CN113293167B

CN113293167B - Gene for controlling early and late flowering of tomato and application thereof

Info

Publication number: CN113293167B
Application number: CN202110391989.3A
Authority: CN
Inventors: 张俊红; 张得迪; 艾国; 叶志彪; 李国斌; 黄蓉; 王家发
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2021-04-12
Filing date: 2021-04-12
Publication date: 2022-03-01
Anticipated expiration: 2041-04-12
Also published as: CN113293167A

Abstract

The invention provides a gene for controlling early and late flowering of tomatoes and application thereof, wherein the nucleotide sequence of the gene for controlling early and late flowering of tomatoes is shown in SEQ. NO. 1. Compared with the prior art, the invention has the beneficial effects that: the gene can control the early and late flowering of the tomato, and control different flowering time and the subsequent cultivation of varieties in different flowering stages by a subsequent cloning technology.

Description

Gene for controlling early and late flowering of tomato and application thereof

Technical Field

The invention belongs to the technical field of plants, and particularly relates to a gene for controlling early and late flowering of tomatoes and application thereof.

Background

Tomatoes are important vegetable crops, providing a source of nutrients for humans and many animals (Consortium, 2012), and are also model plants for fruit development studies, early and late flowering studies (Shalit et al, 2009; Soyk et al, 2017; Zhang et al, 2018). The early and late blooming of the tomato plays an important role in the tomato yield, the fruit maturity and the cultivation management.

Nowadays, the tomato blossoming early and late is mainly regulated and controlled by planting management methods such as temperature management, fertilizer and water management and the like, but the regulation and control effect of the planting management method is limited and uncertain. The gene site-directed improvement of the plant can greatly improve the success rate and the effect of regulation and control.

The current study shows that tomato is a neutral plant, and the current cloned genes regulating tomato flowering phase are SFT (Lifschitz et al, 2006; Shalit et al, 2009; Lifschitz et al, 2014), SP (Pneuli et al, 1998; Pneuli et al, 2001), SP5G (Soyk et al, 2017; Zhang et al, 2018; Song et al, 2020), and the like. With the progress of the study, it was found that tomato flowering is a result of simultaneous control of multiple genes. However, so far, many regulatory genes related to early and late flowering of tomatoes are not found, the gene regulatory network of early and late flowering of tomatoes is not complete enough, and the targeted genes for fixed-point improvement of tomato flowering phase in genetic engineering are very limited. Therefore, the discovery of new genes for regulating tomato flowering has important theoretical significance and practical production application value, and is one of important fields of tomato breeding research.

Disclosure of Invention

In order to solve the technical problems, the invention provides a gene for controlling the early and late flowering of tomatoes and application thereof.

The specific technical scheme is as follows:

the gene for controlling the early and late blossoming of the tomato is characterized in that the cDNA nucleotide sequence of the gene is shown in SEQ. NO. 1.

Compared with the prior art, the invention has the beneficial effects that: the gene can control the early and late flowering of the tomato, and the cultivation of varieties of the tomato in different flowering stages and subsequent different flowering stages is controlled by a gene regulation technology.

The protein coded by the gene for controlling the early and late flowering of the tomato is characterized in that the amino acid sequence is shown as SEQ No. 2.

An overexpression vector containing the gene.

The beneficial effect of adopting the further technical scheme is that: the overexpression vector containing the gene sequence shown in SEQ. NO.1 can improve the expression quantity of the gene, and further bring forward the flowering time of the tomato by about 10 days.

Further, the promoter of the overexpression vector is CaMV 35S.

Further, the backbone vector of the overexpression vector is pHellsgate8 vector.

The difference of the method for constructing the overexpression vector is that the method comprises the following steps:

step S1: using cDNA of each tissue of tomato as a template, and adopting primers such as SEQ.NO. 3-SEQ.NO. 4 to perform PCR amplification to obtain a target fragment;

step S2: inserting the target fragment into a linearized vector;

step S3: and transforming the vector inserted with the target fragment into escherichia coli, and extracting to obtain the overexpression vector.

Compared with the prior art, the invention has the beneficial effects that: the overexpression vector for controlling the flowering morning and evening of the tomato can be obtained by the construction method.

The gene for controlling the early and late flowering of the tomato, the protein coded by the gene for controlling the early and late flowering of the tomato and the application of the overexpression vector in controlling the early and late flowering of the tomato or improving tomato varieties.

The biomaterial containing the overexpression vector is characterized in that the biomaterial is a recombinant microorganism or a transgenic plant cell line or a transgenic plant tissue or a transgenic plant organ.

A method for obtaining tomato varieties blooming in advance is characterized in that an overexpression vector containing a gene sequence shown in SEQ. NO.1 is transferred into agrobacterium and then infects tomato explants, and the tomato varieties blooming in advance are obtained after cultivation.

A method for cloning the genes is characterized in that a mutant which blooms early is subjected to tail-PCR detection, mutation sites are locked, molecular marker primers of SEQ.NO. 11-SEQ.NO. 14 are adopted for further verification, and a plurality of genes related to the mutation sites, including Solyc09g065140, are obtained after the mutation sites are confirmed; and (3) detecting the relative expression quantity of the mutation site associated gene by adopting RT-PCR (reverse transcription-polymerase chain reaction), and finally locking Solyc09g065140 as the gene for controlling the flowering phase of the tomato.

Furthermore, primers for amplifying the Solyc09g065140 gene are shown as SEQ.NO. 17-SEQ.NO. 18.

Drawings

FIG. 1 is a graph comparing the flowering phenotype of WT and Early Flowering (EF) mutants;

FIG. 2 is a graph comparing the flowering phenotypes of WT and EF mutants;

FIG. 3 shows statistics of WT and EF flowering;

FIG. 4 is a schematic diagram showing the position of T-DNA insertion in a T-DNA mutant;

FIG. 5 is a schematic diagram showing the position of a T-DNA amplification primer in a mutant;

FIG. 6 shows the results of detection of run of T-DNA primers;

FIG. 7 shows the results of detecting the relative expression levels of the genes involved in the mutation sites;

FIG. 8 is a schematic diagram of Solyc09g065140 gene information;

FIG. 9 shows the expression of Solyc09g065140 gene in WT;

FIG. 10 shows the expression of Solyc09g065140 gene in the tissue of the Solyc09g065140 gene overexpression plant;

FIG. 11 shows flowering conditions of Solyc09g065140 gene overexpression plants.

Detailed Description

The principles and features of this invention are described below in conjunction with the following drawings, which are set forth by way of illustration only and are not intended to limit the scope of the invention.

In the embodiment of the invention, the related statistical methods of the flowering time comprise 2 methods: (1) the number of days (time) required for the tomato to grow to 2cm from sowing to the first panicle inflorescence; (2) the number of leaves below the inflorescence is 2cm after the tomato is sown to the first panicle inflorescence; specifically, the report by Molinaro-Rosales N et al in FALSIFLORA, the tomato orthogonal of FLORICAULA and LEAFY, control flow time and flow molecular identity plant Journal 20(6): 685-.

In the embodiment of the invention, AC (Ailsa Craig) is a germplasm source TGRC.

Example 1

The embodiment provides a method for obtaining a mutant of an early flowering tomato plant, wherein the mutant is obtained by knocking out a GRF6 gene of an AC germplasm by a gene editing vector and then carrying out genetic transformation, and the method comprises the following specific steps:

and a, constructing a gene editing vector. The gene editing vector is pTX (Ye J, Wang X, Hu TX, Zhang FX, Wang B, Li CX, Yang TX, Li HX, Lu YG, Giovannoni JJ, et al.2017. An InDel in the Promoter of Al-ACTIVATED MALATE TRANSPORTER9 Selected dual vector deletion candidates from blood major contacts and Aluminum plasmid deletion plant Cell 29(9): 2249-. The vector is derived from pBin9, the target sequence of the vector is driven by a tomato U6 promoter, and the target sequence 1 is as follows: ATCTTCTCTATACCATCAGA, respectively; target sequence 2: ATTTACAAGTACATGGTCTC, respectively; the Cas9 sequence is driven by 2 serially-connected 35S promoters, and the specific operation method is the conventional technology in the field;

and b, genetic transformation. The genetic transformation of AC germplasm is carried out by adopting an agrobacterium mediating method (2002) reported by Europe, etc., and a tomato mutant capable of flowering early is found in F1 generation plants which are cultured subsequently, and the invention is named as EF (early flower).

Example 2

This example provides a cloning method for controlling early-late tomato flower development mutant genes.

The method comprises the following steps:

(1) and (5) analyzing the characteristics of the EF mutant. Comparing the flowering status of EF and WT (wild type, germplasm is AC) as shown in FIGS. 1-3, wherein the site indicated by the arrow in FIG. 1 is the site of flowering; in FIG. 2, the arrow indicates the place of flowering, and the numeral indicates the place of leaf growth; fig. 1 and 2 together show that EF has no significant difference in the number of leaves in the first inflorescence compared to WT, but the time from sowing to flowering is significantly shortened, the flowering time is significantly earlier, and the number of flowers in the same period is greater.

In FIG. 3, flowering of WT and EF is more carefully counted, in FIG. 3A, the number of leaves is counted over time, in FIG. 3B, the total number of leaves in the first inflorescence before flowering is counted, and in FIG. 3C, the distance between leaves is counted.

As can be seen from FIG. 3, the number of leaves in the first panicle of the EF mutant is not different from that of the WT, the distance between the leaves of the EF mutant is obviously shorter than that of the WT, the leaves are simple, the growth rate of the leaves is high, and the flowering time is at least 10 days earlier than that of the WT.

(2) Cloning and sequence analysis of the EF gene: the early flowering of tomato is probably caused by the insertion of a foreign DNA fragment introduced into a knockout vector to generate a genetic mutation in combination with the process of obtaining the mutant in example 1, and this fragment is named as T-DNA sequence in the present invention, and its length is about 10092 bp.

The insertion site of T-DNA in EF mutant gDNA is detected by using a tail-PCR method, and according to the primer sequences at the left end and the right end of the T-DNA, the detection primers of the tail-PCR are designed as follows: SEQ.NO. 5-SEQ.NO. 10, as shown in FIG. 4, the T-DNA insertion site is preliminarily confirmed at 139bp downstream of the gene termination codon with the sequence number Solyc09g065140, as shown in FIG. 5, for further confirmation, multiple PCR detection primers are further developed before and after the insertion site, P1, P2, P3 and P4 are detection primers, the sequence of P1 is shown in SEQ.NO.11, the sequence of P2 is shown in SEQ.NO.12, the sequence of P3 is shown in SEQ.NO.13, the sequence of P4 is shown in SEQ.NO.14, the detection result is shown in FIG. 6, and the pair of primers P1 and P4 in WT can amplify a band; in the EF mutant, the primer pair p1+ p2 and p3+ p4 can amplify a target fragment, but the primer pair p1+ p4 cannot detect a band due to the insertion of T-DNA, and the detection result further confirms that the position 139bp downstream of the termination codon of the gene of Solyc09g065140 is the insertion site of the T-DNA.

After obtaining the exact insertion point of the T-DNA, four genes of Solyc09g065130, Solyc09g065140, Solyc09g065150 and Solyc09g065160 near the insertion point are locked in order to further clarify the influence of the insertion of the T-DNA on the related genes. Detecting the expression quantity of the genes in the EF mutant, wherein the amplification primer of the Solyc09g065130 (130 for short) is SEQ.NO. 15-SEQ.NO. 16, the amplification primer of the Solyc09g065140 (140 for short) is SEQ.NO. 17-SEQ.NO. 18, the amplification primer of the Solyc09g065150 (150 for short) is SEQ.NO. 19-SEQ.NO. 20, and the amplification primer of the Solyc09g065160 (160 for short) is SEQ.NO. 21-SEQ.NO. 22. The detection result is shown in fig. 7, the expression level of the gene Solyc09g065140 is obviously increased, the gene Solyc09g065140 is preliminarily determined to be a regulatory gene for early and late flowering of tomato, and when the expression level of the gene is increased, early flowering can be realized.

The related information of Solyc09g065140 is shown in FIG. 8, wherein the cDNA sequence of Solyc09g065140 is shown in SEQ. NO.1, the sequence of the amino acid of the encoded protein is shown in SEQ. NO.2(protein), the protein is a protein consisting of 243 amino acids, and the 139 to 191 amino acids of the protein are FANTASTIC FOUR (FAF) protein structural domains, also called SlFAF1/2 c.

The expression conditions of the Solyc09g065140 gene in WT tissues are further studied, and the expression level of the gene in different tissues of tomato is measured, as shown in FIG. 9, the expression level of the Solyc09g065140 gene in roots, leaves, buds and open flowers is higher.

Example 3

In order to further verify the biological function of the Solyc09g065140 gene, an overexpression vector of the Solyc09g065140 gene is constructed in the embodiment, the overexpression vector is transferred into a wild type explant, and a test is performed after the wild type explant is cultured, in the embodiment, AC is used as the wild type explant, and the specific steps are as follows:

(1) and (3) constructing a Solyc09g065140 gene overexpression vector.

And (3) obtaining tomato cDNA. Obtaining roots, stems, leaves and flowers of the AC and fruit samples in different periods, placing the roots, the stems, the leaves and the flowers in liquid nitrogen for quick freezing, extracting RNA, and then carrying out reverse transcription to obtain cDNA of the AC tomato whole tissue.

Primers EF-OE-FW (SEQ. NO.3) and EF-OE-RV (SEQ. NO.4) were designed based on the sequence of the EF-encoding gene. The objective fragment was recovered by PCR amplification using cDNA from AC tomato as a template, and the concentration was measured to obtain an insert.

The pHellsgate8 vector was double-digested with restriction endonucleases XhoI and XbaI, the vector backbone was recovered, and the concentration was determined as a linearized vector.

Using the method of homologous recombination, the insert was recombined into a linearized vector and then heat-shocked to transform E.coli Trans-T1.

Positive clone screening was performed using spectinomycin Sep, and positive detection was performed on single clones using 35S primer (SEQ. NO.23) and EF-OE-RV. And carrying out amplification culture on the positive clone to extract plasmids, selecting plasmids with the sequencing result consistent with the reference sequence after sequencing for storage, and transferring the plasmids into agrobacterium tumefaciens C58 for explant infection.

(2) Genetic transformation of tomato

Example 1 was used to genetically transform AC germplasm and DNA was extracted from the transplanted plant for detection of the target gene. The positive material is the obtained positive transgenic material.

The results of the positive detection of the transgenic material and the detection of the expression level of the transferred gene are shown in FIG. 10, and the results show that O E-5, OE-7 and OE-8 are all positive transgenic materials, and the expression level of the Solyc09g065140 gene in the positive transgenic materials is obviously increased.

The flowering condition is shown in FIG. 11, OE-5, OE-7 and OE-8 are all positive transgenic materials, arrows point to flowering points, numbers are the places where leaves grow, and the results in FIG. 11 show that the flowering time of the over-expressed plants is obviously earlier. Further, the Solyc09g065140 gene is a regulatory gene for regulating tomato flowering.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> university of agriculture in Huazhong

<120> gene for controlling early and late flowering of tomato and application thereof

<160> 23

<170> SIPOSequenceListing 1.0

<210> 1

<211> 732

<212> DNA

<213> TOMATO (TOMATO)

<400> 1

atgacctcaa cttccacact atatcaaggg ctacaatctt gtctagagcc caaaatggca 60

cctcctagac caaatttctc acaacctatc acattgccac aaaagtctaa aatatgtcaa 120

catgaagatg aaattgaaca agaaaatgac aatgttggtg gcttgagctt tatccaagca 180

cttgcaaatc cttgtcaata ctccaaaaaa ggcgacgaga aggacgaaat ctatgttcat 240

cctttggtga aactctcttc tctcaacaca aatagtttga atatgtgcac tgaaagctta 300

ggaagtgaaa caggcagtga cattagtgaa aacattgacg aaaaagaaac tatttttcac 360

ggagctcaac gatcaaaatg tagagaattt gcgaaaaaaa tcaaaagggt agctagttat 420

ccacctccac taacttcaat gagtggaaat gaaggtgtcc aaattaggcc tcatcgcgag 480

ggtggtcgtt tattattaaa agcaacatca atcacttctt ggaactctag ttttcgagtg 540

gaacgtgcta atggtaggct caagctttct ttgttaatgc atggagaaga agatgtcata 600

atccaaaatg atgaagaaag ttgtagtagt aaattaggag agtattcaag tagaccaaca 660

aggtgcaaag caagtggtag taggaataaa tggatttcat gttgggagcc attttgggtg 720

gctatatctt ga 732

<210> 2

<211> 243

<212> PRT

<213> TOMATO (TOMATO)

<400> 2

Met Thr Ser Thr Ser Thr Leu Tyr Gln Gly Leu Gln Ser Cys Leu Glu

1 5 10 15

Pro Lys Met Ala Pro Pro Arg Pro Asn Phe Ser Gln Pro Ile Thr Leu

20 25 30

Pro Gln Lys Ser Lys Ile Cys Gln His Glu Asp Glu Ile Glu Gln Glu

35 40 45

Asn Asp Asn Val Gly Gly Leu Ser Phe Ile Gln Ala Leu Ala Asn Pro

50 55 60

Cys Gln Tyr Ser Lys Lys Gly Asp Glu Lys Asp Glu Ile Tyr Val His

65 70 75 80

Pro Leu Val Lys Leu Ser Ser Leu Asn Thr Asn Ser Leu Asn Met Cys

85 90 95

Thr Glu Ser Leu Gly Ser Glu Thr Gly Ser Asp Ile Ser Glu Asn Ile

100 105 110

Asp Glu Lys Glu Thr Ile Phe His Gly Ala Gln Arg Ser Lys Cys Arg

115 120 125

Glu Phe Ala Lys Lys Ile Lys Arg Val Ala Ser Tyr Pro Pro Pro Leu

130 135 140

Thr Ser Met Ser Gly Asn Glu Gly Val Gln Ile Arg Pro His Arg Glu

145 150 155 160

Gly Gly Arg Leu Leu Leu Lys Ala Thr Ser Ile Thr Ser Trp Asn Ser

165 170 175

Ser Phe Arg Val Glu Arg Ala Asn Gly Arg Leu Lys Leu Ser Leu Leu

180 185 190

Met His Gly Glu Glu Asp Val Ile Ile Gln Asn Asp Glu Glu Ser Cys

195 200 205

Ser Ser Lys Leu Gly Glu Tyr Ser Ser Arg Pro Thr Arg Cys Lys Ala

210 215 220

Ser Gly Ser Arg Asn Lys Trp Ile Ser Cys Trp Glu Pro Phe Trp Val

225 230 235 240

Ala Ile Ser

<210> 3

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

catttggaga ggacacgctc gagatgacct caacttccac acta 44

<210> 4

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tctcattaaa gcaggactct agatcaagat atagccaccc aaaa 44

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

caatcatgcg aaacgatcca 20

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgaccttagg cgacttttga ac 22

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cataacgtga ctcccttaat tctc 24

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cgccctgata gacggttttt 20

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tctcgggcta ttcttttgat tt 22

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gtgaaaagaa aaaccacccc a 21

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tcattgaaag tgtagaatcc tccg 24

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cataacgtga ctcccttaat tctc 24

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

actcgctagg ggcaactccc 20

<210> 14

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cttaggaagt gaaacaggca gtga 24

<210> 15

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tatcgtcacc ttgttaatcg ct 22

<210> 16

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cgtgcagcat aagatcgata tg 22

<210> 17

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gtagctagtt atccacctcc ac 22

<210> 18

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tccactcgaa aactagagtt cc 22

<210> 19

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

tagacattac aacagcctat gtgagaaa 28

<210> 20

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

agaagaaact gaaatcattg cgaa 24

<210> 21

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

ctatatactc gagtgtccgc tc 22

<210> 22

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

tttgatctcc ggcctcttaa at 22

<210> 23

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

acgcacaatc ccactatcct tc 22

Claims

1. A method for obtaining tomato varieties blooming in advance is characterized in that an overexpression vector containing a gene with a cDNA nucleotide sequence shown in SEQ. NO.1 is transferred into agrobacterium and then infects tomato explants, and the tomato varieties blooming in advance are obtained after cultivation.

2. The method of claim 1, wherein the promoter of the overexpression vector is CaMV 35S.

3. The method for obtaining early flowering tomato varieties according to claim 1 or 2, wherein the method for constructing the overexpression vector comprises the following steps:

step S2: inserting the target fragment into a linearized vector;