CN110066808B

CN110066808B - Application of GY3 gene in controlling number of glumes per ear and yield of rice per plant

Info

Publication number: CN110066808B
Application number: CN201910195096.4A
Authority: CN
Inventors: 邢永忠; 吴比; 毛东海
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2019-03-14
Filing date: 2019-03-14
Publication date: 2021-02-02
Anticipated expiration: 2039-03-14
Also published as: CN110066808A

Abstract

The invention belongs to the field of plant genetic engineering. In particular to application of GY3 gene in controlling the number of glumes per ear and the yield of a single plant of rice. The gene is positioned at the tail end of the long arm of the No. 3 chromosome of rice and controls the property function of the number of glumes per spike of rice. The sequence of the coding region of the gene is shown as SEQ ID NO:1, and the protein sequence is shown as SEQ ID NO: 2, respectively. The coding sequence of the allele of the gene is shown as SEQ ID NO: 3, respectively. The sequences of the retrotransposon insertion in the GY3 gene promoter are shown in SEQ ID NO: 4, respectively. Comparative sequencing proves that a 3882bp retrotransposon insertion exists in promoters of broad-affinity japonica rice 02428 and indica rice ultragreen, so that the 02428 expression level is reduced, and the 02428 allelic genotype is increased. The number of glume flowers per ear and the yield of the over-expression plants are obviously reduced. Is matched with the low expression increasing effect of GY3 in NIL-02428.

Description

Application of GY3 gene in controlling number of glumes per ear and yield of rice per plant

Technical Field

The invention relates to the technical field of plant genetic engineering. In particular to application of GY3 gene in controlling the number of glumes per ear and the yield of a single plant of rice. The invention carries out separation cloning, functional verification and application as rice backbone variety yield character improvement on a gene GY3 for controlling the number of glumes per spike of rice at the tail end of a long arm of a rice 3 rd chromosome.

Background

Rice is an important food crop for human beings, and as the population increases, the living standard increases and urbanization leads to continuous reduction of arable area, a severe demand is provided for the increase of rice yield, so that the genetic improvement of rice yield is always an important target of breeding. The rice yield is mainly determined by the yield of a single plant, the product of the grain number of each ear, the thousand kernel weight and the tillering number constitutes the yield of the single plant, meanwhile, the length of the heading stage determines the regional adaptability of the variety, and the appropriate plant height ensures that the biomass is as high as possible and the lodging resistance is realized, so that the stability of the rice yield is ensured.

Numerous genes have been cloned in rice that affect yield. Gn1a (Ashikari M et al, Cytokinin oxidase regulation rice grain production, Science,2005,309:741-745) is a gene affecting the yield of Japanese clone, and encodes Cytokinin oxidase OsCKX2, which promotes the degradation of cytokinins and increases the yield by accumulating the cytokinins after mutation. Huang et al (Huang X et al, Natural variation at the DEP1 loci of enhancement of grains in rice, Nat Genet,2009,41: 494-. Zha (Zha X et al, Over-expression of the rice LRK1gene improved quantitative ingredients, Plant Biotechnol J,7:611-20) clones a leucine-rich repeat receptor-like kinase gene LRK1, LRK1 is a plasma membrane protein, which is constitutively expressed in young ears, and overexpression of this gene increases the number of flowers per ear. The ideal plant type gene OsSPL14 codes Squamosa-like promoter binding protein and is regulated and controlled by micro-RNA OsmiR156, and during the vegetative growth period, OsSPL14 controls rice tillering; in the reproductive growth period, the high expression of OsSPL14 promotes ear branches, and researches show that one point mutation of OsSPL14 disturbs the Regulation of OsmiR156 on OsSPL14, after OsSPL14 mutation, rice tillering is reduced, the number of ears and thousand-grain weight are increased, simultaneously stalks become thick and strong, the lodging resistance is enhanced, and further the yield is improved (Jiano Y et al, Regulation of OsSPL14by OsmiR156defines ideal plant architecture in rice, Nat Genet,42: 541). Further genes with pleiotropic properties, such as Ghd7(Weiya Xue et al, Natural variation in Ghd7is an important regulator of growing date and yield potential in rice, Nat Genet,2008,40:761 767), Ghd8(Wenhao Yan et al, A major QTL, Ghd8, plant osteogenic roles in growing yield, plant height, and growing date in rice, Mol plant,2011,4: 319-.

Disclosure of Invention

The invention aims to overcome the defects of the prior art, and clones a gene GY3 for controlling rice grain yield (particularly controlling the number of glumes per spike and the yield of a single plant) and application thereof. Under the condition of not prolonging the heading period, the gene enables the backbone variety to increase the yield remarkably, and has better production application prospect. The applicant named this cloned gene GY3 (gain yield 3).

The invention clones a gene which is positioned at the tail end of the long arm of the 3 rd chromosome and can simultaneously increase the secondary branch of rice, the number of glume flowers per spike and the yield of a single plant by using a map-based cloning method, and can increase 10 secondary branches, the number of glume flowers per spike of about 50 grains and the yield of a single plant of about 10 kilograms in the background of a near isogenic system. Meanwhile, through analysis, japonica rice carries the yield-increasing allele, while indica rice only partially carries the yield-increasing allele, and the yield of indica rice can be improved by applying the yield gene. The excellent allele in japonica rice is introduced into backbone varieties '93-11', 'Minghui 63' and 'Teqing' by a continuous backcross method, which has obvious yield increasing effect. Therefore, the GY3 gene has strong application value.

The technical scheme of the invention is as follows:

(1) QTL scanning and near isogenic line construction: f is obtained by hybridizing a rice variety '02428' (from agricultural academy of Jiangsu province) and 'Teqing' (TQ) (breeding and heyday of yellow-dazzling Xiang academy of agricultural academy of Guangdong province)₁SSR markers RM570 and RM7389 (primer sequences reference websites)http://www.gramene.org/Design) identifying true hybrid, selecting true hybrid and backcrossing with 02428 for 4 times to obtain BC₄F₁Construction Process referring to FIG. 1, plant introduction line BC₄F₂The population was isolated and subjected to QTL scan for yield-related traits, and a QTL qGY3(Bi Wu et al, Two quantitative trap loci for grain yield and plant height on chromosome 3 arm light linked in synergistic phase i) controlling the number of panicle flowers and yield of rice was detected at the end of chromosome 3n rice, Mol Breeding,2015,35: 156). For further validation and cloning of qGY3, BC was selected₄F₂Backcrossing and selfing single plant with number M43 in colony with recurrent parent to obtain BC₅F₂And separating the population, and through genetic analysis of the separated population, finding that the homozygous 02428 allele has a yield increasing effect, and can increase about 50 glume flowers per ear and about 10 micrograms of single plant yield, namely completing the construction and primary positioning of the GY3 near isogenic line.

(2) Fine localization and candidate gene determination for GY 3: 2500 near isogenic line background F planted in Wuhan in 2014₂The large population performed a fine mapping of genes, mapping genes to an approximately 60kb interval of the common marker RM7389 and InDel marker ID1 (FIG. 1). By performing function prediction on the segment gene, LOC _ Os03g64070 is found to be a gene LOG-like5 (the CDS sequence of which is shown as SEQ ID NO:1 and is named GY3 gene later in the invention) for encoding cytokinin activating enzyme, and by performing comparative sequencing on the LOG-like5, compared with ' ultramarine ', a 3882bp retrotransposon insertion is formed in the ' 02428 ' promoter, a 9bp fragment insertion is formed in the 33bp position of the 5 ' UTR region upstream of the ATG, and a primer combination is designed for the retrotransposon insertion/deletion to identify all recombinant single strains and find that the recombinant single strains are co-separated from the phenotype. LOG-like5 encodes a cytokinin nucleoside 5' -monophosphate nucleoside hydrolase, which promotes cytokinin synthesis. While Using conventional Real Time (Kenneth J. Livak et al, Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2^-ΔΔC _TMethods,2001,25(4): 402-. Therefore, the present invention identifies it as a candidate gene.

(3) Functional verification of the GY3 gene: CDS of LOG-like5 is amplified from rice 'extra green' by a PCR method, is connected to a pU1301 vector, and a candidate gene is transferred into '02428' by an agrobacterium-mediated genetic transformation method. And phenotype examination is carried out at the T0 generation, compared with transgenic negative plants, transgenic plants over-expressing LOG-like5 can increase glume flower number by 56 per ear on average, and the yield of a single plant is increased by 11 g, so that the candidate gene LOG-like5 of GY3 is determined to have the function of increasing glume flower number and yield of the single plant per ear.

(4) The GY3 gene can obviously increase the yield of rice backbone parents: through comparative sequencing of rice backbone varieties, most of GY3 in indica rice backbone varieties is of extra-green allelic type, so that japonica rice excellent allelic genes are introduced into main indica rice restorer lines 93-11, Minghui 63 and extra-green through backcross, and the yield of improved backbone parent single plants is remarkably increased.

The invention has the beneficial effects that:

the cloned rice GY3 gene can obviously increase the number of glumes per spike and the yield of rice without influencing the heading stage, and can realize the application of high-yield breeding of rice by changing the expression quantity of the gene.

Drawings

FIG. 1: general technical roadmap of the invention. Description of reference numerals: hybridization of the Rice variety "02428" with "Teqing" to yield F₁Then, the rice variety 02428 is used as a recurrent parent, and the BC is obtained through continuous backcross₄F₁Collecting inbred seeds and planting BC₄F₂QTL scans were performed on segregating populations. Detecting a QTL qGY3 controlling the number and yield of glume flowers per ear at the end of the long arm of the 3 rd chromosome, selecting M43 single plants, carrying out backcross with 02428 continuously and selfing to obtain BC₅F₂Population for genetic analysis and fine localization of GY 3.

FIG. 2: the invention relates to an important recombinant individual plant in fine positioning. Description of reference numerals: the marker names used to identify the genotype of the recombinant individuals, which are generally homozygous for one genotype and heterozygous for the other genotype, are shown above the black line, with segregation occurring in the progeny of the recombinant individuals. Therefore, the inbred progeny BC of the recombinant individual plants are planted separately₅F₃Families, all individuals in each family are marked to identify the genotype, and the genotype results are compared to judge whether the homozygous ultramarine genotype and the homozygous 02428 genotype individual in the same family have significant difference of yield-related phenotype, so as to deduce the GY3The genotype of the plant. As shown in FIG. 2, species data, TQ, are listed for the number of grains per ear (grain number per panicle) and yield (yield) of secondary branch (secondary branch), respectively^Mean±SD02428 mean. + -. standard deviation representing genotype homozygosity as TQ phenotype value in each pedigree^Mean±SDRepresent the mean ± sd of the homozygous 02428 phenotype values for the genotypes in each pedigree. As can be seen from fig. 2, significant differences in phenotype were present between the different genotypes of

families

2, 3, 4, 5 and 9, thus determining that GY3 was located in the region from RM7389 to ID 1.

FIG. 3: the invention relates to a comparison of two genotypes of a Near Isogenic Line (NIL) main stem ear. Description of reference numerals: the isogenic line is mainly the phenotype of the stem spike, and compared with the isogenic line NIL-TQ, the isogenic line NIL-02428 has more secondary branches and grains per spike.

FIG. 4: the near isogenic line constructed by the invention and the main stem ear phenotype of the high-yield allele introduced backbone variety. Description of reference numerals: the graphs A, B and C in FIG. 4 and 4 are respectively "extra cyan" (TQ) and "TQ^GY3"," Minghui 63 "(MH 63) and" MH63^GY3"and" 93-11^GY3"wherein: a1, B1 and C1 are overall strain patterns, A2, B2, C2, A3, B3 and C3 are mature-stage ear patterns, and it can be seen from the figure that the introduction of GY3 makes the ear of rice significantly larger, the number of secondary branches is increased, and the effect of increasing the size of the ear of rice of these varieties can be achieved.

FIG. 5: the overexpression vector used in the invention is constructed schematically. Description of reference numerals: the CDS of GY3 was amplified by PCR in the present invention, and single-digested with KpnI, and ligated to the multiple cloning site indicated by the black arrow in the PU1301 expression vector by one-step method.

Detailed Description

Description of sequence listing:

SEQ ID NO:1 is the nucleotide sequence of the coding region (CDS) of the GY3 gene isolated in the invention.

SEQ ID NO: 2 is the protein sequence encoded by the GY3 gene.

SEQ ID NO: 3 is an allele of the GY3 gene (GY3)^TQ) The nucleotide sequence of the coding region (CDS).

SEQ ID NO: 4 is an allele of the GY3 gene (GY3)^TQ) The encoded protein sequence.

SEQ ID NO: 5 is the transposon nucleotide sequence of rice "02428" upstream of the GY3 gene.

Scanning QTL (quantitative trait loci) controlling the number of glumes per ear and the yield of a single plant from the end of a3 rd chromosome of a rice variety 'extra green', selecting an M43 single plant with an SSR marker RM16217 being a TQ genotype, and continuously backcrossing the M43 single plant with 02428 to purify a genetic background, reducing the interference of the genetic background difference on gene positioning, thereby constructing an isogenic line NIL (GY3), and utilizing BC (basic chromosome) to obtain the near isogenic line NIL (GY3)₅F₂And (4) carrying out genetic analysis and QTL effect detection on the segregation population. Screening of 2500 lines of BC₅F₂Individuals were recombined in the population and the recombined individuals were post-tested to fine-locate GY3 and finally the GY3 gene in a segment of about 60kb from the SSR marker RM7389 to the ID1 region. The interval contains a cytokinin activating enzyme gene LOG-like5, comparative sequencing of the LOG-like5 finds that 9bp insertion/deletion exists in 5' UTR at the upstream of ATG between parents, and genotyping is carried out on recombinant single plants to find that the 9bp deletion is completely coseparated with phenotype, so that the gene is determined as a candidate gene. The ultragreen allele of the gene is connected to a pU1301 overexpression vector to be transformed into '02428', a plurality of transgenic positive individuals have the phenotype that the number of spikelets per ear is reduced and the yield of the individual is reduced at the T0 generation, and the LOG-like5 is the GY3 gene.

The following examples further define the invention and describe the isolated cloning and functional validation of the GY3 gene. From the following description and these examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.

Example 1: positioning and effect analysis of GY3

(1) Discovery of GY 3: the breeding of the rice variety '02428' (the heyday of the agricultural academy of sciences of Jiangsu province) and the rice variety 'extra green' (the yellow dazzling courtyard of the agricultural academy of sciences of Guangdong province)And benefit) to obtain hybrid F₁And using '02428' as recurrent parent, continuously backcrossing 4 times to obtain BC₄F₁Selfing and planting BC₄F₂Families (24 plants are planted in each family), phenotypes of traits such as yield and number of glumes per ear of each family are collected, SSR markers (described in Mao, Donghai and the like in the east China sea and other countries) used for constructing genetic maps of Recombinant Inbred Lines (RILs) are combined with the genetic maps of "02428" and "TQ" Recombinant Inbred Lines (RILs) (described in the literature: Mao, Donghai and the like in the east China, Epistasis and comparative gene actions for the genetic bases of transgenic section of rice-grain weight in rice, Euphytoica, 2011,180: 261-. Finally, a QTL qGY3 which simultaneously controls the number of glumes per ear and the yield of a single plant is identified near the SSR marker RM148(www.gramene.org) at the end of the long arm of the 3 rd chromosome.

(2) Construction and effect evaluation of GY3 near isogenic line: in order to further analyze the gene influencing the yield of the single rice plant with the number of glumes per ear, the invention plants the BC with 140 single plants₄F₂Population, using SSR marker to identify the genotype of each individual strain, using MapMaker to construct local region genetic linkage map, then using WinQTL cartographer 2.5 software to select composite region mapping method to perform QTL scanning (see: Zeng ZB. precision mapping of 5 quaternary trail loci genetics,1994,136:1457-₄F₂GY3 was located between chromosome 3 terminal SSR markers RM148 and RM16211, and BC was tested from 140 individual progeny₄F₃Pedigree phenotype, GY3 can be located between RM16211 and RM7389 (see Bi Wu et al, Two qualitative trail loci for grain yield and plant height on chromosome 3 arm light linked in synergistic phase in rice, Mol Breeding,2015,35: 156). According to BC₄F₂And BC₄F₃The pedigree positioning results are inconsistent, the influence on the positioning results can be inferred due to impure background, and meanwhile, the applicant selects the single strain M43 of which RM16217 is pure and is 'TQ, namely ultramarine', and combines 'M43' with '02428'Backcrossing once again and selfing to obtain BC₅F₂The population was used for evaluation of the GY3 effect and fine localization of the genes. At BC₅F₂30 homozygous 02428(NIL-02428) and ultramarine (NIL-TQ) genotype single plants (spike type is shown in figure 3) are respectively selected from the population, the number of glumes per spike, the number of grains per spike, one branch, two branches, thousand grain weight and single plant yield are examined, and the results are shown in table 1.

TABLE 1 comparison of yield traits in near isogenic lines

As can be seen from table 1, in the context of the near isogenic lines, an individual with a 02428 allelic form of GY3 had an increase in the number of glumes per ear and the number of kernels per ear of 50 plus, an increase in secondary shoots of more than 15 and an individual yield of approximately 15 grams.

(3) Fine positioning of GY 3: BC in 2500 strains₅F₂Within the population, each individual was genotyped using the InDel markers ID8 and RM16217 designed by the applicant himself. Selecting the recombinant single plant with two side marker genotypes for the next generation test, and identifying the next generation test F₃Genotype of each individual in the family, and detection of F₃Whether the phenotype of the two homozygous genotype individuals of the family is significantly different or not is used for deducing the genotype of GY3 in the recombinant individual. By adding molecular markers between ID8 and RM16217 and identifying the genotype of the recombinant individual, GY3 could be located in the 60kb region from RM7389 to ID1 in combination with the genotype of GY 3. The sequences of the newly developed InDel markers of the present invention are shown in Table 2.

TABLE 2 GY3 sequences of Fine positioning primers

The fine localization region contained 9 genes, one being annotated as the cytokinin activating enzyme LOG-like5 (accession number LOC _ Os03g64070) (http:// rapdbleglacey. dnas. affrc. go. jp /). LOG (Takashi K et al, Direct control of shoot activity by a cytokine-activating enzyme,2007,445: 652-. Similar functions are found in Arabidopsis thaliana (Kuroha T et al, Functional analyses of LONELY GUY cytokine-activating enzymes present the organism of the direct activation pathway in Arabidopsis,2009,21: 3152-. Comparative sequencing of the full-length CDS and promoter of LOG-like5 revealed that the 02428 promoter had a 3882bp insert of the gyrosyl LTR-retrotransposon from rice (long terminal repeat) and that 02428 had an GACCAGCAG deletion 33bp upstream from the ATG translation start site. A difference of 3 SNPs was identified between the 02428 and ultramarine coding regions, but did not result in alteration of the protein coding sequence. The LOG-like5 expression level detection shows that the NIL-TQ expression level is higher than that of NIL-02428. It is inferred that the insertion of the transposon may lead to a decrease in the expression level, thereby increasing the number of grains per ear and increasing the yield.

Using the insertion/deletion of retrotransposon, 3 primers CL1F, CL1R and CL1-2F (primer sequences are shown in Table 3) were designed to identify whether the rice has retrotransposon insertion. The parents 02428 and TQ are subjected to PCR amplification by using primer combinations such as CL1F + CL1R and CL1-2F + CL1R, so that whether the insertion of an inverted seat exists in the parents can be identified, the parents 02428 can successfully amplify CL1-2F + CL1R but not CL1F + CL1R, the type with the inverted seat insertion is adopted, and the parents can amplify CL1F + CL1R but not CL1-2F + CL1R, the type without the inverted seat insertion is adopted. Meanwhile, the applicant carries out PCR amplification on 533 rice germplasm groups (collected by the national emphasis laboratory of the university of agriculture crop genetic improvement in Huazhong, http:// ricevarmap. ncpgr. cn/v2/) DNA, and basically all japonica rice has retrotransposon insertion (CL1-2F + CL1R can amplify but CL1F + CL1R cannot amplify), while indica rice only has partial varieties with retrotransposon insertion (CL1F + CL1R can amplify but CL1-2F + CL1R cannot amplify), and meanwhile, the applicant also identifies more than 100 wild rice, one part of which has retrotransposon insertion and the other part of which does not. The primer sequences used for amplification are shown in Table 3.

TABLE 3 primer for retrotransposon insertion/deletion identification localization in GY3 promoter

Example 2: transgenic functional verification of GY3

(1) Obtaining of the transformation fragment: the DNA fragment increasing GY3 was amplified from the parent Teqing using the primers shown in Table 4, using the following procedure and PCR reaction conditions: 4 minutes at 94 ℃,30 seconds at 58 ℃ and 30 seconds at 72 ℃, and 1 minute and 30 seconds at 4 ℃ from the steps of circulation 35 times to the step of circulation, and 15 minutes at 72 ℃ and storage at 4 ℃. PU1301 is a plant expression vector modified in the key laboratory of the country where the applicant is in the genetic improvement of crops, and a ubiquitin promoter and an NOS (synthase amplification signal) terminator of corn are inserted into the pCAMBIA1301 multiple cloning site (FIG. 5). Thus, the ubiquitin promoter is used to drive the overexpression of the foreign gene (Qiu D et al, OsWRKY13media disease resistance by regulating the transformed genes in silicate-and jasmal-dependent signaling, Molecular plant-micro interactions: MPMI,2007,20: 492-499). The PU1301 vector was digested with KpnI, and the PCR product and the digested product were recovered using a recovery kit from Fermentas (see the description for Methods, item # K0513) and ligated in one step (see Gibson Dg et al, enzymic assembly of DNA molecules up to recombinant human clones, Nature Methods,2009,6: 343-.

Primers used for overexpression transgenic vector construction of GY3 in Table 4

(2) Escherichia coli DH10B (eppendorf Electroporator 2510, voltage parameter 1800v, using method as instruction, Escherichia coli DH10B strain purchased from promega company) was transformed by ligation product, ligation product was applied on LA plate containing 30mg/L kanamycin, after 16h single colony was picked up in 1mL LB medium containing 30mg/L kanamycin, plasmid was extracted after 12h culture, positive clone was detected by KpnI enzyme digestion (operation method as J. SammBruk, EF Frizhi, T Mannich Abies, Huangpetang, Wangjia, etc., molecular cloning experimental manual (third edition), scientific Press, 2002 edition). Sequencing the positive clone to confirm that the exogenous fragment has no mutation.

(3) And (3) converting 02428: the vector constructed in step (2) is electrically transformed into agrobacterium (a. tumefaciens) EHA105 (purchased from CAMBIA laboratories, australia), referring to the method for electrically transforming the ligation product in step (2). The method 02428 for genetic transformation was carried out with reference to the method reported by Hiei et al (Hiei et al, Efficient transformation of rice (Oryza sativa L.), mediated by Agrobacterium and sequence analysis of the bases of the T-DNA plant J,1994,6: 271-282).

(4) Transgenic plants of T0 generation are obtained. The transgenic individuals were identified by using GUS primers (Table 4), and those that could be amplified were transgenic positive individuals, while those that could not be amplified were transgenic negative individuals.

TABLE 4 transgenic Individual Positive identification primers

(5) Through the investigation of the yield-related phenotype of over-expressed plants of T0 generations, the number of glume flowers per ear of transgenic positive plants is reduced by about 50 grains, the number of the fruit grains per ear is reduced by about 40 grains, and secondary branches are reduced by about 10 grains, so that the yield of a single plant is reduced by about 26 grams compared with that of a 02428 negative plant, and the result that the yield of the single plant of rice is reduced by improving the expression quantity of the GY3 gene is consistent with the result that the yield of the single plant is reduced by the high GY3 expression quantity in NIL-TQ. Therefore, the GY3 gene is successfully cloned, and the gene reduces the secondary stem of rice, the number of glumes per ear and the number of grains per ear and reduces the yield of a single rice plant by improving the expression quantity.

TABLE 5 transgenic Individual plant yield-related trait review

Example 3: by 02428^GY3Allele modified backbone parent

Through the genotype identification of the rice varieties 93-11 (bred and presented in the agricultural science research institute of the region of the lower river of Rituo, Jiangsu), Minghui 63 (bred and presented in Schwaran academy of agricultural science of Sanming City, Fujian province) and Teqing (bred and presented in Huang-Yangxiang academy of agricultural science, Guangdong province) by utilizing the primer combination of CL1F + CL1R, no retrotransposon insertion is found. In the inbred line (NIL), NIL-02428 has yield increasing effect relative to NIL-TQ. In order to verify whether the GY3 of japonica rice allelic type has the effect of increasing yield in the indica rice background, 93-11, ultramarine and Minghui 63 are selected as acceptor parents and 02428 is selected as donor parents to be hybridized respectively to obtain F₁Backcrossing with the receptor parent for 4 times and selecting GY3 gene by using primer combination CL1F + CL1R and CL1-2F + CL1R to obtain BC with the genotype of GY3 02428 in the background of 93-11, Minghui 63 and Teqing respectively₄F₁Selfing to obtain BC₄F₂Planting BC₄F₂And relevant traits affecting yield were examined (FIG. 4). The yield increasing effect is good when the yield characters are inspected.

The main steps of the genetic transformation, the culture medium and the preparation method thereof of the invention are as follows:

(1) abbreviations for reagents and solutions the abbreviations for the plant hormones used in the medium of the present invention are as follows: 6-BA (6-BenzylaminoPurine, 6-benzyladenine); CN (Carbenicillin ); KT (Kinetin ); NAA (Napthalene acetic acid, naphthylacetic acid); IAA (Indole-3-acetic acid, indoleacetic acid); 2,4-D (2, 4-dichlorphenoxyacetic acid, 2,4-Dichlorophenoxyacetic acid); AS (acetosyringone); CH (Casein enzymic Hydrolysate, hydrolyzed Casein); HN (Hygromycin B, Hygromycin); DMSO (Dimethyl Sulfoxide); n6max (N6 macronutrient solution); n6mix (N6 trace element composition solution); MSmax (MS macronutrient component solution); MSmix (MS microelement component solution)

(2) Main solution formulation

1) N6 medium macroelement mother liquor (prepared as 10-fold concentrated solution (10 ×)):

the reagents are dissolved one by one, and then the volume is adjusted to 1000 ml by distilled water at room temperature.

2) Preparing N6 culture medium microelement mother liquor (according to 100 times of concentrated solution (100X))

The above reagents were dissolved at room temperature and made up to 1000 ml with distilled water.

3) Ferric salt (Fe2EDTA) stock solution (prepared as 100X concentrate)

3.73 g of disodium ethylene diamine tetraacetate (Na2 EDTA.2H2O) and 2.78 g of FeSO 4.7H2O are respectively dissolved, mixed and added with distilled water to be constant volume to 1000 ml, and the mixture is heated and bathed for 2 hours at 70 ℃ and stored for standby at 4 ℃.

4) Vitamin stock solution (prepared according to 100X concentrated solution)

Adding distilled water to a constant volume of 1000 ml, and storing at 4 ℃ for later use.

5) MS culture medium macroelement mother liquor (MSmax mother liquor) (prepared according to 10X concentrated solution)

6) MS culture medium microelement mother liquor (MSmin mother liquor) (prepared according to 100X concentrated solution)

7) Preparation of 2,4-D stock solution (1 mg/ml):

weighing 100 mg of 2,4-D, dissolving with 1ml of 1N potassium hydroxide for 5 minutes, adding 10 ml of distilled water to dissolve completely, then fixing the volume to 100 ml, and storing at room temperature.

8) Preparation of 6-BA stock solution (1 mg/ml):

weighing 100 mg of 6-BA, dissolving for 5 minutes by using 1ml of 1N potassium hydroxide, adding 10 ml of distilled water to dissolve completely, then fixing the volume to 100 ml, and storing at room temperature.

9) Formulation of stock solutions of naphthaleneacetic acid (NAA) (1 mg/ml):

weighing 100 mg of NAA, dissolving with 1ml of 1N potassium hydroxide for 5 minutes, adding 10 ml of distilled water to dissolve completely, fixing the volume to 100 ml, and storing at 4 ℃ for later use.

10) Formulation of Indole Acetic Acid (IAA) stock solution (1 mg/ml):

weighing 100 mg of IAA, dissolving with 1ml of 1N potassium hydroxide for 5 minutes, adding 10 ml of distilled water to dissolve completely, fixing the volume to 100 ml, and storing at 4 ℃ for later use.

11) Preparation of glucose stock solution (0.5 g/ml):

weighing 125 g of glucose, dissolving with distilled water to a constant volume of 250 ml, sterilizing and storing at 4 ℃ for later use.

12) Preparation of AS stock solution:

weighing 0.392 g of AS, adding 10 ml of DMSO for dissolving, subpackaging into 1.5 ml of centrifuge tubes, and storing at 4 ℃ for later use.

13) The potassium hydroxide 5.6 g is weighed from the 1N potassium hydroxide stock solution, dissolved by distilled water to a constant volume of 100 ml, and stored at room temperature for standby.

(3) Culture medium formula for rice genetic transformation

1) Induction medium

Adding distilled water to 900 ml, adjusting pH to 5.9 with 1N potassium hydroxide, boiling to 1000 ml, packaging into 50 ml triangular flask (25 ml/bottle), sealing, and sterilizing by conventional method (such as 121 deg.C for 25 min, the following method for sterilizing culture medium is the same as that for the present culture medium).

2) Subculture medium

Adding distilled water to 900 ml, adjusting pH to 5.9 with 1N potassium hydroxide, boiling, diluting to 1000 ml, packaging into 50 ml triangular flask (25 ml/bottle), sealing, and sterilizing.

3) Pre-culture medium

Adding distilled water to 250 ml, adjusting pH to 5.6 with 1N potassium hydroxide, sealing, and sterilizing as above.

The medium was dissolved by heating and 5 ml of glucose stock solution and 250. mu.l of AS stock solution were added before use and dispensed into petri dishes (25 ml/dish).

4) Co-culture medium

5) Suspension culture medium

Adding distilled water to 100 ml, adjusting pH to 5.4, subpackaging into two 100 ml triangular bottles, sealing, and sterilizing according to the above method.

1ml of sterile glucose stock solution and 100. mu.l of AS stock solution were added before use.

6) Selection medium

Adding distilled water to 250 ml, adjusting pH to 6.0, sealing, and sterilizing as above.

The medium was dissolved before use and added to 250. mu.l of HN (50 mg/ml) and 400. mu.l of CN (250 mg/ml) and dispensed into petri dishes (25 ml/dish). (Note: the concentration of carbenicillin in the first selection medium was 400 mg/L, and the concentration of carbenicillin in the second and subsequent selection media was 250 mg/L).

7) Pre-differentiation culture medium

Adding distilled water to 250 ml, adjusting pH to 5.9 with 1N potassium hydroxide, sealing, and sterilizing as above.

The medium was dissolved before use, 250. mu.l of HN (50 mg/ml) 250. mu.l of CN (250 mg/ml) and dispensed into petri dishes (25 ml/dish).

8) Differentiation medium

Distilled water was added to 900 ml and the pH was adjusted to 6.0 with 1N potassium hydroxide.

Boiling, adding distilled water to 1000 ml, packaging into 50 ml triangular flask (50 ml/bottle), sealing, and sterilizing.

9) Rooting culture medium

Distilled water was added to 900 ml and the pH was adjusted to 5.8 with 1N potassium hydroxide.

Boiling, adding distilled water to 1000 ml, packaging into raw tube (25 ml/tube), sealing, and sterilizing.

(4) Agrobacterium-mediated genetic transformation procedure

Callus induction

Removing hull from mature 02428 rice seed, treating with 70% ethanol for 1 min, and sterilizing the surface of 0.15% mercuric chloride (HgCl2) seed for 15 min;

washing the seeds with sterilized water for 4-5 times;

placing the seeds on an induction medium;

the inoculated culture medium is placed in a dark place for culturing for 4 weeks at the temperature of 25 +/-1 ℃.

3.2 callus subculture to select bright yellow, compact and relatively dry embryogenic callus, and culturing in the dark for 2 weeks at 25 + -1 deg.C.

3.3 preculture

Compact and relatively dry embryogenic calli were selected and placed on pre-culture medium for 2 weeks in the dark at 25 + -1 deg.C.

3.4 Agrobacterium culture

1) Agrobacterium EHA105 (a strain from an Agrobacterium strain publicly used by CAMBIA) was pre-cultured for two days at 28 ℃ in LA medium with a corresponding resistance selection (see: preparation of LA medium J. SammBruke et al, molecular cloning instructions, third edition, King Dong Yan et al (translation), scientific Press, 2002, Beijing);

the Agrobacterium is transferred to a suspension medium and cultured on a shaker at 28 ℃ for 2-3 hours.

3.5 Agrobacterium infection

1) Transferring the pre-cultured callus to a sterilized bottle;

adjusting the suspension of Agrobacterium to OD 6000.8-1.0;

soaking the callus in agrobacterium tumefaciens suspension for 30 minutes;

transferring the callus to sterilized filter paper and sucking to dry; then placed on a co-culture medium to be cultured for 3 days at a temperature of 19-20 ℃.

3.6 callus wash and selection culture

1) Washing the callus with sterilized water until no agrobacterium is visible;

soaking in sterilized water containing 400 mg/L Carbenicillin (CN) for 30 min;

transferring the callus to sterilized filter paper and sucking to dry;

transferring the callus to selective medium for selective culture for 2-3 times, each time for 2 weeks.

3.7 differentiation

1) Transferring the resistant callus to a pre-differentiation culture medium and culturing for 5-7 days in a dark place;

transferring the pre-differentiation cultured callus to a differentiation culture medium, and culturing under illumination at 26 ℃.

3.8 taking root

1) Cutting off roots generated during differentiation;

then transferred to rooting medium and cultured for 2-3 weeks under illumination at 26 ℃.

3.9 transplantation

Washing off residual culture medium on the roots, transferring the seedlings with good root systems to a field isolation environment, and managing the field as the common field.

Specifically, the following description is provided: in the rice material related to the present application, a "plus" or "minus" is added to the name of the material, and the name of the material to which the "plus" or "minus" is not added is the same material.

Sequence listing

<110> university of agriculture in Huazhong

Application of <120> GY3 gene in controlling number of glumes per ear and yield of rice per plant

<141> 2019-03-04

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 741

<212> DNA

<213> Rice (Oryza sativa)

<220>

<221> gene

<222> (1)..(741)

<220>

<221> CDS

<222> (1)..(741)

<400> 1

atg atg atg gag aat agc agg gag cag cag ccg gag tcg tcg ccg gcg 48

Met Met Met Glu Asn Ser Arg Glu Gln Gln Pro Glu Ser Ser Pro Ala

1 5 10 15

aac aac aat agc aag aag aag aag aag aag aag acg gcg tcg cgg ttc 96

Asn Asn Asn Ser Lys Lys Lys Lys Lys Lys Lys Thr Ala Ser Arg Phe

20 25 30

cgg cgt gtg tgc gtg ttc tgc ggc agc agc ccc ggg aag aag gcg tcg 144

Arg Arg Val Cys Val Phe Cys Gly Ser Ser Pro Gly Lys Lys Ala Ser

35 40 45

tac cag gtg gcc gcc gtg cag ctg ggg cag cag ctg gtg gag cgc ggc 192

Tyr Gln Val Ala Ala Val Gln Leu Gly Gln Gln Leu Val Glu Arg Gly

50 55 60

atc gac ctg gtg tac ggc ggc ggc agc gtt ggg ctg atg ggg ctg gtg 240

Ile Asp Leu Val Tyr Gly Gly Gly Ser Val Gly Leu Met Gly Leu Val

65 70 75 80

tcc cgc gcc gtc cac gga ggc ggc ggg cac gtg gtg ggc gtg gtg ccc 288

Ser Arg Ala Val His Gly Gly Gly Gly His Val Val Gly Val Val Pro

85 90 95

aat ggc gtg ctg cca cgc gag ctg atc ggc gag acg ctg ggg gag gtg 336

Asn Gly Val Leu Pro Arg Glu Leu Ile Gly Glu Thr Leu Gly Glu Val

100 105 110

agg gcg gtg gga agc atg cac cag cgg aag gcg gag atg gcg cgg gag 384

Arg Ala Val Gly Ser Met His Gln Arg Lys Ala Glu Met Ala Arg Glu

115 120 125

tcg gac gcc ttc atc gcc ctc ccc ggc ggc tac ggc acg ctg gag gag 432

Ser Asp Ala Phe Ile Ala Leu Pro Gly Gly Tyr Gly Thr Leu Glu Glu

130 135 140

ctc ctc gag gtc atc acc tgg gct cag ctc cgc atc cac cac aag ccc 480

Leu Leu Glu Val Ile Thr Trp Ala Gln Leu Arg Ile His His Lys Pro

145 150 155 160

gtc ggc ctc ctc aac gtc gac ggc tac tac gac tcc ctg ctc gcc ttc 528

Val Gly Leu Leu Asn Val Asp Gly Tyr Tyr Asp Ser Leu Leu Ala Phe

165 170 175

atc gac aag gcc gtc cac gaa ggc ttc gtc tcg ccg ccc gcc cgc cgc 576

Ile Asp Lys Ala Val His Glu Gly Phe Val Ser Pro Pro Ala Arg Arg

180 185 190

atc atc gtc gcc gca ccc acc gcc tcc gac ctg ctc tgc aag ctc gag 624

Ile Ile Val Ala Ala Pro Thr Ala Ser Asp Leu Leu Cys Lys Leu Glu

195 200 205

gaa tac gtg ccg ccg ccg cac gac gcc acc gcc ctg aag ctc acc tgg 672

Glu Tyr Val Pro Pro Pro His Asp Ala Thr Ala Leu Lys Leu Thr Trp

210 215 220

gag atg tcc acc gta tcg gag cag cac gcc gga agc atc tac tcc ccc 720

Glu Met Ser Thr Val Ser Glu Gln His Ala Gly Ser Ile Tyr Ser Pro

225 230 235 240

aag ccc gac atg gca cgc tag 741

Lys Pro Asp Met Ala Arg

245

<210> 2

<211> 246

<212> PRT

<213> Rice (Oryza sativa)

<400> 2

Met Met Met Glu Asn Ser Arg Glu Gln Gln Pro Glu Ser Ser Pro Ala

1 5 10 15

Asn Asn Asn Ser Lys Lys Lys Lys Lys Lys Lys Thr Ala Ser Arg Phe

20 25 30

Arg Arg Val Cys Val Phe Cys Gly Ser Ser Pro Gly Lys Lys Ala Ser

35 40 45

Tyr Gln Val Ala Ala Val Gln Leu Gly Gln Gln Leu Val Glu Arg Gly

50 55 60

Ile Asp Leu Val Tyr Gly Gly Gly Ser Val Gly Leu Met Gly Leu Val

65 70 75 80

Ser Arg Ala Val His Gly Gly Gly Gly His Val Val Gly Val Val Pro

85 90 95

Asn Gly Val Leu Pro Arg Glu Leu Ile Gly Glu Thr Leu Gly Glu Val

100 105 110

Arg Ala Val Gly Ser Met His Gln Arg Lys Ala Glu Met Ala Arg Glu

115 120 125

Ser Asp Ala Phe Ile Ala Leu Pro Gly Gly Tyr Gly Thr Leu Glu Glu

130 135 140

Leu Leu Glu Val Ile Thr Trp Ala Gln Leu Arg Ile His His Lys Pro

145 150 155 160

Val Gly Leu Leu Asn Val Asp Gly Tyr Tyr Asp Ser Leu Leu Ala Phe

165 170 175

Ile Asp Lys Ala Val His Glu Gly Phe Val Ser Pro Pro Ala Arg Arg

180 185 190

Ile Ile Val Ala Ala Pro Thr Ala Ser Asp Leu Leu Cys Lys Leu Glu

195 200 205

Glu Tyr Val Pro Pro Pro His Asp Ala Thr Ala Leu Lys Leu Thr Trp

210 215 220

Glu Met Ser Thr Val Ser Glu Gln His Ala Gly Ser Ile Tyr Ser Pro

225 230 235 240

Lys Pro Asp Met Ala Arg

245

<210> 3

<211> 741

<212> DNA

<213> Rice (Oryza sativa)

<220>

<221> gene

<222> (1)..(741)

<220>

<221> CDS

<222> (1)..(741)

<400> 3

atg atg atg gag aat agc agg gag cag cag ccg gag tcg tcg ccg gcg 48

Met Met Met Glu Asn Ser Arg Glu Gln Gln Pro Glu Ser Ser Pro Ala

1 5 10 15

aac aac aat agc aag aag aag aag aag aag aag acg gcg tcg cgg ttc 96

Asn Asn Asn Ser Lys Lys Lys Lys Lys Lys Lys Thr Ala Ser Arg Phe

20 25 30

cgg cgt gtg tgc gtg ttc tgc ggc agc agc ccc ggg aag aag gcg tcg 144

Arg Arg Val Cys Val Phe Cys Gly Ser Ser Pro Gly Lys Lys Ala Ser

35 40 45

tac cag gtg gcc gcc gtg cag ctg ggg cag cag ctg gtg gag cgc ggc 192

Tyr Gln Val Ala Ala Val Gln Leu Gly Gln Gln Leu Val Glu Arg Gly

50 55 60

atc gac ctg gtg tac ggc ggc ggc agc gtt ggg ctg atg ggg ctg gtg 240

Ile Asp Leu Val Tyr Gly Gly Gly Ser Val Gly Leu Met Gly Leu Val

65 70 75 80

tcc cgc gcc gtc cac gga ggc ggc ggg cac gtg gtg ggc gtg gtg ccc 288

Ser Arg Ala Val His Gly Gly Gly Gly His Val Val Gly Val Val Pro

85 90 95

aat ggc gtg ctg cca cgc gag ctg atc ggc gag acg ctg ggg gag gtg 336

Asn Gly Val Leu Pro Arg Glu Leu Ile Gly Glu Thr Leu Gly Glu Val

100 105 110

agg gcg gtg gga agc atg cac cag cgg aag gcg gag atg gcg cgg gag 384

Arg Ala Val Gly Ser Met His Gln Arg Lys Ala Glu Met Ala Arg Glu

115 120 125

tcg gat gcc ttc atc gcc ctc ccc ggc ggc tac ggc acg ctg gag gag 432

Ser Asp Ala Phe Ile Ala Leu Pro Gly Gly Tyr Gly Thr Leu Glu Glu

130 135 140

ctc ctg gag gtc atc acc tgg gct cag ctc cgc atc cac cac aag ccc 480

Leu Leu Glu Val Ile Thr Trp Ala Gln Leu Arg Ile His His Lys Pro

145 150 155 160

gtc ggc ctc ctc aac gtc gac ggc tac tac gac tcc ctg ctc gcc ttc 528

Val Gly Leu Leu Asn Val Asp Gly Tyr Tyr Asp Ser Leu Leu Ala Phe

165 170 175

atc gac aag gcc gtc cac gaa ggc ttc gtc tcg ccg ccc gcc cgc cgc 576

Ile Asp Lys Ala Val His Glu Gly Phe Val Ser Pro Pro Ala Arg Arg

180 185 190

atc atc gtc gcc gcg ccc acc gcc tcc gac ctg ctc tgc aag ctc gag 624

Ile Ile Val Ala Ala Pro Thr Ala Ser Asp Leu Leu Cys Lys Leu Glu

195 200 205

gaa tac gtg ccg ccg ccg cac gac gcc acc gcc ctg aag ctc acc tgg 672

Glu Tyr Val Pro Pro Pro His Asp Ala Thr Ala Leu Lys Leu Thr Trp

210 215 220

gag atg tcc acc gta tcg gag cag cac gcc gga agc atc tac tcc ccc 720

Glu Met Ser Thr Val Ser Glu Gln His Ala Gly Ser Ile Tyr Ser Pro

225 230 235 240

aag ccc gac atg gca cgc tag 741

Lys Pro Asp Met Ala Arg

245

<210> 4

<211> 246

<212> PRT

<213> Rice (Oryza sativa)

<400> 4

Met Met Met Glu Asn Ser Arg Glu Gln Gln Pro Glu Ser Ser Pro Ala

1 5 10 15

Asn Asn Asn Ser Lys Lys Lys Lys Lys Lys Lys Thr Ala Ser Arg Phe

20 25 30

Arg Arg Val Cys Val Phe Cys Gly Ser Ser Pro Gly Lys Lys Ala Ser

35 40 45

Tyr Gln Val Ala Ala Val Gln Leu Gly Gln Gln Leu Val Glu Arg Gly

50 55 60

Ile Asp Leu Val Tyr Gly Gly Gly Ser Val Gly Leu Met Gly Leu Val

65 70 75 80

Ser Arg Ala Val His Gly Gly Gly Gly His Val Val Gly Val Val Pro

85 90 95

Asn Gly Val Leu Pro Arg Glu Leu Ile Gly Glu Thr Leu Gly Glu Val

100 105 110

Arg Ala Val Gly Ser Met His Gln Arg Lys Ala Glu Met Ala Arg Glu

115 120 125

Ser Asp Ala Phe Ile Ala Leu Pro Gly Gly Tyr Gly Thr Leu Glu Glu

130 135 140

Leu Leu Glu Val Ile Thr Trp Ala Gln Leu Arg Ile His His Lys Pro

145 150 155 160

Val Gly Leu Leu Asn Val Asp Gly Tyr Tyr Asp Ser Leu Leu Ala Phe

165 170 175

Ile Asp Lys Ala Val His Glu Gly Phe Val Ser Pro Pro Ala Arg Arg

180 185 190

Ile Ile Val Ala Ala Pro Thr Ala Ser Asp Leu Leu Cys Lys Leu Glu

195 200 205

Glu Tyr Val Pro Pro Pro His Asp Ala Thr Ala Leu Lys Leu Thr Trp

210 215 220

Glu Met Ser Thr Val Ser Glu Gln His Ala Gly Ser Ile Tyr Ser Pro

225 230 235 240

Lys Pro Asp Met Ala Arg

245

<210> 5

<211> 3882

<212> DNA

<213> Rice (Oryza sativa)

<220>

<221> gene

<222> (1)..(3882)

<400> 5

tgtcacgccc cgaactagta ccgaccggaa ctagcccgtg acgctccaaa ttaacctgtt 60

aatcgatacc agtcccagga aacagtgctg gtatcgcagg aagacggatt atcacagcaa 120

cagaggtctc tttattatag agtagaggta cagtcatgtt gggctgcgga cagatcccga 180

gctcacaact gcattacaaa agggggaaac ggaagccagg acttggacca aacaacacag 240

gcgcgacttg ggaactaggc cgaaacccta aaactcatcg aagccggctt gctcctggaa 300

gaactcctca tcagcaggat ccgcttcatc ttcttcagca actgggggga ttatttatat 360

agagcaaggg tgagtacggg ggtactcagc aagccatggg aaataagtgt ttaatgcagg 420

cttcaaggaa ggctgttgtt tttgcagttg attttatttg aactcttttc taaaaacaac 480

taagtgagtg cttctcaaac gacacggatg agacagtgcg tctcgtccgg tcggagtatg 540

tgtaatgtat cagtctttag aattgattca aggttggcac ccggccaaca gcttttcaaa 600

cggccacccg ggccaacaac tttcaaacgg ccacccgggc ctagctgatc ccatcagctg 660

cagatttttc aatcatcgaa cccctttcca caacagcaat ttcacaagca gtagtcaaac 720

aaaactacgc taggaatcac ctcacatccg cccatgaccg tgggcacggc tattcgaaca 780

gcttgttaac ctctgcagag ggggtacact ttacccacac gacattacta acccggatct 840

cccagcccat ggggatccgc cacgtcggga gacctccaag ctttcatgac aaggcatttc 900

caaagccgac acaggtttac catatgccga cgagaggggt cccagaccaa caactggtta 960

ggtcccagac catactgtgc caggaagccc aggggtcctc cccgacacca ccccggcgaa 1020

tccacatgtc tctcggcatc aaggctcccc tgataagcta gttactcagc caggggtgtc 1080

ccattccacc catgtggtcg tacttgtctt atgttcggat gaaattccaa ggaaacggtc 1140

cttaggtgca agagcgggaa accgtacacc cggtacgttc cccggtccgc ggttttggaa 1200

attcatttag ttcgcaagca ccgacccagg tgtcgggttt tccaagtctt ttgtaaaacc 1260

caagttttac ccaagaagtt tttcagaatt ttaagtttga aggcgtccgt cgatactcgc 1320

acagggtgca cgaatatcga gacgcaacta gatggttaca aggggacacg atataacaat 1380

tatcaaagga aggatcaaat gcaacaaatt aggtaggtcc gccaatctgc cttgcagacg 1440

ggacaacaga ttaagtgcga tcctatcaat acataatatt tttcaagcaa cataattaaa 1500

tttcaattat aggctcaaga tgttcaaagg tggcttgcct tgctcgagat ctagagcttg 1560

atcctcgaaa tcctcgcact gcgggtcttc gggctccgaa actacacgca aaacgggaca 1620

actcaacaaa cggcgaaaat aaagccctat taatgacctc taagcgtgcc attagataga 1680

tctcgagatt tgaggaattt tggaagttga acggagtcaa acggatttac ggttgggaag 1740

atattgaatt tctaatatta ttggattttt ggtctaaagg aaaaatgatt taattaaatc 1800

ctttttggaa aagaaaagaa aagaaggagg gggaaaatta gacttccctc gggcggcgag 1860

ggcgcggccc gagagaaagg aggcggctcg gccgagctaa ctgggccggc cggcccgaaa 1920

ggcggcccaa agcgcgcgcg ggggagggga gggagggggc gccggtggac cgggctcacc 1980

tcgcgtggtc ccgagtggga cccgcttgtc agcggctcgg ctcaccgtgc ggagggagca 2040

cgcggcgcac gcgcgtgggc gggggaggga tgcggtgcac gcgcgcggtt cgcggtggaa 2100

cggatgcggc gggcccacgc gcagcctcac ggctcgcggt ggaacgcgcg cacggggagg 2160

ggctgaccgg ggtcaattcg acccggcctt ggccgagctt gcgccgacgt ggcgcctacg 2220

tggctgccac gcgggccggc gggaggtaga cgacgacgcc ggccggaacg aacggcggac 2280

gacagcggcg agcggcggag cgaaccacgg cgatataggc gaaagcgagc acaccgggtg 2340

gttgcacgag acgaggggag acgagccaac ggctcggatt cgccggaggg agcttgacgg 2400

cggcgaatcg cggcggcggc aaccggcggc gggaggaggg gaaaacggcg acgaggtcac 2460

aaggggccga ttcctggcgg cgagagcatc tacgcggcta cgggaatccg atgctagcgt 2520

tggattagga ggaaacgcat cgagggaggc cggcgacgag aggcgcttcc gagctcgggc 2580

agcgacagcg gcgagcacat ggcgagcggc ggcaacggtc ggggcggcgc cggctagcta 2640

cggggaggct actcgtgcta ctacccgagt ctaaggggag gagatggagc gaggagggag 2700

aacggaggga tgcactaccg tgcgggcggg gcgcagtgac gagaggccga cggcgcggga 2760

gtaatctctc cggcctcggg ccggggaaga ggaaggagag ggcgcgcccg gagtcccctt 2820

ccgcgtcctt gctcgtgccg gctcctccga cacgcgcaac gacgaaaggc gacggcgaac 2880

agagcacggg aggcggcggc aatggcgtgg aggcgaacgg gagaggaaag gaaaggggga 2940

agcttaggtt tataggggcg gcaatgtcag tttgggagag gggaaccgac attggacggt 3000

caagccgacg agctggcgct ccggctagcg gccaaaacgg cgacaggagg tgacgccggc 3060

gagagggaaa aaggaagaaa aggggggaga gaaagggggc ttgtcccttg cctcttcggg 3120

aaaaggaggg gggagcgggg cgacgcggca gagggaggag ggactctgcc tccgcccctt 3180

ggaggctagc gcgcggagtg gcggggccga ggcgatgatg acggcggggc ggtgtggagc 3240

ggagcggcga cacgggcgac aggcgcgagc aggcgctgac gacggcggcg accaggcggt 3300

cggccactcg gcactcgcgc gcggcttgca acgggaggcg cggcggatgg agtggcgcgg 3360

ctcgggcacg cgcgctggct gcggggccga gcggctgcag gcgtggcagg gcagcggggc 3420

cgggcggcgc agacagcgca gacagcgcag gcatgatgcg agcgacgacc acgcgggcgc 3480

gcgcgcgcga acgacgcgcg gggagcggca gcgagggagc gaagaggagg gctcggctcg 3540

gcgcgggcgg ctcacgcacg cgcgggcaga gcggagggag cggaggaggg gcgttcggcg 3600

cgagcggctc acgcgcacgc gcgcgcggcg cgcgggcgga gcggagcgga gggggagaga 3660

gagagagaga gagagagata gccggggagg gagggggaga tgggccgaga gagattcggc 3720

ccatcgaacc cagggggagg caaaatagac ttttgcggag gaatttgaga tctgagatgg 3780

cacggacact agacaacaag caaagaaaca aatttcgcaa ttagggtttt taagagataa 3840

ttttcccgct aggcgccacg acggaacggg cgctacagct tt 3882

Claims

1. A primer composition for identifying the rice GY3 gene transposon insertion, which is characterized in that the primer composition is as follows:

forward primer CL 1F: ACACATGACCGGACCTCCAT, respectively;

reverse primer CL 1R: TGCTAGCCCTACAAGGAGGT, respectively;

forward primer CL 1-2F: GGCACGGACACTAGACAACA are provided.

2. The primer composition of claim 1, wherein the primer composition is used for detecting rice yield increasing traits.