTGGAGAATGCTTTGGTTTCTCATGAGCGTCAACATCCTTTGCCGAAAACAGCTGACCCTGGTGTACAAATTTCCGGTAACTTTGCTCCGGTCCCTGAACAAACTGTTAAACAAAGGCTTCCCGTTATTGGAACAATCCCGGATTGCATACAAGGAGTCTA, SEQ ID NO: 5) the target DNA fragment with the sequence fragment between EcoRI and BamHI cleavage sites of pTRV-RNA2 vector and leaving the other sequences of pTRV-RNA2 vector unchanged.

2. Obtaining of GaNCED3 gene silencing plant

Recombinant plasmid is prepared

The plasmid pTRV2-GaNCED3 is transferred into agrobacterium GV3101 to obtain recombinant bacterial liquid. pTRV-RNA1(pTRV1) auxiliary vector bacterial liquid, pTRV-RNA2(pTRV2) empty vector bacterial liquid, pTRV2-CLA vector bacterial liquid (albino positive control) and pTRV2-GaNCED3 vector bacterial liquid are respectively added into 1ml of sterilized LB (containing 50 ug/ml kanamycin and 50 ug/ml rifampicin) liquid culture medium, and placed on a shaker at 200rpm for activation for 16 h. Respectively inoculating the activated bacterial liquid into a triangular flask containing 50ml of LB culture medium, and continuously culturing at 200rpm and 28 ℃ until the OD of the bacterial liquid₆₀₀When the value is 0.8-1.0, centrifuging at 4000rpm for 15min to collect bacterial liquid. Resuspending with VIGS (10mmol/L MES, 200. mu. mol/L acetosyringone 10mmol/L MgCl)₂) Resuspending the cells and adjusting the concentration to OD₆₀₀1.0 for vaccination. Respectively mixing heavy-suspension bacterium liquid of recombinant vectors pTRV2-GaNCED3, pTRV2-CLA and pTRV2 empty vector with heavy-suspension bacterium liquid of pTRV1 in equal volume, and standing at room temperature for 3 h. A1 mL disposable syringe is taken, the bacterial liquid is sucked, and the inoculation is carried out on the back of the leaf. After inoculation, the plants are placed in an incubator for dark culture for 24h and then placed at 25/20 ℃ for culture under the condition of illumination for 16h/8 h.

After about 2 weeks of inoculation, the leaves of the pTRV2-CLA inoculated plants appeared whitish, see FIG. 3. Meanwhile, each inoculated plant is respectively numbered and sampled, and the expression quantity of the target gene GaNCED3 is detected by RT-qPCR. The detection primer sequence is as follows: GaNCED 3-qPCR-F5' -TTCTGAATCCGAGCAAGTGA-3', SEQ ID NO: 8; GaNCED 3-qPCR-R5'-CTTTGGCGAATCCTGACACT-3', SEQ ID NO: 9. reaction procedure: 94 ℃ for 3 min; the 35 cycle program comprised 94 ℃, 30 s; 30s at 60 ℃; 72 ℃ for 1 min; finally, extension is carried out for 5min at 72 ℃. Reaction system: the total volume is 20 μ l, including 2 XTaq PCR Mix 10 μ l, GaNCED 3-qPCR-F0.5 μ l, GaNCED 3-qPCR-R0.5 μ l, template 2.0 μ l, ddH₂O 7.0μl。

The result shows that the expression quantity of GaNCED3 in the plants (VIGS-NCED 3-1-3-12) injected with GaNCED3 silent vectors is only 0.08-0.56 times of that of the control plants (VIGS-TRV2) injected with empty vectors (see figure 4), and the VIGS technology is used for obtaining the silent plants with obviously reduced expression quantity of the target gene GaNCED 3.

3. Identification of drought resistance of silent plants

3.1 phenotypic Change of drought stress sinking default plants

GaNCED3 gene was silenced in Asian Gossypium 1, watering was stopped 3 weeks after inoculation, and plant phenotype change was observed after 10d drought treatment, with normal watered plants as control. As shown in FIG. 5, the water loss of young leaves of VIGS-GANCED3 plant is more reduced, and the plants are wilted and drooped, and have weaker growth than those of the uninoculated plant (CK) and the inoculated empty vector plant (VIGS-TRV 2). This indicates that silencing GaNCED3 reduces the resistance of plants to drought.

3.2 analysis of physiological indices of drought stress sinking default plants

And (3) carrying out drought stress treatment for 10d, sampling the silent plants and the empty vector control respectively, and determining the water loss rate of the isolated leaves and the content of free proline and Malondialdehyde (MDA). The results show that the water loss rate of GaNCED3 silenced plants was significantly higher than that of control plants (P <0.05) at 1h and 2h, and after 3h, the water loss rate was significantly higher than that of control plants (P <0.01) (see fig. 6 a). The accumulation of free proline in leaves of plants with the silenced GaNCED3 gene was significantly less than that of the control (see fig. 6b), and the MDA content was significantly higher than that of the control (P <0.05) (see fig. 6 c). Taken together, the above results indicate that GaNCED3 silencing reduces plant resistance to drought stress.

3.3 expression analysis of abiotic stress-related genes in drought stress-attenuated plants

Stress related genes RD29A, DREB1A and SOS1 are selected to detect the expression change of the genes in each strain under control and drought stress respectively. Referring to fig. 7, it can be seen that under normal Conditions (CK), the expression levels of the stress-related genes were not much different in the silenced plants, the control plants injected with empty vector and the blank control plants not injected. After Drought treatment (Drought), the RD29A and DREB1A genes showed significant up-regulated expression in each line, but the up-regulation was lower in silent plants than in the control. The change of the expression quantity of the SOS1 gene before and after drought treatment in each strain is not obvious. The research result shows that the silencing of the GaNCED3 gene can reduce the expression activity of RD29A and DREB1A genes, so that the drought resistance of a silenced plant is reduced.

Example 3

GaNCED3 gene overexpression can improve drought resistance of transgenic arabidopsis

1. Construction of recombinant plasmids

The leaf cDNA treated with PEG for 2h was used as a template, and the primers GaNCED3-F and GaNCED3-R were used for PCR amplification.

GaNCED3-F:5’-GAACACGGGGGACTCTAGAATGGCTTCATCAACAGCAGC-3’，SEQ ID NO：6；GaNCED3-R:5’-TGAACGATCGGGGAAATTCGAGCTCTTAGGCCTGTTTTTCCAAGTCC-3', SEQ ID NO: 7; in which underlining is illustratedTCTAGAAndGAGCTCthe recognition sequences of restriction enzymes XbaI and ScaI are shown, respectively, and GAACACGGGGGAC and TGAACGATCGGGGAAATTC are protective bases.

The PCR product and the pBI121 vector were digested simultaneously with restriction enzymes XbaI and ScaI. Connecting the recovered enzyme digestion product with a vector skeleton to construct a recombinant plasmid, and carrying out sequencing verification on the recombinant plasmid.

The result showed that the recombinant plasmid was obtained by replacing the sequence fragment between EcoRI and BamHI cleavage sites of pBI121 vector with the target DNA (SEQ ID NO: 1) fragment, and the other sequences on the vector were not changed, and the constructed recombinant plasmid was named pBI121-GANCED 3.

2. Obtaining of GaNCED 3-transgenic Arabidopsis thaliana

The constructed recombinant plasmid pBI121-GaNCED3 was transformed into wild type Col-0 Arabidopsis thaliana by a flower dipping method, transgenic Arabidopsis thaliana seeds of T0 generation were harvested, and seeds of T0 generation were screened on a medium containing 50mg/L kanamycin (see FIG. 8). Primers were designed from the nptII gene sequence on the expression vector (nptII-F: 5'-TGACTGGGCACAACAGACAAT-3', SEQ ID NO: 14; nptII-R: 5'-CGGCGATACCGTAAAGCAC-3', SEQ ID NO: 15) and positive plants of the T1 generation were identified by PCR (see FIG. 9 for partial results). And transplanting the positive plants of the T1 generation into nutrient soil for continuous planting and single plant harvesting, and carrying out separation ratio identification on the T2 and T3 generations on an MS plate containing kanamycin to finally obtain 5 homozygous transgenic arabidopsis thaliana strains.

qRT-PCR detects the expression level of GaNCED3 gene in 5 transgenic lines, and the sequence of the detection primer is as follows: GaNCED3-qPCR-F: 5'-TTCTGAATCCGAGCAAGTGA-3', SEQ ID NO: 8; GaNCED 3-qPCR-R5'-CTTTGGCGAATCCTGACACT-3', SEQ ID NO: 9. reaction procedure: 94 ℃ for 3 min; the 35 cycle program comprised 94 ℃, 30 s; 30s at 60 ℃; 72 ℃ for 1 min; finally, extension is carried out for 5min at 72 ℃. Reaction system: the total volume is 20 μ l, including 2 XTaq PCR Mix 10 μ l, GaNCED 3-qPCR-F0.5 μ l, GaNCED 3-qPCR-R0.5 μ l, template 2.0 μ l, ddH₂O7.0. mu.l. Homozygous strains OE-1, OE-16 and OE-27 with high GaNCED3 gene expression are selected for subsequent verification of GaNCED3 gene drought resistance.

3. Drought resistance identification of GaNCED3 gene-transferred Arabidopsis thaliana

3.1 analysis of seed Germination and Green shoot Rate under drought stress

Seeds of Wild Type (WT) and three transgenic arabidopsis pure lines (OE1, OE16, OE27), respectively, were aseptically treated and seeded on media containing different concentrations of mannitol (100, 200 and 300mM) against MS-blank media. Seeds of wild type and 3 transgenic lines were sown in each dish at 120 seeds, with 3 replicates per concentration. And (5) counting the number of the exposed seeds and calculating the germination rate of the seeds when the seeds are cultured for the 12 th day. And (4) after the seeds germinate, regarding the seeds with the unfolded cotyledons and green as green seedlings, and counting the green seedling rate at 12 d.

As shown in FIG. 10, germination and growth of Arabidopsis seeds were inhibited to various degrees with increasing mannitol concentration.

Under the control and 100mM mannitol treatment conditions, the germination rate and the green seedling rate of transgenic arabidopsis homozygous lines OE-1, OE-16 and OE-27 are slightly higher than those of wild type, but the germination rate and the green seedling rate are not very different. Under the condition of 200mM mannitol, although the germination rates of 3 transgenic lines are slightly higher than that of a wild type, the germination rates are not very different, but the green seedling rate of the transgenic lines is very higher than that of the wild type. Under the condition of 300mM mannitol, seed germination of transgenic and control wild type lines is obviously inhibited, but the seed germination rate of transgenic Arabidopsis lines is extremely higher than that of wild type lines, which shows that the drought resistance of Arabidopsis seeds and seedling stage is improved by transferring GaNCED3 gene (see figure 11).

3.2 analysis of plant root Length under drought stress

Growing arabidopsis seedlings for 7d on an MS culture medium, selecting seedlings with basically equal initial root length, transferring the seedlings to a culture medium containing 300mM mannitol, arranging the seedlings in parallel, treating the seedlings by taking an MS blank culture medium as a control, and selecting 10 seedlings for each treatment to count the root length after culturing for 7 d.

As shown in FIG. 12, the root length difference between each transgenic line and the wild type Arabidopsis thaliana did not reach a very significant level (P <0.01) in the control treatment (CK), but the root length of the transgenic lines was significantly higher than that of the wild type (P >0.01) when the transgenic lines were cultured for 7d on a mannitol-containing drought stress medium, indicating that the GaNCED3a gene-transferred Arabidopsis lines were more resistant to drought stress.

3.3 phenotypic Change of plants under Natural drought

Nutrient soil: mixing vermiculite according to a ratio of 2:1, then transferring arabidopsis thaliana seedlings growing for 7d on MS blank medium into nutrient soil, and culturing in an incubator. After 3 weeks, the Arabidopsis plants were stopped from watering, and were subjected to natural drought treatment, with normal watering as a control. After natural drought treatment for 12d, observing and recording the phenotypic change of the plants.

As can be seen from FIG. 13, under normal culture conditions, there was no significant difference in phenotype between wild type Arabidopsis and transgenic plants. After the drought treatment for 12 days, leaves of wild arabidopsis thaliana are severely wilted, dehydrated and shrunken and even the whole plant dies, the plants grow basically normally after the stress of each transgenic line, most leaves are dark and purple, and only the leaves of individual plants slightly wilted, which shows that the drought resistance of the arabidopsis thaliana with the GaNCED3 gene is stronger than that of the wild arabidopsis thaliana.

3.4 analysis of physiological indices of plant leaves under Natural drought

Sampling before and 10 days after natural drought treatment, respectively, repeating 3 times of biology, and determining the content of Malondialdehyde (MDA) and the content of free proline (Pro). Normal watering group was used as control.

The results in FIG. 14 show that under normal watering conditions, the MDA and proline contents in leaves of transgenic and wild-type plants do not differ significantly (P > 0.01). After 8 days of natural drought treatment, the content of MDA in leaves of wild plants is remarkably higher than that of transgenic plants (P <0.01), and the content of free proline is remarkably lower than that of transgenic plants (P <0.01), which indicates that the tolerance of the Arabidopsis plants with GaNCED3 gene to drought stress is higher than that of the wild plants.

3.5 expression analysis of genes related to stress under Natural drought and in wild type Arabidopsis thaliana

Stress-related genes ABF4, RD29A, CBF3 and SOS1 are selected to detect the expression change of the genes in each strain under normal watering conditions (control) and drought stress respectively. As can be seen from FIG. 15, under normal conditions, there was little difference in the expression amounts of ABF4, RD29A, CBF3 and SOS1 genes in transgenic and wild-type Arabidopsis thaliana. After drought treatment, RD29A and CBF3 genes are obviously upregulated in 3 transgenic lines and wild type arabidopsis thaliana, but the upregulation times are higher in the transgenic lines, ABF4 genes are obviously upregulated and expressed in the wild type arabidopsis thaliana, and the expression quantity of SOS1 genes is slightly upregulated after the drought treatment compared with a control, but the expression quantity difference among the lines is not obvious. Research results show that the GaNCED3 gene in transgenic Arabidopsis can regulate the drought resistance of transgenic plants by activating the expression of abiotic stress related genes such as RD29A, CBF3 and ABF 4.

The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Cotton institute of agriculture and forestry academy of sciences of Hebei province (Special economic crop institute of agriculture and forestry academy of sciences of Hebei province)

<120> application of Asian cotton GaNCED3 gene in improving drought resistance of plants

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1794

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggcttcat caacagcagc atcagtggct agtgggagct gttgtgttaa ggttaaactc 60

cctgtttcaa ctcctcagtc ttcgtcttct tcttcttctt gtattggttt taaaaagcgc 120

tacatttcat gttctttgca aaccccttca attcttcatt tgcctaagca acaatcacca 180

gcttttccac catcaccttc ttctactcct ccaacgaaaa acaccgagaa aactactcaa 240

tcccaacaat ggaatccttt gcaaagagcg gcggctatgg ctttagatgc ggtggagaat 300

gctttggttt ctcatgagcg tcaacatcct ttgccgaaaa cagctgaccc tggtgtacaa 360

atttccggta actttgctcc ggtccctgaa caaactgtta aacaaaggct tcccgttatt 420

ggaacaatcc cggattgcat acaaggagtc tacgctcgaa acggtgccaa cccgcttcat 480

gaaccggtgg ctggacacca tttcttcgat ggggatggga tggttcatgc ggttcagttc 540

aaaaatggct cagctagcta tgcttgtagg ttcactgaaa ccaaccgttt ggttcaagaa 600

cgagcttttg ggcgtcctgt tttccctaaa gccataggtg aactccatgg tcattcaggc 660

atagctagac tgttactttt ctatgctcga ggtttatgtg gactcgttga tccaagccat 720

ggcactggtg ttgctaacgc gggacttgtt tacttcaacg gccaccttct agccatgtct 780

gaagatgatt tgccgtacca tgttcgtatt actccatctg gtgacttgaa aaccattggc 840

agatacgatt ttgatggtca gttgaaatcc acaatgattg ctcaccccaa agttgatcca 900

caaactggtg aattctttgc tcttagctat gatgttatcc aaaaaccgca tctcaagtac 960

ttcaaaattt cacccggtgg taagaaatca cctgatgttg aaatcccagt tgatggtcca 1020

acaatgatgc acgacttcgc catcactgaa aattttgtgg tgataccaga ccaacaagtt 1080

gttttcaaat tgggtgaaat ggttcatggt ggttcacccg ttgtgtatga tcagaacaag 1140

gtatcaaggt ttggggtatt gaacaagaat gccattgatg cttctgggat taaatggatt 1200

gaagcacctg attgcttttg tttccatctt tggaatgctt gggaagaacc agaaactaac 1260

gaagttgttg tgattggttc ttgcatgaca cccccagatt ccattttcaa tgaatgtgaa 1320

gagaatctca agagtgttct gtctgaaatt agattgaatt tgaagaccgg gaaatcgact 1380

cgccgtgcca ttatttctga atccgagcaa gtgaacttgg aagcagggat ggtgaacaag 1440

aatttactgg gaagaaagac tcggtttgca tatttagctc tagctgagcc ttggcctaaa 1500

gtgtcaggat tcgccaaagt cgatctctcg accggggaag ttaacaagta tatctatgga 1560

gatcaaaggt atggtggtga gcctttgttc ttccctcgaa acccccattc ggagaacgaa 1620

gacgacggct atattttagc cttcgttcac gacgagaagg cttggaaatc ggaactgcaa 1680

attgtgaacg ccatggactt aaagctagaa gccacggttc aacttccgtc tcgagttcca 1740

tacggttttc atggaacatt cataagctca aaggacttgg aaaaacaggc ctaa 1794

<210> 2

<211> 597

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ala Ser Ser Thr Ala Ala Ser Val Ala Ser Gly Ser Cys Cys Val

1 5 10 15

Lys Val Lys Leu Pro Val Ser Thr Pro Gln Ser Ser Ser Ser Ser Ser

20 25 30

Ser Cys Ile Gly Phe Lys Lys Arg Tyr Ile Ser Cys Ser Leu Gln Thr

35 40 45

Pro Ser Ile Leu His Leu Pro Lys Gln Gln Ser Pro Ala Phe Pro Pro

50 55 60

Ser Pro Ser Ser Thr Pro Pro Thr Lys Asn Thr Glu Lys Thr Thr Gln

65 70 75 80

Ser Gln Gln Trp Asn Pro Leu Gln Arg Ala Ala Ala Met Ala Leu Asp

85 90 95

Ala Val Glu Asn Ala Leu Val Ser His Glu Arg Gln His Pro Leu Pro

100 105 110

Lys Thr Ala Asp Pro Gly Val Gln Ile Ser Gly Asn Phe Ala Pro Val

115 120 125

Pro Glu Gln Thr Val Lys Gln Arg Leu Pro Val Ile Gly Thr Ile Pro

130 135 140

Asp Cys Ile Gln Gly Val Tyr Ala Arg Asn Gly Ala Asn Pro Leu His

145 150 155 160

Glu Pro Val Ala Gly His His Phe Phe Asp Gly Asp Gly Met Val His

165 170 175

Ala Val Gln Phe Lys Asn Gly Ser Ala Ser Tyr Ala Cys Arg Phe Thr

180 185 190

Glu Thr Asn Arg Leu Val Gln Glu Arg Ala Phe Gly Arg Pro Val Phe

195 200 205

Pro Lys Ala Ile Gly Glu Leu His Gly His Ser Gly Ile Ala Arg Leu

210 215 220

Leu Leu Phe Tyr Ala Arg Gly Leu Cys Gly Leu Val Asp Pro Ser His

225 230 235 240

Gly Thr Gly Val Ala Asn Ala Gly Leu Val Tyr Phe Asn Gly His Leu

245 250 255

Leu Ala Met Ser Glu Asp Asp Leu Pro Tyr His Val Arg Ile Thr Pro

260 265 270

Ser Gly Asp Leu Lys Thr Ile Gly Arg Tyr Asp Phe Asp Gly Gln Leu

275 280 285

Lys Ser Thr Met Ile Ala His Pro Lys Val Asp Pro Gln Thr Gly Glu

290 295 300

Phe Phe Ala Leu Ser Tyr Asp Val Ile Gln Lys Pro His Leu Lys Tyr

305 310 315 320

Phe Lys Ile Ser Pro Gly Gly Lys Lys Ser Pro Asp Val Glu Ile Pro

325 330 335

Val Asp Gly Pro Thr Met Met His Asp Phe Ala Ile Thr Glu Asn Phe

340 345 350

Val Val Ile Pro Asp Gln Gln Val Val Phe Lys Leu Gly Glu Met Val

355 360 365

His Gly Gly Ser Pro Val Val Tyr Asp Gln Asn Lys Val Ser Arg Phe

370 375 380

Gly Val Leu Asn Lys Asn Ala Ile Asp Ala Ser Gly Ile Lys Trp Ile

385 390 395 400

Glu Ala Pro Asp Cys Phe Cys Phe His Leu Trp Asn Ala Trp Glu Glu

405 410 415

Pro Glu Thr Asn Glu Val Val Val Ile Gly Ser Cys Met Thr Pro Pro

420 425 430

Asp Ser Ile Phe Asn Glu Cys Glu Glu Asn Leu Lys Ser Val Leu Ser

435 440 445

Glu Ile Arg Leu Asn Leu Lys Thr Gly Lys Ser Thr Arg Arg Ala Ile

450 455 460

Ile Ser Glu Ser Glu Gln Val Asn Leu Glu Ala Gly Met Val Asn Lys

465 470 475 480

Asn Leu Leu Gly Arg Lys Thr Arg Phe Ala Tyr Leu Ala Leu Ala Glu

485 490 495

Pro Trp Pro Lys Val Ser Gly Phe Ala Lys Val Asp Leu Ser Thr Gly

500 505 510

Glu Val Asn Lys Tyr Ile Tyr Gly Asp Gln Arg Tyr Gly Gly Glu Pro

515 520 525

Leu Phe Phe Pro Arg Asn Pro His Ser Glu Asn Glu Asp Asp Gly Tyr

530 535 540

Ile Leu Ala Phe Val His Asp Glu Lys Ala Trp Lys Ser Glu Leu Gln

545 550 555 560

Ile Val Asn Ala Met Asp Leu Lys Leu Glu Ala Thr Val Gln Leu Pro

565 570 575

Ser Arg Val Pro Tyr Gly Phe His Gly Thr Phe Ile Ser Ser Lys Asp

580 585 590

Leu Glu Lys Gln Ala

595

<210> 3

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gagtaaggtt accgaattct cttcatttgc ctaagcaaca atcac 45

<210> 4

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgagctcggt accggatcct agactccttg tatgcaatcc gg 42

<210> 5

<211> 300

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tcttcatttg cctaagcaac aatcaccagc ttttccacca tcaccttctt ctactcctcc 60

aacgaaaaac accgagaaaa ctactcaatc ccaacaatgg aatcctttgc aaagagcggc 120

ggctatggct ttagatgcgg tggagaatgc tttggtttct catgagcgtc aacatccttt 180

gccgaaaaca gctgaccctg gtgtacaaat ttccggtaac tttgctccgg tccctgaaca 240

aactgttaaa caaaggcttc ccgttattgg aacaatcccg gattgcatac aaggagtcta 300

<210> 6

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gaacacgggg gactctagaa tggcttcatc aacagcagc 39

<210> 7

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tgaacgatcg gggaaattcg agctcttagg cctgtttttc caagtcc 47

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ttctgaatcc gagcaagtga 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ctttggcgaa tcctgacact 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atggcttcat caacagcagc 20

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ttaggcctgt ttttccaagt cc 22

<210> 12

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tcaagactga tttgcgtttc ca 22

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gcgcaaaggt tggtgtcttc 20

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tgactgggca caacagacaa t 21

<210> 15

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cggcgatacc gtaaagcac 19

Claims

1. A drought resistance regulatory gene GaNCED3, characterized in that the nucleotide sequence is shown in SEQ ID NO: 1 is shown in the specification; the amino acid sequence of the expression protein is shown as SEQ ID NO: 2, respectively.

2. Biomaterial containing the GaNCED3 of claim 1, wherein the biomaterial is an expression vector, a cloning vector or an engineered bacterium.

3. The biomaterial of claim 2, wherein the expression vector comprises:

a: the ratio of GaNCED 3-V-F: GAGTAAGGTTACCGAATTCTCTTCATTTGCCTAAGCAACAATCAC, SEQ ID NO: 3 and GaNCED 3-V-R: TGAGCTCGGTACCGGATCCTAGACTCCTTGTATGCAATCCGG, SEQ ID NO: 4 as a primer, and using the leaf cDNA treated by PEG for 2h as a template to carry out PCR amplification to obtain a PCR product with the length of 300bp, wherein the nucleotide sequence of the PCR product is shown as SEQ ID NO: 5 is shown in the specification; the PCR product and the pTRV-RNA2 vector are subjected to double enzyme digestion by restriction enzymes EcoRI and BamHI to construct a recombinant plasmid pTRV2-GaNCED3 capable of inhibiting the expression of GaNCED3 coding protein;

or the like, or, alternatively,

4. Use of the GaNCED3 of claim 1 or the biomaterial of claim 2 to increase drought resistance in a plant, wherein the plant is a monocotyledonous or dicotyledonous plant.

5. Use of the GaNCED3 of claim 1 or the biological material of claim 2 or 3 in the preparation of a transgenic plant, said plant being a monocotyledonous or dicotyledonous plant.

6. Use of the GaNCED3 of claim 1 or the biomaterial of claim 2 in plant breeding wherein the plant is a monocot or a dicot.

7. The use according to claim 6, wherein the breeding is aimed at improving drought resistance in plants, and the dicotyledonous plants are cotton or Arabidopsis; the cotton is Asian cotton.

8. A method of increasing drought resistance in a plant, comprising: overexpressing a GaNCED3 of claim 1 in a plant; wherein the plant is a monocot or a dicot; the dicotyledonous plant is cotton or arabidopsis; the cotton is Asian cotton.

9. A method for identifying a plant, wherein said plant is a monocot or dicot comprising GaNCED3 of claim 1, or a monocot or dicot comprising biological material of claim 2, or a monocot or dicot obtained by the method of claim 8, comprising the steps of: determining whether the plant comprises the GaNCED3 of claim 1; the detection is qPCR detection, and the detection primer sequence is as follows:

GaNCED3-qPCR-F:5’-TTCTGAATCCGAGCAAGTGA-3’，SEQ ID NO：8；

GaNCED3-qPCR-R:5’-CTTTGGCGAATCCTGACACT-3’，SEQ ID NO：9。

10. identifying a plant according to claim 9The method of (a), wherein the qPCR reaction program: 94 ℃ for 3 min; the 35 cycle program comprised 94 ℃, 30 s; 30s at 60 ℃; 72 ℃ for 1 min; finally, extending for 5min at 72 ℃; reaction system: the total volume is 20 μ l, including 2 XTaq PCR Mix 10 μ l, GaNCED 3-qPCR-F0.5 μ l, GaNCED 3-qPCR-R0.5 μ l, template 2.0 μ l, ddH₂O 7.0μl。