CN109929873A - A method of cultivating drought resisting genetically modified plants - Google Patents

Abstract

The invention discloses a kind of methods for cultivating drought resisting genetically modified plants, the recombination over-express vector containing nucleotide sequence shown in SEQ ID NO:1 is constructed first, then transformant is constructed using this recombination over-express vector, this transformant is recycled to infect purpose plant, screening obtains the genetically modified plants compared with normal plants with drought resistant character.The present invention can significantly improve the relative water content and drought resistance of soybean leaves, have important theoretical research value and wide actual application prospect for cultivating drought resisting new soybean varieties.

Description

A method of cultivating drought resisting genetically modified plants

Technical field

The present invention relates to gene engineering technology fields, more particularly to carry out drought resisting soybean based on genetically modified organism engineering technology The cultivation of new varieties.

Background technique

The crop that soybean is very important, is worth with special economic.Soybean is most sensitive to water shortage, the serious shadow of arid The yield and quality for ringing soybean, is the major obstacle of arid and semi-arid lands's soybean yield-increasing.Improve soybean drought resisting ability As one of the critical issue (beautiful etc. in phoenix, 2013) in modern breeding work.Soybean leaves relative water content, chlorophyll contain Amount, proline content and drought resistance are positively correlated;And relative conductivity, osmotic potential and drought resistance are negatively correlated.It is comprehensive to each index Close it was found that, the relationship of chlorophyll content, leaf r elative water content and osmotic potential and drought resistance is more close, can be used as big The best physical signs (Guo's number into etc., 2009) of beans drought resisting identification.Soybean drought resisting is ground currently with technique for gene engineering Study carefully and technological development, there is important theoretical research and practical application value.

Summary of the invention

The technical problem to be solved in the present invention is to provide a kind of methods for cultivating drought resisting genetically modified plants.

In order to solve the above technical problems, the technical solution used in the present invention is as follows.

A method of drought resisting genetically modified plants are cultivated, nucleotides sequence shown in SEQ ID NO:1 is overexpressed in plant Column, cultivate the genetically modified plants with drought resistant character.

As a preferred technical solution of the present invention, building first contains nucleotide sequence shown in SEQ ID NO:1 Over-express vector is recombinated, then transformant is constructed using this recombination over-express vector, this transformant is recycled to infect purpose plant, Screening obtains the genetically modified plants compared with normal plants with drought resistant character.

As a preferred technical solution of the present invention, the recombinant expression carrier includes pTF101 skeleton carrier and SEQ Nucleotide fragments shown in ID NO:1, and contain at least one strong promoter.

As a preferred technical solution of the present invention, the transformant converts Agrobacterium EHA105 using liquid nitrogen freeze-thaw method It is made.

As a preferred technical solution of the present invention, the plant is soybean.

As a preferred technical solution of the present invention, this method is comprised the following steps:

A, the DNA of soybean varieties W82 is extracted, -20 DEG C of refrigerators save backup；

B, the clone of gene: according to the nucleotide sequence design primer pair of SEQ ID NO:1, according to the polyclonal position carrier pTF101 Point, prime end introduce Age I and BamH I digestion recognition site respectively, carry out PCR by template of the DNA of soybean varieties W82, Expand the nucleotide sequence of SEQ ID NO:1；Primer sequence are as follows: F:5'-TGCACCGGTGGGTTCTATTGGTGGTTG-3' SEQ ID NO:2；R:5'-CGGGATCCCGTCTACTTTGGCTAGAAAG-3'SEQ ID NO:3；Amplification program are as follows: 95 DEG C 5 minutes；95 DEG C 30 seconds, 57 DEG C 30 seconds, 72 DEG C 40 seconds, 26 circulation；72 DEG C 30 seconds；Pcr amplification product carries out 1% agarose gel electrophoresis, using the band of the raw work plastic recovery kit recovery purifying 181bp size in Shanghai；The DNA of recycling Segment is connect with pMD19-T carrier, and 1 I 5 μ l of μ l, solution of T vector is added in 10 μ l systems, recycles 4 μ l of segment, mixes Even mixed liquor, overnight, thermal shock method is transferred to E.coli competent escherichia coli cell, is incubated overnight, and chooses positive colony for 16 DEG C of connections And it is sequenced；

C, the building of recombinant expression carrier: the carrier T plasmid containing SEQ ID NO:1 sequence is extracted, with restriction enzyme A ge Digestion products are recycled in I and BamH I digestion；With restriction enzyme A ge I and BamH I digestion empty carrier pTF101, recycling is carried Body skeleton；The digestion products of step 1 are connected with the carrier framework of step 2 with T4 ligase；Connection product is heat-shock transformed big Enterobacteria competence DH5 α bacterial strain, 37 DEG C are incubated overnight, and picking positive colony is sequenced, and obtain recombinant plasmid；

D, liquid nitrogen freeze-thaw method converts Agrobacterium EHA105: taking out the 200 μ l competent cells frozen, 5-10 μ is added after thawing L Plasmid DNA flicks tube wall mixing, puts 20-30 min on ice；It is put into liquid nitrogen and is taken out after 5 min, pipe is transferred to 37 DEG C of thawings Afterwards, 800 μ l YEP non-resistant fluid nutrient mediums, 28 DEG C of oscillation 4-5 h are added；Centrifugation, 10000 rpm, 30 sec are gone Clearly, add 100 μ l YEP fluid nutrient mediums, coated plate after suspension thalline, kanamycins containing 50mg/ml；28 DEG C are set to cultivate to white Color transformant is grown, and picking positive monoclonal shakes bacterium, is converted for soybean cotyledon node；

F, the soybean cotyledon node genetic transformation soybean transformation mediated using Agrobacterium EHA105, screening are obtained and normal plants phase Than the genetically engineered soybean with drought resistant character.

The present invention also includes the nucleotide fragments for cultivating drought resisting genetically modified plants, is had shown in SEQ ID NO:1 Nucleotide sequence.

The present invention also includes the primer pair for expanding nucleotide sequence shown in SEQ ID NO:1, has SEQ ID NO:2, SEQ Nucleotide sequence shown in ID NO:3.

The present invention can also extend to the recombinant expression carrier comprising nucleotide sequence shown in SEQ ID NO:1, transformant, Expression cassette and the transgenic drought-resistant plant constructed using nucleotide sequence shown in SEQ ID NO:1.

The beneficial effects of adopting the technical scheme are that the theoretical research and experimental study of applicant confirm, By being overexpressed nucleotide sequence shown in SEQ ID NO:1 in soybean plant strain, the phase of soybean leaves can be significantly improved To water content and drought resistance, there is important theoretical research value and wide practical application for cultivating drought resisting new soybean varieties Prospect.

Detailed description of the invention

Fig. 1 is the drought-resistant character analysis of Molecular Identification and overexpression plant of the purpose gene in transgenic plant；Knot Fruit shows, is overexpressed the transgenic plant (- 5, -11) of target gene compared with compareing wild type W82, shows apparent drought resisting Phenotype (Figure 1A)；The transgenic plant of target gene is overexpressed compared with compareing wild type W82, leaf r elative water content is obviously high (Fig. 1 C) is obviously increased in the content of control material (Figure 1B), chlorophyll, the content of proline does not occur significantly accumulating (Fig. 1 D).

Specific embodiment

Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly Conventional biochemical reagent company is commercially available.% in following embodiments is unless otherwise specified mass percentage.Below Quantitative test in embodiment, is respectively provided with three repeated experiments, and results are averaged.

The extraction of embodiment 1, Wilimas82 soy bean DNA.

A. soyabean tissue uses liquid nitrogen grinding in mortar, and the powder being fully ground is moved in 1.5 mL centrifuge tubes；Add Enter 650 mL CTAB extracting solutions (100 mM, Tris-HCl(pH 8.0), 4 mol/L NaCl, 20 mmol/L EDTA(pH 8.0), 2% CTAB uses the preceding addition mL of 2 mL/100 beta -mercaptoethanol), it mixes；

B. 65 DEG C of 30 min of water-bath, intermediate slight oscillatory is several times；

C. it is placed in 5 min on ice；

D. chloroform plus in equal volume: isoamyl alcohol (24:1) mixes gently；

E. room temperature, stands 10 min, and 12000 rpm refrigerated centrifuge, 15 min takes supernatant；

F. plus 2 times of volume ice ethyl alcohol, mix, -20 DEG C of 30 min of standing；

G. it is centrifuged, supernatant is discharged；

H. 70% ethyl alcohol, 1 mL is rinsed 2 times, is dried；

I. 100 μ l of sterile water dissolves, -20 DEG C of refrigerator long-term preservations.

Embodiment 2, building recombinant expression carrier.

(1) clone of gene.

The total 181bp(SEQ ID NO:1 of objective gene sequence), according to the primers pair, according to carrier pTF101 Multiple cloning sites, prime end introduces Age I and BamH I digestion recognition site respectively, using the DNA of soybean varieties W82 as template Carry out PCR, amplifying target genes；Primer sequence are as follows:

F:5'-TGCACCGGTGGGTTCTATTGGTGGTTG-3'(SEQ ID NO:2)；

R:5'-CGGGATCCCGTCTACTTTGGCTAGAAAG-3'(SEQ ID NO:3)；

Amplification program are as follows: 95 DEG C 5 minutes；95 DEG C 30 seconds, 57 DEG C 30 seconds, 72 DEG C 40 seconds, 26 circulation；72 ℃ 30 seconds；

Pcr amplification product carries out 1% agarose gel electrophoresis, big using the raw work plastic recovery kit recovery purifying 181bp in Shanghai Small band；

The DNA segment of recycling is connect with pMD19-T carrier (Takara company), and T vector 1 is added in 10 μ l systems I 5 μ l of μ l, solution recycles 4 μ l of segment, mixes mixed liquor, overnight, thermal shock method is transferred to E.coli Escherichia coli for 16 DEG C of connections Competent cell is incubated overnight, and chooses positive colony, delivers the sequencing of invitrogen company.

(2) building of recombinant expression carrier.

1) the carrier T plasmid containing correct sequencing objective gene sequence, is extracted, with restriction enzyme A ge I and BamH Digestion products are recycled in I digestion；

2), with restriction enzyme A ge I and BamH I digestion empty carrier pTF101, carrier framework is recycled；

3), the digestion products of step 1 are connected with the carrier framework of step 2 with T4 ligase；

4), by the heat-shock transformed E. coli competent DH5 α bacterial strain of the connection product of step 3,37 DEG C are incubated overnight, and picking is positive Clone is sequenced；Sequencing result shows to have obtained recombinant plasmid.

The conversion of embodiment 3, Agrobacterium EHA105.

Agrobacterium is converted using liquid nitrogen freeze-thaw method, concrete operations are as follows:

A. the 200 μ l competent cells frozen are taken out, 5-10 μ l Plasmid DNA is added after thawing, flick tube wall mixing, on ice Put 20-30 min；

B. it is put into liquid nitrogen and is taken out after 5 min, after pipe is transferred to 37 DEG C (5 min) thawings, 800 μ l YEP(non-resistants are added) Fluid nutrient medium, 28 DEG C of low-speed oscillation (150 rpm) 4-5 h；

D.10000 rpm, 30 sec, removes supernatant, adds 100 μ l YEP fluid nutrient mediums, and coated plate (contains 50mg/ after suspension thalline Ml kanamycins)；

E. it sets 28 DEG C of cultures to grow to white transformant, picking positive monoclonal shakes bacterium, converts for soybean cotyledon node；

The soybean cotyledon node genetic transformation that embodiment 4, Agrobacterium EHA105 are mediated.

1. taking seed material disinfection by chlorine 10 hours using soybean varieties W82 as material；

2. in B₅Culture medium (culture medium prescription: 2% sucrose, 0.8 % agar powder (sigma), 1 × GAMBORG B-5 BASAL (Phyto Technology Laboratories, article No.: G398), pH is adjusted to 5.7 or so；) on sprout 5 days, use scalpel First soybean band 2cm plumular axis is cut, is put into culture dish, is vertically cut then along hypocotyl, leave and take hypocotyl 2mm Left and right, removing remain attached to epicotyledonary hypocotyl tissue；Make 5-7 in the axial direction of cotyledon and the junction of cotyledon hypocotyl Notch infects 30min(OD in the Agrobacterium EHA105 of activation₆₀₀: 0.8 or so)；

3. explant is gone to co-culture medium (culture medium prescription: 2% sucrose, 0.8% agar powder (sigma), 1.67mg/ L 6-BA, 0.25mg/L GA3,0.1 × GAMBORG B-5 BASAL(Phyto Technology Laboratories, goods Number: G398, pH are adjusted to 5.4 or so；) on altogether training growth 3 days after, then go in induced medium induce Multiple Buds (culture medium is matched Side: 2% sucrose, 0.8% agar powder (sigma), 1.67mg/L 6-BA, 10mg/L glufosinate, 1 × GAMBORG B-5 BASAL(Phyto Technology Laboratories, article No.: G398), pH is adjusted to 5.7 or so)；

4. taking generated separate living tissue 2 weeks after inducing Multiple Buds, make new notch (horizontal direction in the base portion of growing point ), and cultured tissue is moved into elongation medium (culture medium prescription: 2% sucrose, 0.8% agar powder (sigma), 0.1mg/L IAA, 1mg/L Zeatin,0.5mg/L GA3,10mg/L glufosinate,1×MURA SHIGE & SKOOG BASAL MEDIOM w/VITAMINS(Phyto Technology Laboratories, article No.: M404), pH is adjusted to 5.7 or so)；

5. culture is shifted on new culture medium every two weeks primary；Every time transfer when explant base portion make one it is new Horizontal cut；

6. after culture in 6-8 weeks the bud (the general long > 4cm of clip bud) of elongation to be moved into life in 1mg/mlIBA after root dipping It takes root on root culture medium (culture medium prescription: 2% sucrose, 0.8% agar powder (sigma), 0.5 × MURA SHIGE & SKOOG BASAL MEDIOM w/VITAMINS(Phyto Technology Laboratories, article No.: M404), pH is adjusted to 5.7 left sides It is right))；Culture about 2-4 weeks, when growing enough root systems, is transplanted；

7. the seedling taken root carefully is moved into small flower, (import soil: Nutrition Soil=1:1) compost is put into flowerpot；After transplanting Freshness protection package need to be covered one week, seedling is made to get used to the new environment of soil and keep humidity, the temperature between cultivating is removed after a week in 26 DEG C Freshness protection package；

8. smearing leaf with Bar genetic test, glufosinate glufosinate (SIGMA, 45520) after transgenic seedling restoration ecosystem Three kinds of methods of piece and Bar test strips (ENVIROLOGIX, 042043) carry out conversion identification, harvest Bar gene masculine transgenosis Strain carries out the expression analysis and phenotype of target gene in the positive plant and the Transgenic wheat line in T3 generation in T1, T2 generation Identification.

Embodiment 5, the Molecular Identification of transgenic plant.

The progeny of plants positive to T1 and T2 generation has carried out the selection Bar gene expression and gene product function of more system Identification.The analysis of glufosinate and Bar test strips is smeared including homozygous lines PCR identification Bar gene, blade.

1) PCR detects reaction method: extracting Soybean genomic DNA and detects for PCR.Whether detection Bar gene is transferred to greatly In beans genome.Bar gene primer: F:CTACATCGAGACAAGCACGGTCAA(SEQ ID NO:4), R: AGAAACCCACGTCATGCCAGTTC(SEQ ID NO:5).Methods of Extracting DNA from Soybean Leaf is as follows:

A. soyabean tissue uses liquid nitrogen grinding in mortar, and the powder being fully ground is moved in 1.5 mL centrifuge tubes；It is added 650 ML CTAB extracting solution (100 mM, Tris-HCl(pH 8.0), 4 mol/L NaCl, 20 mmol/L EDTA(pH 8.0), 2% CTAB uses the preceding addition mL of 2 mL/100 beta -mercaptoethanol), it mixes；

B. 65 DEG C of 30 min of water-bath, intermediate slight oscillatory is several times；

C. it is placed in 5 min on ice；

D. chloroform plus in equal volume: isoamyl alcohol (24:1) mixes gently；

E. room temperature, stands 10 min, and 12000 rpm refrigerated centrifuge, 15 min takes supernatant；

F. plus 2 times of volume ice ethyl alcohol, mix, -20 DEG C of 30 min of standing；

G. it is centrifuged, supernatant is discharged；

H. 70% ethyl alcohol, 1 mL is rinsed 2 times, is dried；

100 μ l of sterile water dissolution, -20 DEG C of refrigerator long-term preservations.

2) herbicide semar technique identifies positive transgenic plant: Basta stoste being diluted to 130 mg/L of concentration, big When beans first are fully deployed trifoliolate leaf, using main lobe arteries and veins as line of demarcation, half leaf are marked with marking pen, is then dipped in cotton swab It takes glufosinate liquid to wipe marked half leaf, reaction of the blade to herbicide is observed after 5 days.For example positive plant then removes The blade that careless agent was smeared does not change much compared with the blade that do not smear, and for example negative plant then smeared the leaf of herbicide Piece obviously turns yellow even withered.

3) Bar test strips Rapid identification method: taking a little blade to be put into 1.5 mL centrifuge tubes, grinds leaf with grinding rod Piece is added 300 μ L extracting solutions, stirs evenly, and by test strips by defined direction insertion mixed liquor, knot is observed after 5 min Fruit.There are 2 bands and indicate that the plant is positive plant in test strips, and 1 explanation occur is negative plant.

Transgenic plant is added for screening, and every generation all carries out single plant identification, until filtering out homozygous transgenic plant.

Embodiment 6, result observation.

By transgenic line and control, kind is normal to sprout in Culture basin simultaneously, is unearthed within four days or so, be unearthed latter 10 days into Row drought stress is about coerced after a week, and control material apparent blade occurs and wilts, and transgenic line is acted normally.Specifically It is the drought-resistant character analysis of Molecular Identification and overexpression plant of the purpose gene in transgenic plant referring to attached drawing 1.As a result It has been shown that, is overexpressed the transgenic plant (- 5, -11) of target gene compared with compareing wild type W82, shows apparent drought resisting table Type (Figure 1A)；The transgenic plant of target gene is overexpressed compared with compareing wild type W82, leaf r elative water content is apparently higher than Control material (Figure 1B), chlorophyll content obviously increase (Fig. 1 C), the content of proline does not occur significantly accumulating (Fig. 1 D).

Foregoing description is only proposed as the enforceable technical solution of the present invention, not as to the single of its technical solution itself Restrictive condition.

Sequence table

<110>Hua Zhong Agriculture University

<120>a kind of method for cultivating drought resisting genetically modified plants

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 181

<212> DNA

<213>Glycine soybean (Glycine max)

<400> 1

gggttctatt ggtggttggg aatggactgt gatgagtgat gtgagatatc tcatgttgac 60

agaagagaga gagcacaacc cgggaatggc taaaggagtc tttgcctttg ttgggagtgt 120

gccctctctt cctctgtcat catcacattc acatgccttt gctttctagc caaagtagac 180

g 181

<210> 2

<211> 27

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 2

tgcaccggtg ggttctattg gtggttg 27

<210> 3

<211> 28

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 3

cgggatcccg tctactttgg ctagaaag 28

<210> 4

<211> 24

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 4

ctacatcgag acaagcacgg tcaa 24

<210> 5

<211> 23

<212> DNA

<213>artificial sequence (Artificial sequence)

<400> 5

agaaacccac gtcatgccag ttc 23

Claims (9)

1. a kind of method for cultivating drought resisting genetically modified plants, it is characterised in that: be overexpressed shown in SEQ ID NO:1 in plant Nucleotide sequence cultivates the genetically modified plants with drought resistant character.

2. a kind of method for cultivating drought resisting genetically modified plants according to claim 1, it is characterised in that: building contains first Then the recombination over-express vector of nucleotide sequence shown in SEQ ID NO:1 constructs transformant using this recombination over-express vector, This transformant is recycled to infect purpose plant, screening obtains the genetically modified plants compared with normal plants with drought resistant character.

3. a kind of method for cultivating drought resisting genetically modified plants according to claim 2, it is characterised in that: the recombinant expression Carrier includes nucleotide fragments shown in pTF101 skeleton carrier and SEQ ID NO:1, and contains at least one strong promoter.

4. a kind of method for cultivating drought resisting genetically modified plants according to claim 3, it is characterised in that: the transformant is adopted It is made with liquid nitrogen freeze-thaw method conversion Agrobacterium EHA105.

5. a kind of method for cultivating drought resisting genetically modified plants according to claim 1-4, it is characterised in that: described Plant is soybean.

6. a kind of method for cultivating drought resisting genetically modified plants according to claim 5, it is characterised in that: this method includes such as Lower step:

A, the DNA of soybean varieties W82 is extracted, -20 DEG C of refrigerators save backup；

B, the clone of gene: according to the nucleotide sequence design primer pair of SEQ ID NO:1, according to the polyclonal position carrier pTF101 Point, prime end introduce Age I and BamH I digestion recognition site respectively, carry out PCR by template of the DNA of soybean varieties W82, Expand the nucleotide sequence of SEQ ID NO:1；Primer sequence are as follows: F:5'-TGCACCGGTGGGTTCTATTGGTGGTTG-3' SEQ ID NO:2；R:5'-CGGGATCCCGTCTACTTTGGCTAGAAAG-3'SEQ ID NO:3；Amplification program are as follows: 95 DEG C 5 minutes；95 DEG C 30 seconds, 57 DEG C 30 seconds, 72 DEG C 40 seconds, 26 circulation；72 DEG C 30 seconds；Pcr amplification product carries out 1% agarose gel electrophoresis, using the band of the raw work plastic recovery kit recovery purifying 181bp size in Shanghai；The DNA of recycling Segment is connect with pMD19-T carrier, and 1 I 5 μ l of μ l, solution of T vector is added in 10 μ l systems, recycles 4 μ l of segment, mixes Even mixed liquor, overnight, thermal shock method is transferred to E.coli competent escherichia coli cell, is incubated overnight, and chooses positive colony for 16 DEG C of connections And it is sequenced；

C, the building of recombinant expression carrier: the carrier T plasmid containing SEQ ID NO:1 sequence is extracted, with restriction enzyme A ge Digestion products are recycled in I and BamH I digestion；With restriction enzyme A ge I and BamH I digestion empty carrier pTF101, recycling is carried Body skeleton；The digestion products of step 1 are connected with the carrier framework of step 2 with T4 ligase；Connection product is heat-shock transformed big Enterobacteria competence DH5 α bacterial strain, 37 DEG C are incubated overnight, and picking positive colony is sequenced, and obtain recombinant plasmid；

D, liquid nitrogen freeze-thaw method converts Agrobacterium EHA105: taking out the 200 μ l competent cells frozen, 5-10 μ is added after thawing L Plasmid DNA flicks tube wall mixing, puts 20-30 min on ice；It is put into liquid nitrogen and is taken out after 5 min, pipe is transferred to 37 DEG C of thawings Afterwards, 800 μ l YEP non-resistant fluid nutrient mediums, 28 DEG C of oscillation 4-5 h are added；Centrifugation, 10000 rpm, 30 sec are gone Clearly, add 100 μ l YEP fluid nutrient mediums, coated plate after suspension thalline, kanamycins containing 50mg/ml；28 DEG C are set to cultivate to white Color transformant is grown, and picking positive monoclonal shakes bacterium, is converted for soybean cotyledon node；

F, the soybean cotyledon node genetic transformation soybean transformation mediated using Agrobacterium EHA105, screening are obtained and normal plants phase Than the genetically engineered soybean with drought resistant character.

7. the nucleotide fragments for cultivating drought resisting genetically modified plants have nucleotide sequence shown in SEQ ID NO:1.

8. expanding the primer pair of nucleotide sequence shown in SEQ ID NO:1, have shown in SEQ ID NO:2, SEQ ID NO:3 Nucleotide sequence.

9. recombinant expression carrier, transformant, expression cassette and utilization SEQ ID comprising nucleotide sequence shown in SEQ ID NO:1 The transgenic drought-resistant plant of the building of nucleotide sequence shown in NO:1.