CN108018369A - Initiative, detection and the application of corn transformation event ZM2-104 - Google Patents

Abstract

The application belongs to plant biotechnology field, there is provided is named as corn gene event and its detection and the application of ZM2 104.Provide primer pair, primer pair combination and the method for detecting the transgenic event.Additionally provide and obtain the method for various transgenic materials and the offspring of generation and its product by donor of the plant comprising the transgenic event.

Description

Initiative, detection and the application of corn transformation event ZM2-104

Technical field

This application involves plant biotechnology field, and in particular, to a kind of anti-snout moth's larva herbicide-resistant glufosinate-ammonium transgenosis The development of corn transformation event and detection method.

Background technology

Corn borer is commonly called as corn stalk borer, and it is one of important biomolecule disaster for causing the long-term underproduction of corn that it, which is endangered, seriously Influence the yield and quality of corn, including Ostrinia furnacalis (Ostrinia furnacalis) and European corn borer (Ostrinia nubilalis).China is the multiple area and repeating transmission area of Ostrinia furnacalis (Ostrinia furnacalis), almost every two years It is extensive to occur once.General time corn is endangered underproduction 10%-15% by corn borer, the outbreak year underproduction up to 30% with On, or even total crop failure.Because of the harm of corn borer, the corn lost every year just reaches ten thousand tons of 600-900.Corn borer not only directly contributes jade Rice production loss, but also the generation of maize kernel rot is induced and aggravates, make the quality decline of corn.

The major way of prevention corn borer is still based on pesticide control at present.A large amount of uses of pesticide, had both increased plantation Cost, and destroy ecological environment.The insecticidal crystal egg of bacillus thuringiensis (Bacillus thuringiensis, abbreviation Bt) There is special poisoning to the different insects (such as Lepidoptera, coleoptera, Diptera) including corn borer and invertebrate in vain Effect.By cultivating the pest-resistant corns of transgenosis Bt, can effectively preventing corn insect pest, reduce the use of agricultural chemical insecticide, draw Production loss is returned, increases agricultural incomes, mitigates environmental hazard.

Weeds in field and crop competition water, fertilizer, luminous energy and growing space, while be in damage to crops germ and pest again Between host, be one of important biological restriction factor of crop yield.The crop area that China is seriously endangered by weeds throughout the year is high Up to 1,200,000,000 mu, wherein 1.9 hundred million mu of corn.As people in the countryside are toward the quickening of urban migration speed, the scale of corn planting and Mechanization is a foreseeable trend, this causes the method for traditional artificial weeding to become unrealistic.Currently, it is widely used Selective herbicide amount of application is big, and residual life is long, easily influences the normal growth of second stubble crop.The total weed controls such as glufosinate-ammonium Agent has the characteristics that efficient, less toxic, degradable, noresidue, but their weedings are without selectivity, it is impossible to is directly used in the life of crop For a long time.The corn of resistance to steriland herbicide is cultivated by transgenic technology can overcome this problem, i.e., sprayed in corn growth stage Applying 1-2 times just can solve all weed problems, reduce the dosage and input cost of herbicide.The research such as M é ndez (2011) hair Existing, herbicide-resistant transgenic corns per hectare can save 102 dollars of weeding cost, and then to improve 22% (pest-resistant and resistance to for yield Herbicide bivalent transgenosis).It is not only able to improve corn to the resistance of some insect pests and certain herbicide by transgenic technology Patience, while production loss can also be retrieved, increase corn per unit area yield and reduce production cost.

Plant transgene breeding technique have purpose is strong, the cycle is short, efficient, can realize excellent base between different plant species The advantages that transfer of cause.Since first genetically modified crops commercialization in 1996, this technology is brought for Global Agriculture Huge change.Global genetically modified crops cultivated area reaches 1.815 hundred million hectares within 2014, is 1996 annual planting areas More than 100 times.In terms of transformation technology, particle gun and agrobacterium-mediated transformation are the main conversions of transgenic insect-resistant corn research and development application Method.Agrobacterium-mediated transformation is easy to operate, and conversion ratio is higher, and expense is low, is the method for transformation being most widely used at present.In base Because in terms of selection, still to prevent based on the genes such as cry1Ac, cry1F of Lepidoptera maize borer, but existing multiple there is elytrum The strain of mesh resistance such as MON88017 etc., and obtain the input such as anti-corn root nematode strain such as MON863 using cry3 genoids Commercially produce.The scope of target insect has gradually been widened in this explanation anti insect gene selection, increases the choosing to gene pest-resistant spectrum Select.With the application of genetic modification technology, commodity production is also entered using the transgenic Bt corn of codon optimization, such as MON810, MON89034 of Monsanto Chemicals etc..In world wide, have within 1996 more than 40 so far and plant transgenic Bt Corn is commercially produced or feed food processing by 26 state approvals input.

Known in those skilled in the art, expression of the foreign gene in plant has position effect, that is, is inserted into The influence of chromosome position, this influence are probably the transcription regulatory element near structure or integration site due to chromosome Caused by influence.It is thus typically necessary to produce hundreds of different transformation events, and foreign gene is filtered out from these events The excellent transformation event that expression and pattern meet the expected requirements, to achieve the purpose that to commercially produce application.Excellent turns Change event by way of conventional breeding methods, that is, sexual hybridization by the germplasm of GM plant bred by crossing to other genetic backgrounds, its Offspring maintains the transgene expression characteristic of original transformant.This strategy is widely used to have certain annidation In improved seeds with achieve the purpose that increase merit.

The content of the invention

The application is by the anti-corn borer gene (cry1Ab/cry1AcZM) of Dipel (BT) and herbicide glufosinate-ammonium patience Gene (bar) is transferred in the genome of maize elite inbred line by agrobacterium-mediated transformation, obtains a pest-resistant resistance to weeding Agent corn transformation event ZM2-104.

In addition, establish particularly significant to the method for transformation event progress specific detection.On the one hand, specific conversion is detected The presence of event be to determine in the filial generation of sexual hybridization whether the effective means containing target gene；On the other hand, for measuring The method of particular event will be helpful to observe Transgene-safty management rules, such as require to come from the commercialization kind of genetically modified crops Plant, the license of sale of processed goods etc. and mark regulations.By nucleic acid detection method well known in the art, including it is but unlimited In carrying out PCR amplification or using the DNA hybridization of nucleic acid probe using polynucleotide primers come to detect the presence of transgenosis be possible 's.In general, the DNA primer sequence of detection genetically modified plants is simple and consistent with method, detection target sequence is often concentrated In the gene expression element frequently used, such as promoter, terminator and marker gene.Therefore, carried for distinguishing identical conversion The different transformation events that body produces need to obtain the sequence information of unique " flanking DNA ".Corn transformation event is carried out special Property detection, preferably can exercise supervision transgenic corn events, parent, filial generation its product management.

On the one hand, this application provides the nucleic acid molecules of corn transformation event ZM2-104, it is selected from：Include SEQ ID NO:The nucleic acid molecules of nucleotide sequence shown in 2 or its fragment or its variation or its complementary series.

On the other hand, this application provides detection corn transformation event ZM2-104 nucleic acid molecules primer pair or draw The combination of thing pair, it is selected from：

Primer pair, it includes specific recognition SEQ ID NO:The sequence of its 1-255 nucleotide is included in sequence shown in 2 A primer and specific recognition SEQ ID NO for row:The sequence of its 256th to 7008 nucleotide is included in sequence shown in 2 Or another primer of complementary series；And/or

Primer pair, it includes specific recognition SEQ ID NO:Its 256th to 7008 nucleotide is included in sequence shown in 2 Sequence a primer and specific recognition SEQ ID NO:The sequence of its 7009-7272 nucleotide is included in sequence shown in 2 Another primer of row or complementary series.

In one embodiment, above-mentioned primer pair is selected from：

Primer pair (1)

SEQ ID NO:3(FW-csp2267):5 '-TGCGTCCTAAATTGTCAGTT-3 ',

SEQ ID NO:4(RV-csp2526):5’-ACTTAGACATGCAATGCTCA-3’；

Primer pair (2)

SEQ ID NO:3(FW-csp2267):5 '-TGCGTCCTAAATTGTCAGTT-3 ',

SEQ ID NO:14(RV-csp2344):5’-TATAGGGTTTCGCTCATGTG-3’；

Primer pair (3)

SEQ ID NO:7(FW-csp2529):5 '-ACTGTTTCTTTTGTCGATGC-3 ',

SEQ ID NO:10(RV-csp2424):5’-TCCCAAAAGCAACCAGTATT-3’；

With primer pair (4)

SEQ ID NO:9(FW-csp2423):5 '-GGCTAGTATCTACGACACAC-3 ',

SEQ ID NO:10(RV-csp2424):5’-TCCCAAAAGCAACCAGTATT-3’。

On the other hand, this application provides the method for identifying transformation event ZM2-104 in biological sample, it includes Use the combination of above-mentioned primer pair or primer pair.

On the other hand, this application provides the kit or microarray for detecting corn transformation event ZM2-104, its Include the combination of above-mentioned primer pair or primer pair.

On the other hand, the combination this application provides above-mentioned primer pair or primer pair or above-mentioned kit or Application of the microarray in corn transformation event ZM2-104 is detected.

On the other hand, this application provides existing for transformation event ZM2-104 in detection biological sample or its offspring Method, it includes：

Biological sample is provided, and from the extraction from biological material DNA；

The combination of foregoing primer pair or primer pair is provided；

DNA amplification reaction is carried out using above-mentioned primer pair；With

Detect the sub- molecule of DNA cloning that the DNA amplification reaction produces, wherein the sub- molecule of the DNA cloning there are table The presence of bright transformation event ZM2-104,

Wherein described transformation event ZM2-104 is that exogenous DNA is introduced into plant so as to produce SEQ ID in plant NO:The DNA of 2 sequences.

On the other hand, this application provides separated DNA molecular, it includes any amplification produced by the above method Son.

On the other hand, this application provides contain SEQ ID NO:Purposes of 2 transgenic corns in breeding, optionally The ground breeding includes by pollen cultures, haploid embryo culture, doubles culture, cell culture, tissue cultures, selfing or hybridization Or more combination obtain progeny plants.On the other hand, this application provides made made of the plant that such use produces Product, optionally described product are food, feed or the raw material of industry.

On the other hand, this application provides genetically modified plants, it includes transformation event ZM2-104.

On the other hand, this application provides pass through pollen with the transgenic corn plant containing transformation event ZM2-104 Culture, haploid embryo culture, double the offspring that the combination of culture, cell culture, tissue cultures, selfing or hybridization or more obtains Plant.

Transformation event ZM2-104 described herein is directed to be introduced into exogenous DNA in plant so as to produce SEQ in plant ID NO:The DNA of 2 sequences.In SEQ ID NO:In 2 sequences, 1-255 nucleotide and 7009-7272 nucleotide are jade Intrinsic sequence in rice genome sequence, 256-7008 nucleotide are external source insert sequence.

In addition, present invention also provides the method that control of insect and Weeds distribution are carried out using above-mentioned corn transformation event.

Brief description of the drawings

Figure 1A is the structure diagram of carrier pZZ01194；Figure 1B is the structure diagram of carrier pZZ01206；Fig. 1 C are The structure diagram of carrier pZZ00015；Fig. 1 D are the structure diagram of carrier pZHZH25018；Wherein

Patience type (T) and the performance of responsive type (S) maize leaf after Fig. 2 smears for glufosinate-ammonium.

Fig. 3 A are the anti-Ostrinia furnacalis worm identification of transformed plant blade.R is pest-resistant；S is sense worm；Fig. 3 B are transformed plant stem The anti-Ostrinia furnacalis worm identification of bar.R is pest-resistant；S is sense worm.

Fig. 4 is Southern hybridization figures.1st and 5 swimming lanes are negative control auspicious 249；9th swimming lane is positive control；2nd, 3rd, 4 are and HindIII digestion DNA hybridization results；6th, 7,8 swimming lanes be and NcoI digestion DNA hybridization results；M is molecular weight mark Remember swimming lane, there is base logarithm to mark (kb).333bp probes come from cry1Ab/cry1AcZM partial sequences, and These positive bands are respectively 6kb (HindIII) and 12.5kb (NcoI), shows the copy insertion of foreign gene unit point list.

Fig. 5 is inserted into Maize genome schematic diagram for pZHZH25018 carriers T-DNA.Left side insertion point is positioned at No. 2 dyeing Body 15342865bp；Right side insertion point is located at No. 2 chromosome 15342925bp；Pass through 4 pairs of primer amplifications, cloned DNA fragments And sequencing, demonstrate left side flap primer pair and answer area, insetion sequence area and right side flap primer pair answer area.

Fig. 6 A show left side flap primer PCR positive reaction specificity.Swimming lane 1-4 be respectively sterile water, auspicious 249DNA, ZM2-104DNA, other same carrier difference transformation event DNA, only ZM2-104 genomic DNAs swimming lane 3 have with high-visible.

Masterplate DNA sample-adding amounts when Fig. 6 B show the reaction of left side flap primer PCR, swimming lane 1-6 is respectively 0.1,0.5,1.0, 5.0、10.0、15ng；Amplicon band is high-visible when swimming lane 2 shows 0.5ng masterplates.

Fig. 7 A show right side flap primer PCR positive reaction specificity.Swimming lane 1-4 be respectively sterile water, auspicious 249DNA, ZM2-104DNA, other same carrier transformation event DNA, only ZM2-104 genomic DNAs swimming lane 3 have with high-visible.

Masterplate DNA sample-adding amounts when Fig. 7 B show the reaction of right side flap primer PCR, swimming lane 1-6 is respectively 0.05,0.1,0.5, 1.0、5.0、10.0ng；Amplicon band is high-visible when swimming lane 2 shows 0.1ng masterplates.

Embodiment

Defined below and method is provided preferably to define the application and instruct this area general in the application practice Logical technical staff.Unless otherwise mentioned, term understands according to the common usage of person of ordinary skill in the relevant.It is cited herein All patent documents, scientific paper, professional standard and other public publications etc., full content therein is integrally incorporated herein As reference.

As used herein, " corn " be any corn plant and including can with all plant varieties of corn breeding, wrap Including whole plant, plant cell, plant organ, plant protoplast, plant can therefrom regenerated Plant cell and tissue culture Complete plant cell in thing, plant callus and plant or plant part, the plant part such as embryo, pollen, embryo Pearl, seed, leaf, flower, branch, fruit, cane, root, the tip of a root, flower pesticide etc..

This application involves transformation event ZM2-104 refer to pass through transgenosis with corn inbred line auspicious 249 for acceptor, obtain The plant of foreign gene insert (T-DNA inserts) is inserted between specific gene group sequence.In instantiation, turn Gene expression carrier used thereof has SEQ ID NO:Sequence shown in 1, obtained T-DNA inserts have SEQ ID after transgenosis NO:Sequence shown in 2 256-7008 nucleotide.Transformation event ZM2-104 can refer to this transgenic protocol, can also refer to By the T-DNA inserts in the obtained genome of this process, or the combination of T-DNA inserts and flanking sequence, or can be with Refer to the plant obtained by this transgenic protocol.In instantiation, which is also applied for same expression vector (SEQ ID NO:1) other acceptor kinds are converted, so that the plant that T-DNA inserts are inserted into same genomic locations and are obtained Thing.Transformation event ZM2-104 can also refer to by above-mentioned plant carry out vegetative propagation, generative propagation, it is double-diminished or double breeding or with On combination obtained from progeny plants.

In this application, applicant is obtained with SEQ ID NO:2 1-255 nucleotide and 7009-7272 Nucleotide is T-DNA inserts (the SEQ ID NO of flanking sequence:2 256-7008 nucleotide).Flanking sequence is not only It is limited to SEQ ID NO:2 1-255 nucleotide and 7009-7272 nucleotide, because the flanking sequence listed only is For representing position of the T-DNA inserts in genome, i.e. left side insertion point is located at No. 2 chromosome 15342865bp；It is right Side insertion point is located at No. 2 chromosome 15342925bp.Therefore the application flanking sequence can according to genome sequence and to Both sides extend.

Since transformation event ZM2-104 produces the T-DNA inserts that specific site is inserted into genome, it is inserted into Site is specific, can be used for detecting in biological sample whether include transformation event ZM2-104.Therefore, it is possible to specificity Detect primer pair, probe and the primer pair of the T-DNA inserts of transformation event ZM2-104 and the bond site of flanking sequence Combination with probe is used equally for the transformation event ZM2-104 of detection the application.

As used herein, " nucleotide sequence " includes the deoxyribonucleotide or ribose core for being related to single-stranded or double-stranded form Thuja acid polymer, and write from left to right with 5 ' to 3 ' directions unless otherwise limitation, nucleotide sequence.

In some embodiments, the nucleic acid fragment of the application can be changed, to carry out conserved amino acid replacement. In certain embodiments, amino can not be changed to the nucleotide sequence of the application according to unifacial leaf codon preference The replacement of acid sequence, such as the codon of monocotyledon preference can be used to replace codon of the coding with amino acid sequence, Without changing the encoded amino acid sequence of the nucleotide sequence.

In some embodiments, the application further relates to the variation of nucleic acid fragment.In general, the change of specific nucleic acid fragment Body will with the specific nucleotide sequence have at least about 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%th, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% or higher sequence it is same Property, or more complementary series.Such variant sequence thereof includes addition, missing or the replacement of one or more nucleic acids, from And the addition, removal or replacement of corresponding amino acid residue can be caused.Pass through alignment programs bag known in the art Include hybridization technique and determine sequence identity.The difference of the nucleotide sequence variants of embodiment and the sequence of the application may be as few as 1-15 nucleotide, as little as 1-10 (such as 6-10), as little as 5, as little as 4,3,2 or even 1 nucleotide.

As used herein, " probe " be addition of conventional detectable mark or report molecule such as radio isotope, The separated polynucleotides of ligand, chemiluminescent agent or enzyme, the chain of itself and target polynucleotide is complementary.

As used herein, " primer " is separated polynucleotides, it hybridizes to be formed between primer and target dna strand by nucleic acid Crossbred and anneal with complementary target dna strand, then by such as archaeal dna polymerase along target DNA chain-unfolding.Primer pair is related to it Target polynucleotide expands purposes, such as passes through polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

As used herein, " kit " or " microarray " refers to for corn transformation event ZM2-104 in biological sample The reagent set or chip of the purpose of identification and/or detection.For in quality control (such as purity of seed batch), vegetable material or It is such as, but not limited to the inspection of event ZM2-104 in food or feed product comprising vegetable material or from the material of vegetable material The purpose of survey, can use kit or chip, and its component can be adjusted specifically.

Following embodiments are used to illustrate the present invention, but are not limited to the scope of the present invention.Without departing substantially from spirit of the invention In the case of essence, the modifications or substitutions made to the method for the present invention, step or condition belong to scope of the present application.If Without specializing, embodiment is according to conventional laboratory conditions, such as the molecular cloning experiment handbook (Sambrook of Sambrook et al. J&Russell DW,Molecular cloning:A laboratory manual, 2001), or according to manufacturer's specification It is recommended that condition.Unless otherwise specified, chemical reagent used in embodiment is conventional commercial reagent, used in embodiment The conventional means that technological means is well known to those skilled in the art.

The acquisition and identification of 1. transgenic corns ZM2-104 of embodiment

The acquisition of transgenic event ZM2-104 comprises the following steps with identification：

(1) artificial synthesized anti-Lepidoptera maize borer gene DNA sequence cry1Ab/cry1AcZM, structure contain pest-resistant base The conversion carrier pZHZH25018 of cause and the screening-gene of resistance to glufosinate-ammonium bar；

(2) conversion carrier in step (1) is imported into corn inbred line by agrobcterium-mediated transformation In auspicious 249, obtain transformation seedlings and cultivate and arrive greenhouse；

(3) by step (2) transformation seedlings carry out Molecular Identification, choose low copy number (1-2) and do not contain or containing compared with The T0 of few carrier DNA for plant selfing or test cross and harvests seed (T1 generations)；

(4) transformation seedlings that will be selected in step (3), carry out Resistance Identification using blade partial smearing method, verify resistance to weeding Agent is horizontal；

(5) transformation seedlings in step (4) are carried out anti-maize borer excised leaf using partial blade to identify, assesses resistance Performance and Agronomic；

(6) T1 in step (3) is sprouted for seed, herbicide spraying is chosen resistant plant sampling and carried out after emerging 20 days PCR is analyzed, and obtains single copy insertion transgenic corns strain of homozygosis, selfing harvest seed (T2 generations)；

(7) T2 in step (6) is sprouted for seed, seedling stage carries out herbicide-resistant glufosinate-ammonium identification again, systematically into The anti-maize borer identification of row excised leaf, in vitro filigree and the anti-snout moth's larva identification of live body of plastic greenhouse, are carried out at the same time economical character Assessment；

(8) T2 selected in step (7) is subjected to southern hybridization analysis insertions for seedling, extracting leaves genomic DNA The copy number of gene；

(9) by the T2 selected in step (8) for seedling, the flanking sequence that insertion gene is carried out using leaf DNA is analyzed, obtained The data of gene left margin and right margin flanking sequence is inserted into, designs synthetic primer, amplification insetion sequence and flank border sequence, Determine the chromosome position that transformation event occurs.

Each step is discussed further below.

The design and synthesis of 1-1. anti insect genes

The gene of the application by by fusion with transformation 608, Cry1Ab and Cry1AcN ends amino acid sequence based on, And with the codon substitutions coded sequence of plant-preference.Eliminate the richness for causing plant transcription unstable present in DNA sequence dna Sequence containing AT and common restriction enzyme site, then carry out correction elimination by the method for permutation cipher；And at 3 ' ends Plus terminator codon TAA, a DNA sequence dna transformed is obtained；Determine the Bt genes such as sequence SEQ of simultaneously chemical synthesis transformation ID NO:1.The protein of improved DNA sequence encoding contains 3 function sections, wherein two functional areas very high homologies of N-terminal In Cry1Ab corresponding parts, the functional areas very high homology of C-terminal is in Cry1Ac, therefore the application gene is named as cry1Ab/ cry1AcZM.By the sequence (CN1037913C, 1996) and Monsanto transgenic corn events of the sequence and Guo Sandui et al. The Cry1Ab of Mon810 has carried out sequence analysis (the results are shown in Table 1), and calculates G/C content (the results are shown in Table 2).

Table 1.Bt gene DNA sequence tetraploid rices

Sequence names	With the homology of cry1Ab/cry1AcZM
		CN1037913C	74.9%
Mon810	71.4%

Table 2.cry1Ab/cry1AcZM and nearly edge sequence G/C content percentage

Sequence names	GC ratios %
		cry1Ab/cry1AcZM	58
CN1037913C	48
		Mon810	61

1-2. vector construction

According to the needs of the expressing gene function in plant, further to cry1Ab/cry1AcZM gene coding regions above and below Trip has carried out expression optimization design, and the efficiency of intensity and protein translation of the gene on transcriptional level is improved with this, is included in 5 ' ends add Omega (Ω) sequence of one section of 67 nucleotide and the Kozak sequences of 3 nucleotide (acc) be used for strengthening it is true The translation efficiency of karyogene, and one section of poly (A) tail sequence in 3 ' end eukaryote mRNAs, with increase from karyon to born of the same parents The transport of matter and the stability of mRNA and translation efficiency.

In 5 ' the end addition HindIII and PstI restriction enzyme sites of the cry1Ab/cry1AcZM of synthesis, 3 ' end addition PmeI enzymes Enzyme site, and the sequence of synthesis is cloned on Puc57simple carriers, it is named as pZZ01194 (Figure 1A).

The structure of pZHZH25018：

Ubi startups are obtained using carrier pzz00002 of the restriction endonuclease HindIII+BamHI processing containing ubi promoters is limited Sub-piece, uses T₄Archaeal dna polymerase filling-in end.Using restriction endonuclease PstI processing pZZ01194 are limited, T is used₄Archaeal dna polymerase filling-in End, Ubi promoters are connected into by blunt end cloning mode, obtain the carrier containing Ubi-cry1Ab/cry1AcZM fragments, It is named as pZZ01201.

Carrier containing Tocs terminators (there are EcoRI restriction enzyme sites at 5 ' ends, and there are PmeI, EcoRI sites in 3 ' ends), life Entitled pZZ01131, Tocs terminator sequence can be obtained by EcoRI single endonuclease digestions pZZ01131.

EcoRI processing pZZ01131 obtains Tocs and terminates sub-piece, uses T₄The viscous end that archaeal dna polymerase filling-in produces.

PmeI handles pZZ01201, and Tocs terminators are connected into by blunt end cloning mode, and acquisition contains Ubi- The carrier of cry1Ab/cry1AcZM-Tocs fragments, is named as pZZ01206 (see Figure 1B).

It is double by HindIII+PmeI with carrier pCambia3300 (carrying 35s-BAR-T35spolyA elements) for skeleton Digestion adds Ubi-EGFP-T35spolyA elements, obtains carrier pZZ00015 (Fig. 1 C).

HindIII+PmeI handles pZZ01206 carriers, obtains Ubi-cry1Ab/cry1AcZM-Tocs fragments.

HindIII+PmeI handles pZZ00015 carriers, and incision is connected into Ubi-Cry1Ab/Cry1AcZM-Tocs, obtains Expression vector containing two Expression elements of Ubi-cry1Ab/cry1AcZM-Tocs and 35s-BAR-T35spolyA is named as PZHZH25018 (Fig. 1 D), its sequence such as SEQ ID NO:Shown in 1.

The genetic transformation of 1-3. corns

The Plasmid DNA of carrier pZHZH25018 is transformed into Agrobacterium EHA105 by electric shocking method, it is spare after identification.It is beautiful The rataria of length 1.5mm or so is taken to be used to convert after auspicious 249 selfing of rice self-mating system.The rataria for collecting about 200 fruit ears is a collection of It is secondary, it is placed in EP pipes and suspension is suctioned out, add the Agrobacterium bacterium solution containing 200 μM of acetosyringones, co-culture 5 minutes, so Rataria is transferred to afterwards and is co-cultured on base, light culture three days.Rataria after light culture is placed on calli induction media, has been treated After callus is grown, place on the screening and culturing medium of the bialaphos containing 5mg/L, screening and culturing, subculture is once every two weeks.When anti- Property callus when growing, picking out embryo callus subculture in good condition goes on differential medium, and condition of culture is 26 DEG C, daily , when illumination 16 is small, there is regeneration seedling after two weeks in 3000Lux light intensity.Regenerated plantlet is moved on in root media, is treated small After seedling grows two level roots, transplant in being mixed with Nutrition Soil and vermiculite (1：3) in small basin.Leaf sample is taken to extract DNA at the same time, PCR measure determines positive strain, then transplants into big flowerpot, obtains T0 for plant.T0 is selfed or is hybridized for plant T1 is obtained for seed.

1-4.T0 and the analysis and identification of offspring

T1 is seeded in greenhouse for seed, obtains T1 for plant.Insect resistance identification, herbicide-resistant point are carried out to it Analyse, Analysis of agronomic characters, T2 is obtained after pollination self for seed.T2 is seeded in greenhouse for seed, obtains T2 generation plants Strain.Insect resistance identification, herbicide-resistant analysis, Analysis of agronomic characters and Molecular injury are carried out to it, T3 is obtained after pollination self For seed.T3 is seeded in greenhouse for seed, obtains T3 for plant.Insect resistance identification is carried out to it, herbicide-resistant is analyzed, Analysis of agronomic characters and Molecular injury, T4 is obtained after pollination self for seed.

Upgraded according to the pest-resistant and herbicide-resistant characteristic of transformation event and the excellent degree of Agronomic by generation, by T1 liters Level arrives T3, afterwards into intermediate experiment.

(A) herbicide-resistant Characters Identification

Herbicide tolerance is identified：T0 is seeded in greenhouse temperature for positive plant by the seed that selfing or test cross obtain Room, carries out Herbicid resistant identification for plant to 6-8 blade phases T1, removes the plant without resistant gene.Due to cry1Ab/ Cry1AcZM genes and the gene of resistance to glufosinate-ammonium are transformed into recipient corn with T-DNA right boundary sequences.T0 generations With T1 generation selfing in the case of, T2 for strain plant population Herbicid resistant segregation ratio be judge gene pure foundation it One.

It is that Bayer Cropscience (China) Co., Ltd produces to spray herbicide used to protect examination and reach, and active ingredient is 18% grass Ammonium phosphine soluble concentrate.Glufosinate tolerant identification concentration determines：The recommendation dosage of the herbicide (is watered for 150-300ml/ mus 30-40 kilograms), that is, 100-267 times is diluted, therefore the application tries to reach solution and smear have conversion thing using 100 times of diluted protect Two leaves (cutting off blade tip to mark as investigation) of the lobus cardiacus phase (6~8 fully expanded leaves) of part corn.Observed simultaneously after 4-5 days Record herbicide tolerance performance (Fig. 2).The result shows that this experiment obtained the T0 of the high resistance to Glufosinate of a collection of blade for corn and its Offspring.

(B) the anti-snout moth's larva life of transgenic corn plant is surveyed

Worm method is connect using Ostrinia furnacalis (Ostriniafurnacalis) to T1, T2 and T3 plant using lobus cardiacus phase live body Anti- snout moth's larva property has carried out raw survey in field and has tested.

Carry out connecing worm in plant growth and development to lobus cardiacus mid-term (7 blade phase), each plant meets worm 10-20 only.Will About 60, blackhead phase ovum is put into centrifuge tube, and the mouth of pipe is clogged with absorbent cotton.Centrifuge tube is put into 28 DEG C, the incubator of humidity 80% In, or be placed in and cover wet towel moisturizing under room temperature, absorbent cotton is pulled out after pieces of an egg hatching, is launched in lobus cardiacus clump.Connect How much worm, by the killed degree of strain investigation plant lobus cardiacus, according to the worm channel size on killed blade and divides aggrieved etc. after 2-3 weeks Level, referred to as eats leaf level.The 9 grades of grade scales (table 3) formulated mostly using international corn borer cooperative groups in the world at present.By strain Investigation food leaf level, using each strain average value as the food leaf level for identification strain, investigates channel before harvest, and according to table 3 Evaluation criterion determine its anti-snout moth's larva rank.

The anti-snout moth's larva property field test evaluation criterion of 3. corn of table

Note：*.The sum of visible hole count in moth stem tunnel number of the diameter more than 2.5cm and cane is calculated as every plant of hole count.

**HR：Highly resistance；R：It is anti-；MR：Moderate resistance；S：Sense；HS：Height sense

The transformation event that the application selectes averagely eats leaf level to Ostrinia furnacalis worm blade and reaches 1.1-1.4, is highly resistance Rank, is shown in Fig. 3 A, Fig. 3 B and table 4.

Result is surveyed in the food leaf level life of 4. transformant different generations snout moth's larva of table

Transformation event number	From generation to generation	Averagely eat leaf level	Standard deviation
				ZM2-104	T1	1.4*	0.5
ZM2-104	T2	1.1*	0.4
				ZM2-104	T3	1.2*	0.3
Cry1Ab-11	Positive control	1.2*	0.15
				Auspicious 249	Negative control	6.1	1.1

Remarks：1st, strain number n=10 is investigated；" * " represents the significant difference compared with negative control.

2nd, present event transformant System Number (T3：M1433T300122；T2：M1423T200104；T0： M00896A018b)。

The DNA molecular identification of 1-5. transgenic events

(A) PCR is detected

T0 is extracted for transgenic corns genomic DNA using the DNA extraction kit of Tiangeng Biochem Technology, INC..

Following reagent is taken out from -20 degree refrigerators and is thawed：10 times of PCR buffer solutions (Takara), deoxynucleotide mixing Thing (10mM, Sigma), bag expand forward primer SEQ ID NO:12(CSP759)：5’-CACGCAGATTCCAGCGGTCAA-3’； With reverse primer SEQ ID NO:13(CSP760)：5 '-GACGAGGTGAAGGCGTTAGCA-3 ') and maize leaf DNA moulds Plate.After all reagents thaw, the brief centrifugation several seconds, is placed in stand-by on ice.The mixed liquor of PCR reaction systems is prepared, is mixed, The brief centrifugation several seconds.PCR reaction systems (20 μ l)：2 10 times of μ l PCR buffer solutions (Takara), the mixing of 0.5 μ l deoxynucleotides Thing (10mM, Sigma), the 0.8 forward and reverse primer mixtures of μ l (5 μM), 0.2 μ l r-Taq (5U, Takara), 1 μ l maize leafs DNA profiling, remaining is dd H₂O.Mixed liquor is dispensed into the PCR pipe of 200 μ l specifications, 1 μ l template DNAs are added, for not Mark is carried out respectively with sample to distinguish.PCR reaction tubes are put into 9700 type PCR amplification instruments of Thermo, select default PCR Amplification program, bring into operation reaction.PCR response procedures are：94 DEG C of pre-degenerations 2 minutes；30 circulations：94 DEG C be denatured 30 seconds, 58 DEG C annealing 30 seconds, 72 DEG C extend 30 seconds；Last 72 DEG C extend 5 minutes.

After PCR, 5 μ l PCR products are taken to be detected into row agarose gel electrophoresis.1.5% Ago-Gel is prepared, 150V electrophoresis dyeing 10 minutes in Ethidum Eremide (EB) after 25 minutes, take pictures in ultraviolet gel imaging system.cry1Ab/ Cry1AcZM genes are peculiar for conversion carrier, therefore the transfer-gen plant that can amplify the gene specific band is positive plants Strain, otherwise as negative-type.

(B) Southern traces are identified

Probe is prepared using pZHZH25018 Plasmid DNA as template.With SEQ ID NO:12(CSP759)： CACGCAGATTCCAGCGGTCAA and SEQ ID NO:13(CSP760)：GACGAGGTGAAGGCGTTAGCA is primer, is used Roche Holding Ag PCR digoxigenin-probe synthetic agent box (article No.s：11636090910) spy of the synthesis for cry1Ab/cry1AcZM Pin, for 333bp, (probe sequence is shown in SEQ ID NO to probe size:11).Amplification system includes：5 μ L (50pg) of DNA profiling, 0.5 μ L, CSP760 primer of CSP759 primers, 0.5 μ L, PCR DIG mixtures, 5 μ L, 0.75 μ L, PCR buffer solution (10 of archaeal dna polymerase Times) 5 μ L, ddH₂O33.25μL.PCR response procedures are：94 DEG C of pre-degenerations 5 minutes；35 circulations：94 DEG C are denatured 30 seconds, 55 DEG C Annealing 30 seconds, 72 DEG C extend 45 seconds；Last 72 DEG C extend 7 minutes.Treat that PCR amplification finishes, product is solidifying with 1% in 12 DEG C of preservations Glue detection mark effect.Amplified production is the probe with sequence listed above.

The blade genome DNA of transgenic corns T1, T2 or T3 for material is extracted, after the DNA precipitation dryings of acquisition It is dissolved in deionized water, it is spare after measured concentration.

Sample digestion and endonuclease bamhi recycling are carried out, contains 20 μ g corn gene group DNAs, 20 μ l in 200 μ L digestion systems Restriction enzyme (HindIII or NcoI), 20 μ l, 10 times of buffer solutions, add ddH₂O polishings are to 200 μ l.20 μ are taken after digestion 16h L carries out electrophoresis detection, and whether detection digestion effect is thorough.Digestion products add ddH₂O polishings add 1/10 volume to 400 μ l 3M sodium acetate solutions (pH5.2), add the Dr.GenTLE Precipitation Carrier of 4 μ l, 2.5 times of volumes of addition Absolute ethyl alcohol, fully mixes, and 12,000rpm 4 DEG C centrifuge 15 minutes.It will precipitate with 50 μ l ddH₂O dissolves, and adds on 6 times of 5 μ l Sample buffer solution.

DNA is passed through into 0.8% gel, 20V electrophoresis 16h.Cut away unnecessary swimming lane and loading wells, remaining gel denaturing soln Processing 2 times, 15 minutes every time, the jog on shaking table.Handled 2 times with neutralization buffer again, it is 15 minutes every time, light on shaking table Shake.Ultra-pure water cleans once.20 times of SSC are handled 10 minutes, with whatman systems carry out transferring film 4 it is small when more than.

After transferring film, film is placed on the Whatman 3MM filter paper with 10 times of SSC infiltrations, the crosslinking of UV crosslinking instrument 3-5 minutes.Use ddH₂O simply washes film, in air drying.Hybridization and developing process are according to Roche digoxin detection kit I (article No.s：11745832910) operation manual carries out.

This experiment detects exogenous origin gene integrator to the copy number of Maize genome and the similarities and differences of transformation event.Pass through Genomic DNA is respectively cut in HindIII and NcoI restriction endonucleases, has obtained being incorporated into the result of Maize genome copy number (see figure 4).Fig. 4 shows this transformation event T2 for strain corn gene group DNA respectively by HindIII and NcoI digestions and cry1Ab/ Cry1AcZM specific probe molecule results of hybridization, probe length 333bp.1 and 5 swimming lanes are negative control auspicious 249；9 swimming lanes are sun Property control；2nd, 3,4 are and HindIII digestion DNA hybridization results；6th, 7,8 swimming lanes are and NcoI digestion DNA hybridization results；M is point Son amount mark swimming lane, has base logarithm to mark (kb).A These positive bands are shown under the conditions of two kinds of digestions respectively, are respectively 6kb (HindIII) and 12.5kb (NcoI), show the copy insertion of foreign gene list, be single copy transformation event.

(C) size and structure of insetion sequence

The carrier size that the application foreign gene list copy insetion sequence includes right boundary sequence is 6812bp.By dividing The method of section PCR amplification exogenous DNA sequencing, it is 6753bp (SEQ ID NO to determine transformation event insetion sequence actual size:2 256-7008), T-DNA inserts are relative to expression vector SEQ ID NO:1 left end lacks 15bp, and right end lacks 44bp (see SEQ ID NO:Nucleotide 1-15 and 6769-6812 in 1).Above-mentioned 59bp nucleotide is located at the border sequence of noncoding region.It is lacked The integrality of anti insect gene cry1Ab/cry1AcZM and selection markers bar genes is not influenced.CDNA clones are inserted into DNA, sequence point Analysis comparison shows that nucleotide sequence and the carrier T-DNA sequences of 6753bp have the difference of a nucleotide, and A sports G, the alkali Base is located in cry1ab gene codes section, and encoded amino acid becomes serine (AGC), but two by asparagine (AAC) Person is hydrophilic amino acid.

The DNA molecular detection of 2 corn transformation event of embodiment

2-1 left side flap sequence analyses

Take transformation event plant leaf to be measured extraction STb gene (transfer-gen plant of T2 generations or T3 for robust growth), profit The amplification of foreign gene flanking sequence, clone, the sequencing of insertion Maize genome are carried out with connector PCR method, obtains sequence results.

(1) primer needed for artificial synthesized connector PCR, it is spare after dilution；Primer sequence is as shown in table 5.

5. primer sequence of table

(2) high quality corn gene group DNA is prepared, it is spare after dilution；

(3) ddH is used₂Adapter-primer AD-L and AD-S are diluted to 100 μm of ol/L by O respectively, isometric mixing, 94 DEG C of water-baths 4min is denatured, is the connector of 50 μm of ol/L after cooled to room temperature；

(4) digestion corn gene group DNA, digestion system are as follows：

37 DEG C of digestion 3h.

(5) jointing, linked system are as follows：

16 DEG C of connections overnight.

(6) template reacted using genomic DNA digestion-connector connection product in step (5) as first round PCR, instead Answer system such as following table.Response procedures are：94 DEG C, 5min；7 circulations：94 DEG C of 30sec, 72 DEG C of 3min；32 circulations：94℃ 30sec；67℃3min；67℃7min；25℃10min.

6. first round of table PCR reaction systems

Component	Volume (μ L)
		10×PCR Buffer	2
dNTP(10mmol/L)	0.4
		Bar-86(10μM)	0.5
SP1(10μM)	0.5
		rTaq(5U/μl)	0.3
Genomic DNA	2
		ddH2O	To 20 μ L of final volume

(7) the second wheel PCR amplification is carried out for template with first round PCR product (mixed liquor dilutes 40 times).

Table 7. second takes turns PCR reaction systems

Component	Volume (μ L)
		10×PCR Buffer	2
dNTP(10mmol/L)	0.4
		Bar-22(10μM)	0.5
SP2(10μM)	0.5
		rTaq(5U/μl)	0.3
Upper wheel PCR product (40 times of dilution)	2
		ddH2O	To 20 μ L of final volume

Response procedures are：94 DEG C, 5min；5 circulations：94 DEG C of 30sec, 72 DEG C of 3min；30 circulations：94 DEG C of 30sec, 67 ℃3min；67℃7min；25℃10min.

(8) product of the second wheel PCR electrophoresis detection in 1% (w/v) 1 × TAE Ago-Gels is taken, recycles 300bp- DNA fragmentation between 2kb；

(9) fragment of recycling is connected into carrier T, 16 DEG C of connections overnight；

(10) connection product of (9) is converted；

(11) converted product in M13F and M13R primer amplifications (10), and picking positive colony shaking table culture bacterium solution are used, Plasmid DNA is extracted using the TIANprep Rapid small extraction reagent kits of Mini Plasmid Kit rapid plasmids (centrifugation column type)；

(12) Plasmid DNA in (11) is sequenced with sequencing primer, utilized Terminator V3.1Cycle Sequencing Kit carry out sequencing PCR to Plasmid DNA.Sequencing primer is M13F and M13R primers；M13-F： 5 '-TGTAAAACGACGGCCAGT-3 ', M13-R：5’-CAGGAAACAGCTATGACC-3’；

(13) purified with NaAc and absolute ethyl alcohol, the PCR product in formamide denaturation (12)

(14) PCR product that purifying has been denatured in (13) is sequenced using the start of ABI DNA sequencers 3730 and reads survey Sequence result.

(15) sequencing result carries out homologous search in PlantGDB databases with BLASTN instruments and maize genomic sequence Rope, chromosome number and base pair position number using best matching result as insertion point, usual sequence identity is 90- 100%.

Insertion T-DNA left side flap sequence 255bp are detected by this experiment, see sequence SEQ ID NO:2 nucleotide 1- 255.Using corn B73 whole genome sequences as with reference to (http://www.plantgdb.org/ZmGDB/cgi-bin/ BlastGDB.pl), analysis relatively determines that insertion point is located at No. 2 chromosome 15342865bp on the left of the application transformation event, joins See Fig. 5.

2-2 right side flap sequence analyses

According to the sequence results in left side in the application, with reference to corn B73 whole genome sequences (http:// Www.plantgdb.org/ZmGDB/cgi-bin/blastGDB.pl primer) is designed to carry out in conjunction with insertion gene order primer PCR has obtained foreign gene right side flap sequence amplification fragment, is sequenced after clone, obtains right side flap sequence results.

The Maize genome chromosome position according to where obtained sequence, has cloned DNA fragmentation using PCR, has demonstrated Sequence accuracy, is shown in sequence SEQ ID NO:2 nucleotide 7009-7272.

Using corn B73 whole genome sequences as reference, analysis relatively determines that insertion point is located on the right side of the application transformation event No. 2 chromosome 15342925bp, referring to Fig. 5.

Show by sequence analysis, after external source T-DNA is inserted into acceptor gene group, external source T-DNA is sent out on left and right border respectively The missing of 15bp and 44bp are given birth to, i.e. SEQ ID NO:T-DNA inserts (nucleotide 256-7008) and SEQ ID NO in 2:1 Lack 15bp and 44bp respectively compared to left and right end.Further analysis shows, the missing of the DNA fragmentation do not influence anti insect gene The integrality of cry1Ab/cry1AcZM and selection markers bar genes.

In addition, Maize genome missing (that is, the Chr2 at insertion point:15342865-Chr2:15342925), do not have Destroy the endogenous functional gene of any of corn.

The flanking DNA sequence detecting method of 3. transgenic corns ZM2-104 of embodiment

3-1 left side flaps DNA sequence dna detects：Using in the left side flap genome sequence and exogenous sequences of corn transformation event The sequence design of 35S polyA terminators pair of primers (FW-csp2267 and RV-csp2344), establishes transformation event production The qualitative PCR identification method of product.Design is held according to ZM2-104 transformation event foreign DNA fragmentation integration sites LBT-DNA 5 ' Primer is：

SEQ ID NO:3(FW-csp2267):5 '-TGCGTCCTAAATTGTCAGTT-3 ' (Maize genome area),

SEQ ID NO:14(RV-csp2344):5 '-TATAGGGTTTCGCTCATGTG-3 ' (35s PolyA regions)；

Above-mentioned special primer determines optimal annealing temperature under the conditions of 55-65 DEG C using temperature gradient pcr amplified DNA fragment Degree.As a result confirm that with 61 DEG C be optimal amplification temperature；PCR response procedures are 95 DEG C of 5min；35 circulations：94 DEG C of 30s, 55-65 DEG C 30s, 72 DEG C of 1min；72℃7min.

To test above-mentioned primer (FW-csp2267；RV-csp2344) this transformation event of specific amplified characteristic, separate sources Maize dna be used for PCR amplification.PCR reaction conditions and program are 95 DEG C of 5min, and 35 circulate：94 DEG C of 30s, 61 DEG C 30s, 72 DEG C of 1min；72℃7min.The result shows that only this transformation event DNA can have positive findings, other transformation events or Person's negative control corn variety is negative findings (see Fig. 6 A).The DNA fragmentation size 466bp of amplification is with expected consistent, DNA pieces Section cloning and sequencing obtains result also with being expected unanimously.

To test this transformation event total corn DNA minimum amount, above-mentioned special primer is in most preferably amplification 61 DEG C of conditions of temperature Under, amplify purpose fragment using different masterplate DNA sample-adding amounts.PCR reaction conditions and program are 95 DEG C of 5min；35 circulations： 94 DEG C of 30s, 61 DEG C of 30s, 72 DEG C of 1min；72℃7min.The result shows that Maize genome masterplate DNA minimum amounts are 0.5ng (see Fig. 6 B).For the DNA fragmentation size of amplification with expected consistent, DNA fragmentation cloning and sequencing obtains result also with being expected unanimously.

Utilize primer SEQ ID NO:3 (FW-csp2267) and SEQ ID NO:4 (RV-csp2526) can also be amplified This transformation event foreign DNA fragmentation integration site T-DNA left side flaps maize genomic sequence and carrier sequence.PCR reaction conditions It is 95 DEG C of 5min with program；35 circulations：95 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 3min；72℃7min.The DNA fragmentation size of amplification For 2244bp with expected consistent, DNA fragmentation cloning and sequencing obtains result also with being expected unanimously.It can be used for confirming this transformation event.

3-2 right side flaps DNA sequence dna detects：Utilize the sequence of the T-ocs terminators in the exogenous sequences of corn transformation event Pair of primers (FW-csp2423 and RV-csp2424) is devised with right side flap genome sequence, establishes the qualitative of the transformation event PCR identification methods.The primer for holding design according to ZM2-104 transformation event foreign DNA fragmentation integration sites RBT-DNA 5 ' is：

SEQ ID NO:9(FW-csp2423):5 '-GGCTAGTATCTACGACACAC-3 ' (T-ocs regions)；

SEQ ID NO:10(RV-csp2424):5 '-TCCCAAAAGCAACCAGTATT-3 ' (Maize genome area).

Above-mentioned special primer determines optimal annealing temperature under the conditions of 55-65 DEG C using temperature gradient pcr amplified DNA fragment Degree.As a result confirm that with 59 DEG C be optimal amplification temperature (see figure)；PCR response procedures are 95 DEG C of 5min；35 circulations：94 DEG C of 30s, 55-65 DEG C of 30s, 72 DEG C of 1min；72℃7min.

To test above-mentioned primer (FW-csp2423；RV-csp2424) this transformation event of specific amplified characteristic, separate sources Maize dna be used for PCR amplification.PCR reaction conditions and program are 95 DEG C of 5min；35 circulations：94 DEG C of 30s, 59 DEG C 30s, 72 DEG C of 1min circulations；72℃7min.The result shows that only this transformation event DNA can have positive findings, other conversion things Part or negative control corn variety are negative findings (see Fig. 7 A).The DNA fragmentation size 605bp of amplification is consistent with expection, DNA fragmentation cloning and sequencing obtains result also with being expected unanimously.

To test this transformation event total corn DNA minimum amount, above-mentioned special primer is in most preferably amplification 59 DEG C of conditions of temperature Under, PCR reaction conditions and program are 95 DEG C of 5min；35 circulations：94 DEG C of 30s, 59 DEG C of 30s, 72 DEG C of 1min；72℃7min.Expand Increase that the Maize genome masterplate DNA lowest dose levels of purpose fragment be 0.1ng (see Fig. 7 B).The DNA fragmentation size of amplification with it is pre- Phase is consistent, and DNA fragmentation cloning and sequencing obtains result also with being expected unanimously.

Utilize primer SEQ ID NO:7 (FW-csp2529) and SEQ ID NO:10 (RV-csp2424) can also be amplified This transformation event foreign DNA fragmentation integration site T-DNA right side flaps maize genomic sequence and carrier sequence.PCR reaction conditions It is 95 DEG C of 5min with program；35 circulations：95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 3min；72℃7min.The DNA fragmentation size of amplification For 3150bp with expected consistent, DNA fragmentation cloning and sequencing obtains result also with being expected unanimously.It can be used for confirming this transformation event.

The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, without departing from the technical principles of the invention, some improvement and modification can also be made, these are improved and modification Also it should be regarded as protection scope of the present invention.

Sequence table

<110>Chinese subset rolls into a ball Co., Ltd

<120>Initiative, detection and the application of corn transformation event ZM2-104

<130> 15C11923CN

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 6812

<212> DNA

<213>PZHZH25018 carrier sequences

<400> 1

tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 60

gacgttttta atgtactgaa ttaacgccga attaattcgg gggatctgga ttttagtact 120

ggattttggt tttaggaatt agaaatttta ttgatagaag tattttacaa atacaaatac 180

atactaaggg tttcttatat gctcaacaca tgagcgaaac cctataggaa ccctaattcc 240

cttatctggg aactactcac acattattat ggagaaactc gagtcaaatc tcggtgacgg 300

gcaggaccgg acggggcggt accggcaggc tgaagtccag ctgccagaaa cccacgtcat 360

gccagttccc gtgcttgaag ccggccgccc gcagcatgcc gcggggggca tatccgagcg 420

cctcgtgcat gcgcacgctc gggtcgttgg gcagcccgat gacagcgacc acgctcttga 480

agccctgtgc ctccagggac ttcagcaggt gggtgtagag cgtggagccc agtcccgtcc 540

gctggtggcg gggggagacg tacacggtcg actcggccgt ccagtcgtag gcgttgcgtg 600

ccttccaggg gcccgcgtag gcgatgccgg cgacctcgcc gtccacctcg gcgacgagcc 660

agggatagcg ctcccgcaga cggacgaggt cgtccgtcca ctcctgcggt tcctgcggct 720

cggtacggaa gttgaccgtg cttgtctcga tgtagtggtt gacgatggtg cagaccgccg 780

gcatgtccgc ctcggtggca cggcggatgt cggccgggcg tcgttctggg ctcatggtag 840

actcgagaga gatagatttg tagagagaga ctggtgattt cagcgtgtcc tctccaaatg 900

aaatgaactt ccttatatag aggaagggtc ttgcgaagga tagtgggatt gtgcgtcatc 960

ccttacgtca gtggagatat cacatcaatc cacttgcttt gaagacgtgg ttggaacgtc 1020

ttctttttcc acgatgctcc tcgtgggtgg gggtccatct ttgggaccac tgtcggcaga 1080

ggcatcttga acgatagcct ttcctttatc gcaatgatgg catttgtagg tgccaccttc 1140

cttttctact gtccttttga tgaagtgaca gatagctggg caatggaatc cgaggaggtt 1200

tcccgatatt accctttgtt gaaaagtctc aatagccctt tggtcttctg agactgtatc 1260

tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttcacat caatccactt 1320

gctttgaaga cgtggttgga acgtcttctt tttccacgat gctcctcgtg ggtgggggtc 1380

catctttggg accactgtcg gcagaggcat cttgaacgat agcctttcct ttatcgcaat 1440

gatggcattt gtaggtgcca ccttcctttt ctactgtcct tttgatgaag tgacagatag 1500

ctgggcaatg gaatccgagg aggtttcccg atattaccct ttgttgaaaa gtctcaatag 1560

ccctttggtc ttctgagact gtatctttga tattcttgga gtagacgaga gtgtcgtgct 1620

ccaccatgtt ggcaagctgc tctagccaat acgcaaaccg cctctccccg cgcgttggcc 1680

gattcattaa tgcagctggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa 1740

cgcaattaat gtgagttagc tcactcatta ggcaccccag gctttacact ttatgcttcc 1800

ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt cacacaggaa acagctatga 1860

catgattacg aattcgagct cggtacccgg ggatcctcta gagtcgacct gcaggcatgc 1920

aagcttatcc agcttgcatg cctgcagtgc agcgtgaccc ggtcgtgccc ctctctagag 1980

ataatgagca ttgcatgtct aagttataaa aaattaccac atattttttt tgtcacactt 2040

gtttgaagtg cagtttatct atctttatac atatatttaa actttactct acgaataata 2100

taatctatag tactacaata atatcagtgt tttagagaat catataaatg aacagttaga 2160

catggtctaa aggacaattg agtattttga caacaggact ctacagtttt atctttttag 2220

tgtgcatgtg ttctcctttt tttttgcaaa tagcttcacc tatataatac ttcatccatt 2280

ttattagtac atccatttag ggtttagggt taatggtttt tatagactaa tttttttagt 2340

acatctattt tattctattt tagcctctaa attaagaaaa ctaaaactct attttagttt 2400

ttttatttaa taatttagat ataaaataga ataaaataaa gtgactaaaa attaaacaaa 2460

taccctttaa gaaattaaaa aaactaagga aacatttttc ttgtttcgag tagataatgc 2520

cagcctgtta aacgccgtcg acgagtctaa cggacaccaa ccagcgaacc agcagcgtcg 2580

cgtcgggcca agcgaagcag acggcacggc atctctgtcg ctgcctctgg acccctctcg 2640

agagttccgc tccaccgttg gacttgctcc gctgtcggca tccagaaatt gcgtggcgga 2700

gcggcagacg tgagccggca cggcaggcgg cctcctcctc ctctcacggc accggcagct 2760

acgggggatt cctttcccac cgctccttcg ctttcccttc ctcgcccgcc gtaataaata 2820

gacaccccct ccacaccctc tttccccaac ctcgtgttgt tcggagcgca cacacacaca 2880

accagatctc ccccaaatcc acccgtcggc acctccgctt caaggtacgc cgctcgtcct 2940

cccccccccc ctctctacct tctctagatc ggcgttccgg tccatggtta gggcccggta 3000

gttctacttc tgttcatgtt tgtgttagat ccgtgtttgt gttagatccg tgctgctagc 3060

gttcgtacac ggatgcgacc tgtacgtcag acacgttctg attgctaact tgccagtgtt 3120

tctctttggg gaatcctggg atggctctag ccgttccgca gacgggatcg atttcatgat 3180

tttttttgtt tcgttgcata gggtttggtt tgcccttttc ctttatttca atatatgccg 3240

tgcacttgtt tgtcgggtca tcttttcatg cttttttttg tcttggttgt gatgatgtgg 3300

tctggttggg cggtcgttct agatcggagt agaattctgt ttcaaactac ctggtggatt 3360

tattaatttt ggatctgtat gtgtgtgcca tacatattca tagttacgaa ttgaagatga 3420

tggatggaaa tatcgatcta ggataggtat acatgttgat gcgggtttta ctgatgcata 3480

tacagagatg ctttttgttc gcttggttgt gatgatgtgg tgtggttggg cggtcgttca 3540

ttcgttctag atcggagtag aatactgttt caaactacct ggtgtattta ttaattttgg 3600

aactgtatgt gtgtgtcata catcttcata gttacgagtt taagatggat ggaaatatcg 3660

atctaggata ggtatacatg ttgatgtggg ttttactgat gcatatacat gatggcatat 3720

gcagcatcta ttcatatgct ctaaccttga gtacctatct attataataa acaagtatgt 3780

tttataatta ttttgatctt gatatacttg gatgatggca tatgcagcag ctatatgtgg 3840

atttttttag ccctgccttc atacgctatt tatttgcttg gtactgtttc ttttgtcgat 3900

gctcaccctg ttgtttggtg ttacttctgc aggtcgactc tagaggatcg tatttttaca 3960

acaattacca acaacaacaa acaacaaaca acattacaat tactatttac aattacaacc 4020

atggattgcc ggccctacaa ctgcctgtcg aaccctgagg tggaggtcct gggcggcgag 4080

cggattgaga ctggctacac accgattgac atctcactct ccctgaccca gttcctcctg 4140

tcggagttcg tgccaggcgc tgggttcgtt ctcggcctgg tggatatcat ttggggcatc 4200

ttcgggccaa gccagtggga cgctttcctg gtccagatcg agcagctcat taatcagagg 4260

atcgaggagt tcgcgcggaa ccaggctatt agccgcctcg agggcctgtc gaacctctac 4320

cagatctacg ccgagagctt cagggagtgg gaggctgatc cgacgaaccc cgccctgagg 4380

gaggagatgc ggattcagtt caatgacatg aactccgctc tgaccacggc tatcccactc 4440

ttcgcggtgc agaattacca ggtcccactc ctgagcgtct acgtgcaggc tgcgaacctc 4500

cacctgtctg tgctgcgcga tgtttcagtg ttcggccaga cctgggggtt cgacgctgct 4560

acgattaatt ccaggtacaa cgatctgaca cggctcatcg gcaattacac tgaccatgcc 4620

gttcggtggt acaacaccgg cctcgagagg gtgtgggggc cagactccag ggattggatt 4680

aggtacaacc agttccgcag ggagctcaca ctgactgtcc tggacatcgt ttccctcttc 4740

ccaaactacg atagccggac ctaccctatt cgcacggtgt cccagctgac aagggagatc 4800

tacactaatc cagtcctcga gaacttcgac ggctctttcc gcgggtcagc tcagggcatt 4860

gaggggtcca tcaggagccc tcacctgatg gatatcctca actcaatcac catctacacg 4920

gacgctcacc gcggcgagta ctactggtcc gggcatcaga tcatggcttc cccagtcggc 4980

ttcagcgggc cagagttcac cttcccactg tacggcacga tggggaacgc tgctccacag 5040

cagaggatcg ttgctcagct cggccagggg gtgtaccgca cactgtccag cactctctac 5100

cggcgcccgt tcaacatcgg cattaacaat cagcagctga gcgtgctcga cggcacagag 5160

ttcgcctacg ggacttcgtc taacctgccc tcggcggtct acaggaagtc gggcaccgtt 5220

gactctctcg atgagatccc gccccagaac aataacgtcc cacctcgcca gggcttctcg 5280

cacaggctgt cgcatgtttc tatgttccgg tcaggcttct ccaactcatc cgtctccatc 5340

attagggccc cgatgttctc atggatccac cggtccgcgg agttcaataa catcattgct 5400

agcgattcga tcacgcagat tccagcggtc aagggcaatt tcctcttcaa cgggagcgtt 5460

atctcgggcc ctgggttcac aggcggggac ctggtgaggc tcaatagctc gggcaataac 5520

atccagaaca ggcggtacat tgaggtccca atccacttcc cttctacctc aacgcgctac 5580

agggtccggg ttcgctacgc gtccgtgaca ccaattcatc tgaatgtcaa ctggggcaat 5640

tcttcaatct tctcgaacac tgtgcctgcc acagcgactt ctctggacaa tctccagtcc 5700

agcgatttcg gctacttcga gtctgctaac gccttcacct cgtctctcgg caatatcgtg 5760

ggggtccgca acttcagcgg cacggctggc gttattattg ataggttcga gttcatccct 5820

gttactgcta ccctggaggc tgagtaagta ggtgaggaat tctttgagta ttatggcatt 5880

ggaaaagcca ttgttctgct tgtaatttac tgtgttcttt cagtttttgt tttcggacat 5940

caaaaaaaaa aaaaaaaaaa aaaaaaaatt taacaaaaaa aaaaaaaaaa aaaaaaaagt 6000

ttaattcgat tatcctcgag ccctagtgtc ctgctttaat gagatatgcg agacgcctat 6060

gatcgcatga tatttgcttt caattctgtt gtgcacgttg taaaaaacct gagcatgtgt 6120

agctcagatc cttaccgccg gtttcggttc attctaatga atatatcacc cgttactatc 6180

gtatttttat gaataatatt ctccgttcaa tttactgatt gtaccctact acttatatgt 6240

acaatattaa aatgaaaaca atatattgtg ctgaataggt ttatagcgac atctatgata 6300

gagcgccaca ataacaaaca attgcgtttt attattacaa atccaatttt aaaaaaagcg 6360

gcagaaccgg tcaaacctaa aagactgatt acataaatct tattcaaatt tcaaaagtgc 6420

cccaggggct agtatctacg acacaccgag cggcgaacta ataacgctca ctgaagggaa 6480

ctccggttcc ccgccggcgc gcatgggtga gattccttga agttgagtat tggccgtccg 6540

ctctaccgaa agttacgggc accattcaac ccggtccagc acggcggccg ggtaaccgac 6600

ttgctgcccc gagaattatg cagcattttt ttggtgtatg tgggccccaa atgaagtgca 6660

ggtcaaacct tgacagtgac gacaaatcgt tgggcgggtc cagggcgaat tttgcgacaa 6720

catgtcgagg ctcagcagga cctgcaggcg tttaaactat cagtgtttga caggatatat 6780

tggcgggtaa acctaagaga aaagagcgtt ta 6812

<210> 2

<211> 7272

<212> DNA

<213>ZM2-104 sequences of events

<400> 2

tgcgtcctaa attgtcagtt acataattcg agctattgct ttcctcgttc tcccttcttc 60

ctttttttta ccttgattgg gtgaggagtg atgagtttgc catgatctgg taaaaatcct 120

tcctagctgt agcgactcat aattcttata actgctcata gtagtatatg gaaaagagta 180

agttatatcg caatctcctc ctaattttgt gtggcatgtt ggtagaagaa gataacattc 240

tctctgattc attcatggtg taaacaaatt gacgcttaga caacttaata acacattgcg 300

gacgttttta atgtactgaa ttaacgccga attaattcgg gggatctgga ttttagtact 360

ggattttggt tttaggaatt agaaatttta ttgatagaag tattttacaa atacaaatac 420

atactaaggg tttcttatat gctcaacaca tgagcgaaac cctataggaa ccctaattcc 480

cttatctggg aactactcac acattattat ggagaaactc gagtcaaatc tcggtgacgg 540

gcaggaccgg acggggcggt accggcaggc tgaagtccag ctgccagaaa cccacgtcat 600

gccagttccc gtgcttgaag ccggccgccc gcagcatgcc gcggggggca tatccgagcg 660

cctcgtgcat gcgcacgctc gggtcgttgg gcagcccgat gacagcgacc acgctcttga 720

agccctgtgc ctccagggac ttcagcaggt gggtgtagag cgtggagccc agtcccgtcc 780

gctggtggcg gggggagacg tacacggtcg actcggccgt ccagtcgtag gcgttgcgtg 840

ccttccaggg gcccgcgtag gcgatgccgg cgacctcgcc gtccacctcg gcgacgagcc 900

agggatagcg ctcccgcaga cggacgaggt cgtccgtcca ctcctgcggt tcctgcggct 960

cggtacggaa gttgaccgtg cttgtctcga tgtagtggtt gacgatggtg cagaccgccg 1020

gcatgtccgc ctcggtggca cggcggatgt cggccgggcg tcgttctggg ctcatggtag 1080

actcgagaga gatagatttg tagagagaga ctggtgattt cagcgtgtcc tctccaaatg 1140

aaatgaactt ccttatatag aggaagggtc ttgcgaagga tagtgggatt gtgcgtcatc 1200

ccttacgtca gtggagatat cacatcaatc cacttgcttt gaagacgtgg ttggaacgtc 1260

ttctttttcc acgatgctcc tcgtgggtgg gggtccatct ttgggaccac tgtcggcaga 1320

ggcatcttga acgatagcct ttcctttatc gcaatgatgg catttgtagg tgccaccttc 1380

cttttctact gtccttttga tgaagtgaca gatagctggg caatggaatc cgaggaggtt 1440

tcccgatatt accctttgtt gaaaagtctc aatagccctt tggtcttctg agactgtatc 1500

tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttcacat caatccactt 1560

gctttgaaga cgtggttgga acgtcttctt tttccacgat gctcctcgtg ggtgggggtc 1620

catctttggg accactgtcg gcagaggcat cttgaacgat agcctttcct ttatcgcaat 1680

gatggcattt gtaggtgcca ccttcctttt ctactgtcct tttgatgaag tgacagatag 1740

ctgggcaatg gaatccgagg aggtttcccg atattaccct ttgttgaaaa gtctcaatag 1800

ccctttggtc ttctgagact gtatctttga tattcttgga gtagacgaga gtgtcgtgct 1860

ccaccatgtt ggcaagctgc tctagccaat acgcaaaccg cctctccccg cgcgttggcc 1920

gattcattaa tgcagctggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa 1980

cgcaattaat gtgagttagc tcactcatta ggcaccccag gctttacact ttatgcttcc 2040

ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt cacacaggaa acagctatga 2100

catgattacg aattcgagct cggtacccgg ggatcctcta gagtcgacct gcaggcatgc 2160

aagcttatcc agcttgcatg cctgcagtgc agcgtgaccc ggtcgtgccc ctctctagag 2220

ataatgagca ttgcatgtct aagttataaa aaattaccac atattttttt tgtcacactt 2280

gtttgaagtg cagtttatct atctttatac atatatttaa actttactct acgaataata 2340

taatctatag tactacaata atatcagtgt tttagagaat catataaatg aacagttaga 2400

catggtctaa aggacaattg agtattttga caacaggact ctacagtttt atctttttag 2460

tgtgcatgtg ttctcctttt tttttgcaaa tagcttcacc tatataatac ttcatccatt 2520

ttattagtac atccatttag ggtttagggt taatggtttt tatagactaa tttttttagt 2580

acatctattt tattctattt tagcctctaa attaagaaaa ctaaaactct attttagttt 2640

ttttatttaa taatttagat ataaaataga ataaaataaa gtgactaaaa attaaacaaa 2700

taccctttaa gaaattaaaa aaactaagga aacatttttc ttgtttcgag tagataatgc 2760

cagcctgtta aacgccgtcg acgagtctaa cggacaccaa ccagcgaacc agcagcgtcg 2820

cgtcgggcca agcgaagcag acggcacggc atctctgtcg ctgcctctgg acccctctcg 2880

agagttccgc tccaccgttg gacttgctcc gctgtcggca tccagaaatt gcgtggcgga 2940

gcggcagacg tgagccggca cggcaggcgg cctcctcctc ctctcacggc accggcagct 3000

acgggggatt cctttcccac cgctccttcg ctttcccttc ctcgcccgcc gtaataaata 3060

gacaccccct ccacaccctc tttccccaac ctcgtgttgt tcggagcgca cacacacaca 3120

accagatctc ccccaaatcc acccgtcggc acctccgctt caaggtacgc cgctcgtcct 3180

cccccccccc ctctctacct tctctagatc ggcgttccgg tccatggtta gggcccggta 3240

gttctacttc tgttcatgtt tgtgttagat ccgtgtttgt gttagatccg tgctgctagc 3300

gttcgtacac ggatgcgacc tgtacgtcag acacgttctg attgctaact tgccagtgtt 3360

tctctttggg gaatcctggg atggctctag ccgttccgca gacgggatcg atttcatgat 3420

tttttttgtt tcgttgcata gggtttggtt tgcccttttc ctttatttca atatatgccg 3480

tgcacttgtt tgtcgggtca tcttttcatg cttttttttg tcttggttgt gatgatgtgg 3540

tctggttggg cggtcgttct agatcggagt agaattctgt ttcaaactac ctggtggatt 3600

tattaatttt ggatctgtat gtgtgtgcca tacatattca tagttacgaa ttgaagatga 3660

tggatggaaa tatcgatcta ggataggtat acatgttgat gcgggtttta ctgatgcata 3720

tacagagatg ctttttgttc gcttggttgt gatgatgtgg tgtggttggg cggtcgttca 3780

ttcgttctag atcggagtag aatactgttt caaactacct ggtgtattta ttaattttgg 3840

aactgtatgt gtgtgtcata catcttcata gttacgagtt taagatggat ggaaatatcg 3900

atctaggata ggtatacatg ttgatgtggg ttttactgat gcatatacat gatggcatat 3960

gcagcatcta ttcatatgct ctaaccttga gtacctatct attataataa acaagtatgt 4020

tttataatta ttttgatctt gatatacttg gatgatggca tatgcagcag ctatatgtgg 4080

atttttttag ccctgccttc atacgctatt tatttgcttg gtactgtttc ttttgtcgat 4140

gctcaccctg ttgtttggtg ttacttctgc aggtcgactc tagaggatcg tatttttaca 4200

acaattacca acaacaacaa acaacaaaca acattacaat tactatttac aattacaacc 4260

atggattgcc ggccctacaa ctgcctgtcg aaccctgagg tggaggtcct gggcggcgag 4320

cggattgaga ctggctacac accgattgac atctcactct ccctgaccca gttcctcctg 4380

tcggagttcg tgccaggcgc tgggttcgtt ctcggcctgg tggatatcat ttggggcatc 4440

ttcgggccaa gccagtggga cgctttcctg gtccagatcg agcagctcat taatcagagg 4500

atcgaggagt tcgcgcggaa ccaggctatt agccgcctcg agggcctgtc gaacctctac 4560

cagatctacg ccgagagctt cagggagtgg gaggctgatc cgacgaaccc cgccctgagg 4620

gaggagatgc ggattcagtt caatgacatg aactccgctc tgaccacggc tatcccactc 4680

ttcgcggtgc agaattacca ggtcccactc ctgagcgtct acgtgcaggc tgcgaacctc 4740

cacctgtctg tgctgcgcga tgtttcagtg ttcggccaga cctgggggtt cgacgctgct 4800

acgattaatt ccaggtacaa cgatctgaca cggctcatcg gcaattacac tgaccatgcc 4860

gttcggtggt acaacaccgg cctcgagagg gtgtgggggc cagactccag ggattggatt 4920

aggtacaacc agttccgcag ggagctcaca ctgactgtcc tggacatcgt ttccctcttc 4980

ccaaactacg atagccggac ctaccctatt cgcacggtgt cccagctgac aagggagatc 5040

tacactaatc cagtcctcga gaacttcgac ggctctttcc gcgggtcagc tcagggcatt 5100

gaggggtcca tcaggagccc tcacctgatg gatatcctca actcaatcac catctacacg 5160

gacgctcacc gcggcgagta ctactggtcc gggcatcaga tcatggcttc cccagtcggc 5220

ttcagcgggc cagagttcac cttcccactg tacggcacga tggggagcgc tgctccacag 5280

cagaggatcg ttgctcagct cggccagggg gtgtaccgca cactgtccag cactctctac 5340

cggcgcccgt tcaacatcgg cattaacaat cagcagctga gcgtgctcga cggcacagag 5400

ttcgcctacg ggacttcgtc taacctgccc tcggcggtct acaggaagtc gggcaccgtt 5460

gactctctcg atgagatccc gccccagaac aataacgtcc cacctcgcca gggcttctcg 5520

cacaggctgt cgcatgtttc tatgttccgg tcaggcttct ccaactcatc cgtctccatc 5580

attagggccc cgatgttctc atggatccac cggtccgcgg agttcaataa catcattgct 5640

agcgattcga tcacgcagat tccagcggtc aagggcaatt tcctcttcaa cgggagcgtt 5700

atctcgggcc ctgggttcac aggcggggac ctggtgaggc tcaatagctc gggcaataac 5760

atccagaaca ggcggtacat tgaggtccca atccacttcc cttctacctc aacgcgctac 5820

agggtccggg ttcgctacgc gtccgtgaca ccaattcatc tgaatgtcaa ctggggcaat 5880

tcttcaatct tctcgaacac tgtgcctgcc acagcgactt ctctggacaa tctccagtcc 5940

agcgatttcg gctacttcga gtctgctaac gccttcacct cgtctctcgg caatatcgtg 6000

ggggtccgca acttcagcgg cacggctggc gttattattg ataggttcga gttcatccct 6060

gttactgcta ccctggaggc tgagtaagta ggtgaggaat tctttgagta ttatggcatt 6120

ggaaaagcca ttgttctgct tgtaatttac tgtgttcttt cagtttttgt tttcggacat 6180

caaaaaaaaa aaaaaaaaaa aaaaaaaatt taacaaaaaa aaaaaaaaaa aaaaaaaagt 6240

ttaattcgat tatcctcgag ccctagtgtc ctgctttaat gagatatgcg agacgcctat 6300

gatcgcatga tatttgcttt caattctgtt gtgcacgttg taaaaaacct gagcatgtgt 6360

agctcagatc cttaccgccg gtttcggttc attctaatga atatatcacc cgttactatc 6420

gtatttttat gaataatatt ctccgttcaa tttactgatt gtaccctact acttatatgt 6480

acaatattaa aatgaaaaca atatattgtg ctgaataggt ttatagcgac atctatgata 6540

gagcgccaca ataacaaaca attgcgtttt attattacaa atccaatttt aaaaaaagcg 6600

gcagaaccgg tcaaacctaa aagactgatt acataaatct tattcaaatt tcaaaagtgc 6660

cccaggggct agtatctacg acacaccgag cggcgaacta ataacgctca ctgaagggaa 6720

ctccggttcc ccgccggcgc gcatgggtga gattccttga agttgagtat tggccgtccg 6780

ctctaccgaa agttacgggc accattcaac ccggtccagc acggcggccg ggtaaccgac 6840

ttgctgcccc gagaattatg cagcattttt ttggtgtatg tgggccccaa atgaagtgca 6900

ggtcaaacct tgacagtgac gacaaatcgt tgggcgggtc cagggcgaat tttgcgacaa 6960

catgtcgagg ctcagcagga cctgcaggcg tttaaactat cagtgtttaa actagtgggc 7020

gcgaatggcg cacctgggcc cgaccccgac ccctttcctg tcgattaata tttgtttgcc 7080

acgtaggagt acaagtgtag gctaggtgaa ggtgaagcgc agtcatggta aggaaattgc 7140

cacttggaag tagtagtagt ttgcggtttg gtgagttctt ttccttcttt gcagcctgct 7200

ctgctctgct ctactcagcc caaccgaacc catgaaattg atcggttaaa taaatactgg 7260

ttgcttttgg ga 7272

<210> 3

<211> 20

<212> DNA

<213>Primer

<400> 3

tgcgtcctaa attgtcagtt 20

<210> 4

<211> 20

<212> DNA

<213>Primer

<400> 4

acttagacat gcaatgctca 20

<210> 5

<211> 20

<212> DNA

<213>Primer

<400> 5

gcggataaca atttcacaca 20

<210> 6

<211> 20

<212> DNA

<213>Primer

<400> 6

ctgcagaagt aacaccaaac 20

<210> 7

<211> 20

<212> DNA

<213>Primer

<400> 7

actgtttctt ttgtcgatgc 20

<210> 8

<211> 20

<212> DNA

<213>Primer

<400> 8

tttgacctgc acttcatttg 20

<210> 9

<211> 20

<212> DNA

<213>Primer

<400> 9

ggctagtatc tacgacacac 20

<210> 10

<211> 20

<212> DNA

<213>Primer

<400> 10

tcccaaaagc aaccagtatt 20

<210> 11

<211> 333

<212> DNA

<213>Probe

<400> 11

cacgcagatt ccagcggtca agggcaattt cctcttcaac gggagcgtta tctcgggccc 60

tgggttcaca ggcggggacc tggtgaggct caatagctcg ggcaataaca tccagaacag 120

gcggtacatt gaggtcccaa tccacttccc ttctacctca acgcgctaca gggtccgggt 180

tcgctacgcg tccgtgacac caattcatct gaatgtcaac tggggcaatt cttcaatctt 240

ctcgaacact gtgcctgcca cagcgacttc tctggacaat ctccagtcca gcgatttcgg 300

ctacttcgag tctgctaacg ccttcacctc gtc 333

<210> 12

<211> 21

<212> DNA

<213>Primer

<400> 12

cacgcagatt ccagcggtca a 21

<210> 13

<211> 21

<212> DNA

<213>Primer

<400> 13

gacgaggtga aggcgttagc a 21

<210> 14

<211> 20

<212> DNA

<213>Primer

<400> 14

tatagggttt cgctcatgtg 20

Claims (10)

1. nucleic acid molecules, it includes SEQ ID NO:Nucleotide sequence shown in 2 or its fragment, variation or complementary series, or by Composition described above.

2. test right requires the combination of the primer pair or primer pair of 1 nucleic acid molecules, it is selected from：

Primer pair, it includes specific recognition SEQ ID NO:Sequence comprising its 1-255 nucleotide in sequence shown in 2 One primer and specific recognition SEQ ID NO:Sequence comprising its 256-7008 nucleotide or mutual in sequence shown in 2 Another primer of complementary series；And/or

Primer pair, it includes specific recognition SEQ ID NO:The sequence of its 256-7008 nucleotide is included in sequence shown in 2 A primer and specific recognition SEQ ID NO for row:In sequence shown in 2 sequence comprising its 7009-7272 nucleotide or Another primer of person's complementary series.

3. the combination of primer pair as claimed in claim 2 or primer pair, wherein the primer pair is selected from：

(1)SEQ ID NO:3 and SEQ ID NO:4；

(2)SEQ ID NO:3 and SEQ ID NO:14；

(3)SEQ ID NO:7 and SEQ ID NO:10；With

(4)SEQ ID NO:9 and SEQ ID NO:10.

4. the method for identifying transformation event ZM2-104 in biological sample, it includes the use of any one of claim 2-3 institutes The combination of the primer pair or primer pair stated.

5. kit or microarray for detecting corn transformation event ZM2-104, it includes any one of claim 2-3 institutes The combination of the primer pair or primer pair stated.

6. the kit described in primer pair or the combination of primer pair or claim 5 any one of claim 2-3 Or application of the microarray in corn transformation event ZM2-104 is detected.

7. detecting the existing method of transformation event ZM2-104 or its offspring in biological sample, it includes

Biological sample is provided, and from the extraction from biological material DNA；

The combination of primer pair or primer pair any one of claim 2-4 is provided；

DNA amplification reaction is carried out using above-mentioned primer pair；With

The sub- molecule of DNA cloning that the DNA amplification reaction produces is detected, wherein the presence of the sub- molecule of the DNA cloning shows to turn The presence of change event ZM2-104, wherein the transformation event ZM2-104 is that exogenous DNA is introduced into plant so as in plant Produce SEQ ID NO:The DNA of 2 sequences.

8. separated DNA molecular, it includes any amplicon produced by claim 7 the method.

9. contain SEQ ID NO:Purposes of 2 transgenic corns in breeding, optionally described breeding include training by pollen Support, haploid embryo culture, double culture, cell culture, tissue cultures, selfing or hybridization or more combination obtain offspring plant Thing.

10. the product made of the plant that the purposes of claim 9 produces, optionally described product is food, feed or industry Raw material.