CN104610438B - One grows cotton stress response GAP-associated protein GAP GhGeBP and its encoding gene and application - Google Patents
One grows cotton stress response GAP-associated protein GAP GhGeBP and its encoding gene and application Download PDFInfo
- Publication number
- CN104610438B CN104610438B CN201310538033.7A CN201310538033A CN104610438B CN 104610438 B CN104610438 B CN 104610438B CN 201310538033 A CN201310538033 A CN 201310538033A CN 104610438 B CN104610438 B CN 104610438B
- Authority
- CN
- China
- Prior art keywords
- plant
- encoding gene
- protein
- aba
- ghgebp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of upland cotton GhGeBP albumen and its encoding gene and application.Protein G hGeBP, is the protein with one of following amino acid residue sequences：1）The amino acid residue sequence of SEQ ID № .2 in sequence table；2）The substitution by one or several amino acid residues and/or missing and/or addition and the protein as derived from 1) related to plant stress response by the amino acid residue sequence of the SEQ ID № .2 in sequence table.The albumen and its encoding gene of the present invention can be used to cultivate high salt tolerant cotton variety（System）, have a good application prospect.
Description
Technical field
The invention belongs to the genetic modification of plants technology and Plant Biotechnology application field of agricultural, and in particular to Yi Zhongmian
Flower stress response related gene and its encoding proteins and application.
Background technology
GeBP（GL1enhancer binding protein）It is distinctive a kind of transcription factor family in plant, intends south
Comprising 23 members in mustard, 5 member genes of the family are found in upland cotton.Julien Curaba et al.（2003）Once reported
Road GeBP is mainly separate living tissue and the expression of tender phyllopodium of nutrition organs, determines that blade cell differentiation is ordered as repressor
Fortune；Chevalier et al.（2008）Research shows, GeBP and non-conservative new comprising bright of class GeBP one classes of encoding histone
The transcription factor protein of propylhomoserin zipper, and this albuminoid participated in Cytokinin pathway, suppresses ARR genes
Negative regulation effect to basic element of cell division response.Perazza et al.（2011）Result of study is CPR5（CONSTITUTIVE
EXPRESSOR OF PATHOGENESIS-RELATED GENES5）Aspect is expanded with GeBP/GPLs in regulating cell to rise conversely
Effect.But the effect on GeBP in terms of plant stress-resistance there is no research to report.
The content of the invention
It is an object of the invention to provide a kind of albumen and its encoding gene and its application.Protein name provided by the present invention
For GhGeBP, from upland cotton（Gossypium hirsutum）.
Albumen of the present invention is following 1）Or 2）Albumen：
1）The protein of amino acid sequence composition shown in SEQ ID № .2 in sequence table；
2）By the amino acid residue sequence of the SEQ ID № .2 in sequence table taking by one or several amino acid residues
Generation and/or missing and/or addition and the protein as derived from 1) related to plant stress response.
Amino acid sequence in sequence table shown in SEQ ID № .2 is made up of 389 amino acid residues.
Above-mentioned 1）With 2）In GhGeBP albumen can be artificial synthesized, also can first synthesize its encoding gene, then carry out biological table
Reach.Above-mentioned 1）With 2）In the encoding gene of GhGeBP albumen can be by by the 88- of SEQ ID № .1 in sequence table
DNA sequence dna shown in 1254 nucleotides lacks the codon of one or several amino acid residues, and/or carries out one or several
Obtained after the missense mutation of base-pair.
The nucleic acid molecules for encoding the GhGeBP albumen fall within protection scope of the present invention.
The nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules can also be
RNA, such as mRNA, hnRNA or tRNA.
A further object of the present invention is to provide the encoding gene of the albumen.
The encoding gene has one of following nucleotide sequence：
1）SEQ ID № in sequence table：1 nucleotide sequence of 88-1254；
2）SEQ ID № in polynucleotide：The polynucleotide sequence of 2 protein sequences；
3）Can be with SEQ ID № in sequence table under high high stringency conditions：The nucleotide sequence of the 1 DNA sequence dna hybridization limited；
4）With 1）Or 2）Or 3）The DNA sequence dna of restriction has more than 90% homology, and encodes identical function protein
DNA sequence dna；Specifically, the homology is more than 95%；Specific again is more than 96%；Specific again is more than 97%；It is specific again
For more than 98%；Specific again is more than 99%.
Above-mentioned high high stringency conditions can be that with 6 × SSC, 0.5%SDS solution hybridizes at 65 DEG C, then with 2 × SSC,
0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film once.
Wherein, the SEQ ID № in sequence table：1 is made up of 1378 nucleotides, its open reading frame（ORF）For certainly
SEQ ID № in the 5 ' nucleotides of end 88-1254, polynucleotide：Protein shown in 2, i.e., it is of the present invention
GhGeBP albumen.
Recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing above-mentioned nucleic acid molecules fall within the present invention's
Protection domain.
The recombinant vector can be recombinant expression carrier, or recombinant cloning vector.
The recombinant expression carrier can use existing expression vector establishment.The expression vector can also include foreign gene
3 ' ends untranslated region, i.e., the DNA fragmentation comprising polyadenylation signals and any other participation mRNA processing or gene expression.Institute
State the 3 ' ends that the bootable polyadenylic acid of polyadenylation signals is added to mRNA precursor.Use the gene constructed recombinant expression carrier
When, any enhanced, composing type, organizing specific type or inducible promoter can be added before its transcription initiation nucleotides,
They can be used alone or are used in combination with other promoters；In addition, using the gene constructed recombinant expression carrier of the present invention
When, it is also possible to use enhancer, including translational enhancer or transcriptional enhancer.For the ease of entering to transgenic plant cells or plant
Row identification and screening, can be processed to plant expression vector used, such as addition, expression can produce color change in plant
The gene of enzyme or luminophor（Gus gene, GFP genes, luciferase genes etc.）, resistant antibiotic marker
（Gentamicin label, kanamycins label etc.）Or anti-chemical reagent marker gene（Such as anti-herbicide gene）Deng.From
The security consideration of genetically modified plants, can be not added with any selected marker, directly screen transformed plant with adverse circumstance.
The primer pair for expanding encoding gene total length of the present invention or its any fragment falls within the scope of protection of the invention.
Weight it is a further object to provide albumen of the present invention, encoding gene and containing the encoding gene
Group carrier, expression cassette, transgenic cell line or recombinant bacterium it is following it is at least one in application：
1）Adjust plant salt stress response；
2）Adjust plant ABA stress responses.
The regulation plant salt stress response is that the salt tolerance for making plant strengthens；
The regulation plant ABA stress responses are that the resistance to ABA for making plant strengthens.
The plant is dicotyledon or monocotyledon；The dicotyledon is specially arabidopsis or cotton；Institute
State cotton specially upland cotton（Gossypium hirsutum）.
The present invention's a further object is offer albumen of the present invention, encoding gene and containing the encoding gene
Recombinant vector, expression cassette, transgenic cell line or Host Strains are cultivating the application in genetically modified plants are cultivated.
Specifically, the genetically modified plants have following at least one character：1）The salt tolerance enhancing of plant；2）Plant
Resistance to ABA enhancings.
The specific plant is dicotyledon or monocotyledon；The dicotyledon is specially arabidopsis or cotton
Flower；The cotton is specially upland cotton（Gossypium hirsutum）.
Further object of the present invention is to provide a kind of method for cultivating genetically modified plants, is by coding base of the present invention
Because importing purpose plant, genetically modified plants are obtained.
The genetically modified plants are compared with the purpose plant, with following at least one character：1）The salt tolerance of plant
Enhancing；2）The resistance to ABA enhancings of plant.
Specifically, the plant is dicotyledon or monocotyledon；The dicotyledon be specially arabidopsis or
Cotton；The cotton is specially upland cotton（Gossypium hirsutum）.
The present invention clones cotton GhGeBP genes from upland cotton, plant over-express vector is successfully built, using agriculture bar
The inflorescence dip method transformation mode plant Arabidopsis thaliana of bacterium mediation, compared with the control, transgenic arabidopsis is than non-transgenic arabidopsis
Salt tolerance and resistance to ABA are improved, therefore the present invention enriches the genetic resources for cultivating high salt tolerant cotton variety.
Brief description of the drawings
Fig. 1 be 150mM NaCl Stress treatments upland cotton " after middle G5 " 0.5h, the GhGeBP bases at middle G5 different tissues position
Because of differential expression situation, wherein CK is Normal group result, and NaCl represents salt stress treatment group result.
Fig. 2 is the PCR qualification result figures of partial transgenic Arabidopsis plant, and wherein CK+ is represented using DNA as template,
CK- represents that wildtype Arabidopsis thaliana DNA is template.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material, reagent used etc., unless otherwise specified, are commercially obtained in following embodiments.
Upland Cotton " middle G5 " seeds（In the cotton new materials such as Wang Kunbo, Cui Rongxia, Wang Chunying in G5 main features
State cotton .2000,24.）There is provided by the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute, the public can obtain from China Agricultural University.
The preparation of embodiment 1, cotton GhGeBP genes
Genomic DNA is extracted respectively as material using G5 Rooted Cuttings in upland cotton (Gossypium hirsutum L.) kind
And total serum IgE；The total serum IgE reverse transcription of extraction is obtained into cDNA；Respectively using genomic DNA and cDNA as template, with GhG1F and
GhG1R is that primer enters performing PCR amplification.The primer sequence of above-mentioned PCR amplifications is as follows：
GhG1F：5’ATTTGCTATTGCCTCCTTCCCTGTT3’
GhG1R：5’GAGCTACAGATACCCCCCATGATTG3’
PCR reaction systems are 50 μ l, and reaction system is：2 μ l templates（CDNA or genomic DNA）, 1 μ l primers（10μM）, 5
μ l10 × LA buffer, 8 μ l dNTP（2.5mM each）, 0.5 μ l LA-Taq enzymes, 34.5 μ l ddH2O。
PCR response procedures are：94 DEG C of 5min, 1cycle；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 90s（2min）, 30cycles；
72 DEG C of 10min, 4 DEG C of ∞, 1cycle.
By the agarose gel electrophoresis of the pcr amplification product progress 1% of acquisition, fragment is reclaimed, pMD18-T is connected to
vector（TAKARA, D101A）, E. coli competent DH5 α bacterial strains are converted, is inverted for 37 DEG C and stays overnight light culture.By blue hickie
Positive colony bacterium solution sample presentation is sequenced screening, picking monoclonal, bacterium colony PCR checking positive colonies.Sequencing result shows, with base
Because group DNA is that the fragment that template amplification is obtained is identical with the clip size obtained using cDNA as template amplification, it is sequenced by analyzing
As a result, contrast cDNA sequence and genomic dna sequence, find the gene intronless；Above-mentioned PCR amplifications obtain nucleic acid fragment tool
SEQ ID № in ordered list：1 nucleotide sequence, common 1378bp, wherein coding head of district 1167bp（Do not include terminator）,
SEQ ID № in the coding region sequence such as sequence table：In 1 shown in 88-1254 nucleotides, SEQ ID in polynucleotide
№：Amino acid sequence shown in 2, totally 389 amino acid residues, molecular weight is 43KD, and isoelectric point is 5.03.This had into sequence
SEQ ID № in table：The fragment of the nucleotide sequence of 88-1254 is named as GhGeBP in 1.
Embodiment 2, the checking of GhGeBP gene functions
（One）The expression analysis of the lower GhGeBP genes of salt stress processing
G5 Rooted Cuttings in plant cotton, Hoagland suspension cultures.When seedling length to three one heart stage of leaf, utilize
The processing of 150mM NaCl solutions, is compareed as common Hoagland nutrient solutions, take respectively 150mM NaCl solutions processing 0.5h and
Root, stem, the leaf of control, liquid nitrogen flash freezer are stored in -70 DEG C, for RNA extractings.The 3 parts of backups of every part of material.
Cotton total serum IgE is extracted using modified CTAB method, reverse transcription is obtained after cDNA, using GhG3F and GhG3R as primer, with
GhActin is that reference gene carries out RT-PCR analyses.Primer sequence is as follows：
GhG3F：5’GGAGGCGAAATGGAGGAAATTGC3’
GhG3R：5’GAGCTACAGATACCCCCCATGATTG3’
RT-PCR analysis results are shown in Fig. 1.As a result show, GhGeBP genes have expression in the tissue such as root, stem, leaf, and
Under salt stress processing 0.5h, expression of the GhGeBP genes in each tissue is in substantially up-regulation trend.
（Two）Resistance to salt-stressed plants are cultivated with GhGeBP genes
1st, plant expression vector pBI121-GhGeBP preparation
Primer GhG1F and GhG1R are introduced into restriction endonuclease sites respectively, GhG2F and GhG2R, primer is named as
GhG2F and GhG2R sequences are as follows：
GhG2F：5’GCTCTAGAGCATTTGCTATTGCCTCCTTCCCTGTT3’Xba Ⅰ
GhG2R：5’CGAGCTCGGAGCTACAGATACCCCCCATGATTG3’Sac Ⅰ
With the primer containing restriction enzyme site of above-mentioned design, using the cDNA of G5 Rooted Cuttings in upland cotton cultigen as template,
Enter performing PCR amplification.The correct amplification purpose fragment with restriction enzyme site will be sequenced and is connected to plant expression vector pBI121
（PBI121 derives from Chinese plasmid vector strain cell pnca gene collection）；Connection product converts bacillus coli DH 5 alpha, 37
DEG C overnight incubation；Picking monoclonal shakes bacterium, the correctness of sequence verification sequence.The foreign gene inserted in gained plasmid has sequence
SEQ ID № in list：Nucleotide sequence shown in 1, pBI121-GhGeBP is named as by the plasmid.
2nd, the acquisition of recombinational agrobacterium
Plasmid pBI121-GhGeBP is converted to Agrobacterium tumefaciems EHA105 competent cell with freeze-thaw method（Purchased from Beijing
Its bounties Gene Tech. Company Limited）.28 DEG C in the YEP solids training containing 50 μ g/ml kanamycin sulfates and 50 μ g/ml rifampins
Screening and culturing in supporting；By bacterium colony PCR（Use the primer GhG1F and GhG1R in embodiment 1）Positive monoclonal is reflected
Fixed, will identify correct Agrobacterium is that the recombinational agrobacterium containing recombinant plant expression vector pBI121-GhGeBP is named as
EHA105/pBI121-GhGeBP。
3rd, the acquisition of transgenic arabidopsis
1）Using inflorescence dip method arabidopsis thaliana transformation
A) Agrobacterium infects the preparation of liquid
Restructuring Agrobacterium tumefaciems EHA105/pBI121-GhGeBP is taken to be inoculated in 5ml YEP fluid nutrient mediums（Containing 50 μ g/ml
Kanamycin sulfate and 50 μ g/ml rifampins）In, shake bacterium and stay overnight, second day rolling bottle is into 500ml YEP fluid nutrient mediums, 28
DEG C culture to OD600 be 1.6-2.0；Thalline is collected by centrifugation, MS solution is used（MS minimal medium compositions：A great number of elements, micro member
Element, molysite, vitamin B5,5% sucrose, 40 μ l/500ml Silwet L-77）OD600 is suspended into for 0.8-1.0, agriculture bar is obtained
Bacterium infects liquid.
b）The preparation of purpose plant Arabidopsis thaliana
By Columbia ecotype arabidopsis Col-0（Purchased from Salk Institute Genomic Analysis
Laboratory）Transplant about 4 weeks or so, start after bolting, the head by main inflorescence without stem leaf is removed, promote its side life flower
Sequence grows, and treats that side life inflorescence starts to bloom, can be used for conversion.
C) convert
By step 2）The whole strain of arabidopsis tipped upside down on together with flowerpot and fill 250ml steps 1）The Agrobacterium of preparation infects liquid
Container in soak conversion；Arabidopsis plant side is put in pallet, covered with black plastic cloth, plastic cloth is taken off after one day
Open, flowerpot is uprightly placed, carry out normal illumination cultivation, collect the T1 of maturation for seed.
d）Resistance seedling is screened
After T1 is for seed disinfection, it is laid on MS solid mediums and (contains 50 μ g/ml kanamycin sulfates), 4 DEG C of vernalization 2-3
My god, 21 DEG C culture 10 days after select resistant plant move into soil in, after 30 days by individual plant harvest T2 for seed.According to same side
Screening T2 is for seed for method plantation, and it is 3 to transplant Resistant segregation ratio:1 T2 is for strain 3, and individual plant harvests T2 for each list in strain
T3 is tied in strain for seed, takes 16 T3 to carry out resistance screening after the same method for strain seed at random, 6 T3 generations are obtained
No longer produce the Transgenic wheat line of Resistant segregation.T3 is taken to be carried out on behalf of the plant of Transgenic wheat line or seed a large amount of numerous
Kind, for follow-up PCR identifications and phenotypic evaluation.
T1, which is represented, shows the contemporary plant selfing seed obtained of conversion and the plant grown up to by it；T2, which is represented, shows T1 for selfing
The seed of acquisition and the plant grown up to by it；T3, which is represented, shows the seed that T2 is obtained for selfing and the plant grown up to by it.
2）The PCR identifications of transgenic Arabidopsis plants
Take T3 generations no longer to produce the Transgenic wheat line plant leaf extraction genomic DNA of Resistant segregation, use primer
KanF and KanR enter performing PCR amplification, and prediction primer size is 500bp.Primer KanF and KanR sequence are as follows：
KanF：5’-CACTGAAGCGGGAAGGGACT-3’
KanR：5’-CGATACCGTAAAGCACGAGGAA-3’
PCR qualification results show that the T3 of selection is all positive for transgenic Arabidopsis plants；The PCR mirror of plant part
Determine result and see Fig. 2.
3）The Salt-Tolerance Identification of transgenic Arabidopsis plants
The T3 of the positive will be accredited as Transgenic wheat line（TL1-TL6）With wildtype Arabidopsis thaliana Col-0（WT）Kind
Son, after 0.5%NaClO solution disinfections, is plated on MS solid medium flat boards, vernalization 3 days under the conditions of 4 DEG C, then turn respectively
Greenhouse is moved to, 21 DEG C of illumination cultivations moved to seedling containing various concentrations after 4 days（0、100、150、200mM）NaCl with it is difference dense
Degree（1、75、100、125μM）Cultivated 10 days in ABA MS solid mediums, weigh single-strain fresh weight（Including root, stem and leaf）, each strain
System sets 3 repetitions, each to repeat 20-40 young plants.
The Salt-Tolerance Identification result of transgenic Arabidopsis plants represents with the form of mean+SD, such as table 1, table 2.
Table 1, transgenic Arabidopsis plants are through the single-strain fresh weight after salt stress 10 days（Unit：mg）
Note：* in table 1 is represented compared with the WT plant under same concentration NaCl stress conditions, as a result in the differences of p ＜ 0.05
Reach the level of signifiance；* is represented compared with the WT plant under same concentration NaCl stress conditions, is as a result extremely shown in the differences of p ＜ 0.01
Write；# in table represents that same strain plant fresh weight under different NaCl stress conditions compares, and is as a result reached in the differences of p ＜ 0.05
The level of signifiance；## represents that same strain plant fresh weight under different NaCl stress conditions compares, and as a result extremely shows in the differences of p ＜ 0.01
Write.
The result of table 1 carries out Multiple range test using Duncan methods to data.As a result show, under the conditions of normal incubation medium, turn
Gene strain plant fresh weight is with WT plant without significant difference；But with the rise of NaCl concentration, transgenic line is planted with WT
Strain fresh weight performance is notable（It is extremely notable）Difference.Illustrate that the arabidopsis thaliana salt-tolerance for turning GhGeBP genes is improved.
Phenotype is also different under the conditions of same transgenic line ties up to NaCl stress, by 6 transgenic line fresh weights
It is compared, it is found that G2121 and G2131 strains plant strain growth is influenceed smaller by NaCl.
Table 2, transgenic Arabidopsis plants through ABA coerce 10 days after single-strain fresh weight（Unit：mg）
Note：* in table 2 is represented compared with the WT plant under same concentration ABA stress conditions, as a result in the differences of p ＜ 0.05
Significantly；* is represented compared with the WT plant under same concentration ABA stress conditions, as a result extremely notable in the differences of p ＜ 0.01；In table
# represent that same strain plant fresh weight under different ABA stress conditions compares, as a result in the significant differences of p ＜ 0.05；## represents same
One strain plant fresh weight under different ABA stress conditions compares, as a result extremely notable in the differences of p ＜ 0.01.
The result of table 2 carries out Multiple range test using Duncan methods to data.As a result show, under the conditions of normal incubation medium, turn
Gene strain plant fresh weight is with WT plant without significant difference；But with the rise of ABA concentration, transgenic line and WT plant
Fresh weight performance is notable（It is extremely notable）Difference.Illustrate that transgenic arabidopsis can improve the tolerance coerced ABA.
Same transgenic line, which is tied up to, shows also different under various concentrations ABA stress conditions, 6 transgenic lines compare,
The plant strain growth of G2103, G2119 and G2131 strain is not coerced by ABA to be influenceed, and G2121 transgenic lines tie up to ABA presence
Under the conditions of increment increase, the strain can further further investigate its response mechanism.
Claims (12)
1. it is the protein of the amino acid sequence composition shown in the SEQ ID No.2 in sequence table a kind of protein.
2. the encoding gene of protein described in claim 1.
3. encoding gene according to claim 2, it is characterised in that：Such as sequence table of the nucleotide sequence of the encoding gene
Shown in 88-1254 of middle SEQ ID No.1.
4. the recombinant vector containing the encoding gene described in Claims 2 or 3.
5. recombinant vector according to claim 4, it is characterised in that：The recombinant vector is recombinant expression carrier or restructuring
Cloning vector.
6. the expression cassette containing the encoding gene described in Claims 2 or 3.
7. the Host Strains containing the encoding gene described in Claims 2 or 3.
8. the encoding gene described in protein, Claims 2 or 3 described in claim 1, the restructuring described in claim 4 or 5
Host Strains described in expression cassette or claim 7 described in carrier, claim 6 it is following it is at least one in application：
1) plant salt stress response is adjusted；The regulation plant salt stress response is that the salt tolerance for making plant strengthens；
2) plant ABA stress responses are adjusted；The regulation plant ABA stress responses are that the resistance to ABA for making plant strengthens.
9. described in any described encoding gene of protein, claim 2-3, claim 4 or 5 described in claim 1
The answering in genetically modified plants are cultivated of the Host Strains described in expression cassette or claim 7 described in recombinant vector, claim 6
With；The genetically modified plants have following at least one character：1) the salt tolerance enhancing of plant；2) the resistance to ABA enhancings of plant.
10. a kind of method for cultivating genetically modified plants, is that any described encoding genes of claim 2-3 are imported into purpose to plant
Thing, obtains genetically modified plants；The genetically modified plants are compared with the purpose plant, with following at least one character：1) plant
The salt tolerance enhancing of thing；2) the resistance to ABA enhancings of plant.
11. method according to claim 10, it is characterised in that：The purpose plant is that dicotyledon or unifacial leaf are planted
Thing.
12. method according to claim 11, it is characterised in that：The dicotyledon is arabidopsis or cotton.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310538033.7A CN104610438B (en) | 2013-11-04 | 2013-11-04 | One grows cotton stress response GAP-associated protein GAP GhGeBP and its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310538033.7A CN104610438B (en) | 2013-11-04 | 2013-11-04 | One grows cotton stress response GAP-associated protein GAP GhGeBP and its encoding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104610438A CN104610438A (en) | 2015-05-13 |
| CN104610438B true CN104610438B (en) | 2017-10-13 |
Family
ID=53145113
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310538033.7A Active CN104610438B (en) | 2013-11-04 | 2013-11-04 | One grows cotton stress response GAP-associated protein GAP GhGeBP and its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104610438B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111321144B (en) * | 2020-03-06 | 2021-07-27 | 中国农业科学院棉花研究所 | Application of Asian cotton miR172c in regulation and control of response of target plants to salt stress |
| CN113215188B (en) * | 2021-04-29 | 2023-05-16 | 上海师范大学 | Method for improving powdery mildew resistance and pathogen infection of China rose |
| CN117447572A (en) * | 2023-11-17 | 2024-01-26 | 中国农业大学 | Sea island cotton fusarium wilt resistance protein GbOFP7 and encoding gene and application thereof |
-
2013
- 2013-11-04 CN CN201310538033.7A patent/CN104610438B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| "Expression Profile of Early Responsive Genes Under Salt Stress in Upland Cotton (Gossypium hirsutum L.)";Xi Zhang et al.;《Plant Mol Biol Rep》;20110125;第29卷(第3期);第627-628页的材料与方法，第632页右栏第2段，第633页左栏第2段，表3 * |
| GeBP, the first member of a new gene family in Arabidopsis encodes a nuclear protein with DNA-binding activity and is regulated by KNAT1;Julien Curaba et al.;《The Plant Journal》;20030116;第33卷(第2期);305-317 * |
| Overexpression of a Common Wheat Gene TaSnRK2.8 Enhances Tolerance to Drought, Salt and Low Temperature in Arabidopsis Temperature in Arabidopsis;Hongying Zhang et al.;《PLOS ONE》;20101230;第5卷(第12期);1-12 * |
| 棉花盐胁迫应答基因GhCPK5的克隆及序列分析;甄军波等;《中国农业大学学报》;20110615;第16卷(第3期);8-14 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104610438A (en) | 2015-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101955521B (en) | Plant stress tolerance associated protein, and coded genes and application thereof | |
| CN107937416A (en) | Improve gene and its application of nitrogen fertilizer for paddy rice utilization ratio and yield | |
| CN107827964A (en) | A kind of transcription factor PwNAC2 related to plant stress tolerance and its encoding gene and application | |
| CN106399323A (en) | Paddy rice leaf color regulation and control gene YL1 and use thereof | |
| WO2020221029A1 (en) | Zea mays receptor-like kinase gene zmrlk7 and use thereof | |
| CN103288944B (en) | Protein bHLH17 (Basic Helix Loop Helix 17) as well as coding gene and application thereof | |
| CN106480163B (en) | A method of joint apple callus cell culture and genetic transformation identify apple disease-resistant gene | |
| CN111087457B (en) | Protein NGR5 for improving nitrogen utilization rate and crop yield, and coding gene and application thereof | |
| Yang et al. | Genetic transformation and expression of transgenic lines of Populus× euramericana with insect-resistance and salt-tolerance genes | |
| CN104610438B (en) | One grows cotton stress response GAP-associated protein GAP GhGeBP and its encoding gene and application | |
| CN110713994B (en) | Plant stress tolerance associated protein TaMAPK3, and coding gene and application thereof | |
| CN109971766A (en) | A kind of and plant stress tolerance-associated protein PwRBP1 and its encoding gene and application | |
| CN113621625A (en) | Application of sesame SiERF103 gene in enhancing plant resistance | |
| CN103288943B (en) | Protein bHLH13 (Basic Helix Loop Helix 13) as well as coding gene and application thereof | |
| CN104140462B (en) | Plant salt endurance associated protein GhSnRK2-6 and encoding gene thereof and application | |
| CN106892973A (en) | Plant adversity resistance related protein GhMYB4 and encoding gene and application | |
| CN108752442A (en) | Color potato salt tolerance correlation StDof2 albumen and its encoding gene and application | |
| CN103588867B (en) | Soybean transcription factor GmMYB174a, and coding gene and applications thereof | |
| CN105802931A (en) | CRK4 protein and application of coded gene thereof in regulating and controlling growth of plant stems and leaves | |
| CN103172717B (en) | Plant low potassium stress resistant related protein GmWRKY50 as well as encoding gene and application thereof | |
| CN106191073A (en) | HOX3 gene purposes in improvement cotton fiber elongation character | |
| CN102732553B (en) | Improve the gene engineering method and material of plant products | |
| CN104628840B (en) | Plant stress tolerance related protein VrDREB2A, coding gene and application thereof | |
| CN104861051B (en) | Plant development associated protein AtUBP15 and its encoding gene and application | |
| CN103172718B (en) | Plant low nitrogen stress resistant related protein GmDUF-CBS and encoding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |