CN1191354C - Method for producing transgene paddy with amount of spikelet being increased - Google Patents
Method for producing transgene paddy with amount of spikelet being increased Download PDFInfo
- Publication number
- CN1191354C CN1191354C CNB021105340A CN02110534A CN1191354C CN 1191354 C CN1191354 C CN 1191354C CN B021105340 A CNB021105340 A CN B021105340A CN 02110534 A CN02110534 A CN 02110534A CN 1191354 C CN1191354 C CN 1191354C
- Authority
- CN
- China
- Prior art keywords
- oscen1
- oscen2
- gene
- paddy rice
- rice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention provides a method for producing transgene paddy rice with increased spikelet amount, which has the following steps: (a), exogenous OsCen1 and/or OsCen2 genes are transmitted into paddy rice callus so as to obtain paddy rice cells or tissue transmitted with the extraneous source OsCen1 or OsCen2 genes; (b), the paddy rice cells or tissue obtained in step (a) is regenerated into paddy rice plants. The transgene paddy rice with the increased spikelet amount is obtained by utilizing a transgenic technology through the malposition excess expression of the paddy rice OsCen1 genes and the OsCen2 genes. The present invention also provides a carrier carrying the OsCen1 genes and/or the OsCen2 genes, and host cells thereof.
Description
Technical field
The present invention relates to the genetically engineered field.More specifically, the present invention relates to utilize OsCen1 and OsCen2 gene, the method for the transgenic paddy rice that the generation spikelet number increases and relevant carrier and transgenic plant.
Background technology
Monocotyledon rice is one of world's staple food crop, and the state that rice young panicle is grown directly influences the output of grain, and the therefore research to concerning between rice young panicle generation and the gene can be provided fundamental basis for the artificial adjustment that the paddy rice reproductive growth is grown.
At present, the growth research of dicotyledons is studied than the growth of monocotyledons, comparatively deeper.Especially to the research of dicotyledonous model plant Arabidopis thaliana and Common Snapdragon, proposed by " ABC model " that floral organ is taken place.All things considered is mainly carried out from following three aspects the research of flower development: (A) growth of inflorescence, (B) startup of floral meristem and (C) generation of floral organ.
In Arabidopis thaliana and Common Snapdragon, cloned the gene relevant with keeping inflorescence meristem and floral meristem.Existing discovering:
(A) in Arabidopis thaliana, the gene of keeping the inflorescence meristem attribute is the TFL1 gene, is the CEN gene in the Common Snapdragon;
(B) in Arabidopis thaliana, the gene of keeping the floral meristem attribute is the LEAFY gene, is the FLO gene in the Common Snapdragon.
CEN and FLO are a pair of collaborative mutually again genes that repels mutually on function, the inflorescence meristem of the wild-type of Common Snapdragon to floral meristem change early stage, the expression of FLO is only arranged, after FLO expresses, by the conduction of signaling molecule, the expression of activation CEN, after the expression of CEN is strengthened, by the transmission of signaling molecule, suppress the expression of FLO again, thereby make wild-type keep the growth of indeterminate inflorescence.
Therefore, the expression of CEN and FLO can be thought the switch that inflorescence meristem changes between floral meristem.In mouseearcress, TFL1 and LEAFY have and Common Snapdragon in similar function between CEN and the FLO.Obtained the transfer-gen plant of 35S TFL1 in the Arabidopis thaliana, the overexpression of TFL1 has greatly prolonged vegetative phase and inflorescence vegetative period of Arabidopis thaliana, and obtains than the more seed of wild-type.
From paddy rice, cloned the gene with Common Snapdragon FLO gene and Arabidopis thaliana LFY dna homolog, called after RFL gene.Yet the in situ hybridization result shows that the RFL gene does not resemble and belongs to floral meristem attribute gene FLO and the LFY that RFL may be relevant with the growth of primary tiller stalk and secondary branch stalk.And, do not obtain the result consistent with 35S LFY with RFL gene overexpression in Arabidopis thaliana of paddy rice.
Therefore, in view of the increase of world population, this area presses for the method that exploitation improves rice yield.
Summary of the invention
One object of the present invention just provides a kind of method that the paddy rice spikelet number is increased, its rice Os Cen1 and OsCen2 gene by changing external source over to, thus produce the transgenic paddy rice that spikelet number increases.
Another object of the present invention provides employed gene order, carrier and genetically modified rice cell, tissue and plant in the method for the transgenic paddy rice that the generation spikelet number increases.
In a first aspect of the present invention, a kind of method that produces the transgenic paddy rice that spikelet number increases is provided, it comprises step:
(a) OsCen1 and/or the OsCen2 gene with external source changes rice cell or tissue over to, obtains to have changed over to the rice cell or the tissue of external source OsCen1 and/or OsCen2 gene;
(b) with the rice cell or the tissue that have changed external source OsCen1 and/or OsCen2 gene over to that obtain in the step (a), regeneration rice plant.
In a preference, in step (a), change the OsCen1 and the OsCen2 gene both of external source over to rice cell or tissue.
In another preference, in step (a), with the agroinfection rice callus tissue that carries OsCen1 sense expression vector and/or OsCen2 sense expression vector.
In another preference, in step (a), described OsCen1 sense expression vector is pCSL0040, and described OsCen2 sense expression vector is pCSL0042.
In another preference, the albumen shown in the described OsCen1 genes encoding SEQ ID NO:2, and the albumen shown in the described OsCen2 genes encoding SEQ ID NO:6.
In another preference, described OsCen1 gene contains the nucleotide sequence of 27-545 position among the SEQ ID NO:1, and described OsCen2 gene contains the nucleotide sequence of 17-535 position among the SEQ ID NO:5.
In a second aspect of the present invention, a kind of expression vector is provided, it contains the gene that is selected from down group: OsCen1 gene and OsCen2 gene.
Preferably, in described carrier, the albumen shown in the described OsCen1 genes encoding SEQ ID NO:2, and the albumen shown in the described OsCen2 genes encoding SEQ ID NO:6.
In a third aspect of the present invention, a kind of vegetable cell is provided, be integrated with the OsCen1 gene and/or the OsCen2 gene of external source in its genome.Preferably, described vegetable cell is from Oryza (Oryza), more preferably from paddy rice (Oryza sativa).
Description of drawings
Fig. 1 has shown and has contained OsCen1 cDNA sequence and the primer sequence that complete ORF adds 3 ' UTR.
Fig. 2 has shown and has contained OsCen2 cDNA sequence and the primer sequence that complete ORF adds 3 ' UTR.
Fig. 3 is the plasmid map of the sense expression vector of pCSL0040 plasmid-OsCen1.Wherein, T-Border (L) and T-Border (R) represent left margin and the right margin of T-DNA respectively.
Fig. 4 is the plasmid map of the sense expression vector of pCSL0042 plasmid-OsCen2.Wherein, T-Border (L) and T-Border (R) represent left margin and the right margin of T-DNA respectively.
Embodiment
Common Snapdragon and mouseearcress are the dicotyledons of indeterminate inflorescence, and paddy rice is the monocotyledons of determinate inflorescence, therefore study young fringe growth course and the Expression of Related Genes of paddy rice, can the competitive list cotyledon plant and dicotyledons in the similarities and differences of pattern of regulation and control inflorescence meristem and floral meristem regulation and control.The inventor is material with the paddy rice, transformation between nutrition apical meristem in the main research rice stem apical meristem, inflorescence meristem, the floral meristem, in the research paddy rice with the gene of CEN dna homolog, study its expression rule by the method for overexpression, function and with the relation of RFL, confirmed the gene OsCen1 and the OsCen2 that can cause small ear to increase first.Finished the present invention on this basis.
In the present invention, term " OsCen1 albumen " or " OsCen1 polypeptide " are used interchangeably, all refer to the to have rice Os Cen1 aminoacid sequence albumen or the polypeptide of (SEQ ID NO:2).Term " OsCen2 albumen " or " OsCen2 polypeptide " are used interchangeably, all refer to the to have rice Os Cen1 aminoacid sequence albumen or the polypeptide of (SEQ ID NO:6).They can contain or not contain initial methionine.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating OsCen1 or OsCen2 albumen or polypeptide " is meant that OsCen1 or OsCen2 polypeptide are substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying OsCen1 or the OsCen2 albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises OsCen1 or the proteic fragment of OsCen2, derivative and analogue.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep natural OsCen1 of the present invention or identical biological function or the active polypeptide of OsCen2 albumen basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merge formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
In the present invention, term " OsCen1 or OsCen2 polypeptide " also comprises having and variant forms OsCen1 or OsCen2 albumen identical function, SEQ ID NO.2 or 6 sequences.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises OsCen1 or proteic active fragments of OsCen2 and reactive derivative.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, can and utilize anti-OsCen1 or polypeptide or albumen that the antiserum(antisera) of OsCen2 polypeptide obtains with the coded albumen of the DNA of OsCen1 or OsCen2 DNA hybridization under high or low tight degree condition.The present invention also provides other polypeptide, as comprises OsCen1 or OsCen2 polypeptide or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of OsCen1 or OsCen2 polypeptide.Usually, this fragment have OsCen1 or OsCen2 peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of OsCen1 or OsCen2 albumen or polypeptide.The difference of these analogues and natural OsCen1 or OsCen2 polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
In the present invention, " OsCen1 or OsCen2 albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2 or 6, there are 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to Table A and produce.
Table A
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.
For OsCen1, the coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
For OsCen2, the coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:5 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:6, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:5.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or separation coding OsCen1 or the proteic polynucleotide of OsCen2.
OsCen1 of the present invention or OsCen2 Nucleotide full length sequence or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or repeatedly PGR amplification, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention by chemosynthesis.
Use method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.The primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or OsCen1 or OsCen2 albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the OsCen1 or the OsCen2 polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention OsCen1 or OsCen2 polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, OsCen1 or OsCen2 polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains OsCen1 or OsCen2 DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance, hygromycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell or transformation receptor can be prokaryotic cell prokaryocytes, as bacterial cell (Agrobacterium); Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells.Preferred transformation receptor is a vegetable cell, and monocotyledons especially is as grass.More preferably, transformation receptor is the callus of oryza plant.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
Certainly, can also or carry OsCen1 and the plasmid of OsCen2 changes plant callus over to, make in its karyomit(e) that is integrated directly into host cell OsCen1 and OsCen2.Then, by the conventional plant regeneration techniques, described vegetable cell or callus regeneration are become complete plant.In this plant, OsCen1 and OsCen2 are able to the dystopy overexpression and express, thereby spikelet number is increased.
The present invention also comprises transgenic plant and the filial generation thereof that obtains with the inventive method, comprises the filial generation of transgenic plant and common plant.
The OsCen1 and the OsCen2 transgenic paddy rice that utilize the inventive method to obtain, the phenotype of its transgenic paddy rice is different from the phenotype of wild-type.The principal feature of OsCen1 and OsCen2 transgenic paddy rice is as follows:
(1) spend 11 wild-types during the fringe portion feature of transgenic paddy rice obviously is different from: the number of the small ear that transgenic paddy rice is total is Duoed one times than wild-type; The number of the branch stalk of transgenic paddy rice is more than wild-type.
(2) spend 11 wild-types short in the aspect ratio of transgenic rice plant, the stem of transgenic paddy rice than in spends 11 wild-types thick, is difficult for lodging.
(3) spend the sword-like leave length and width of 11 wild-types during the sword-like leave of transgenic paddy rice compares.
Therefore, the present invention improves the possibility that provides new for the fringe portion proterties of artificial design paddy rice, genetic improvement, rice breeding and the gene engineering of paddy rice.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment 1
Separating of paddy rice CENTRORADIALIS (CEN)-like gene OsCen1 and OsCen2 gene
Conservative fragments with the 4th exon of CEN gene of Common Snapdragon is a probe, to paddy rice (Guanglu ai 4, long-grained nonglutinous rice) genome dna library carries out the in situ hybridization screening, through the three-wheel screening, obtain six positive colonies, select structure and subclone that the strongest positive colony FD229 of two signals and FD322 have done physical map, and finished examining order.2 CEN-like gene OsCen1 (cry not only FDR1) and OsCen2 (but also being FDR2) have been obtained.
Genome sequence according to OsCen1 and OsCen2, designed special primer, and be template with the reverse transcription product of the mRNA in the paddy rice inflorescence meristem, the method by 5 ' RACE and 3 ' RACE is separated to and OsCen1 and the corresponding cDNA of OsCen2 gene, and has finished order-checking.The long 907bp of OsCen1 cDNA, the long 956bp of OsCen2cDNA compares cDNA and genome sequence, and discovery OsCen1 and OsCen2 genomic dna are all formed (CEN and TFL gene also have four exons and three introns) by four exons and three introns.
Infer OsCen1 and OsCen2 173 the amino acid whose albumen (SEQ ID NO:2 and SEQ ID NO:6) of all encoding according to GCG, the amino acid identity of the two is 92.5%.The albumen of the albumen of OsCen1 and OsCen2 coded by said gene and CEN coded by said gene all has 73.99% homology, has 72.52% and 73.41% homology with TFL1 in the Arabidopis thaliana.These results show that OsCen1 of paddy rice and OsCen2 gene are the CEN gene of Common Snapdragon, the analogue of Arabidopis thaliana TFL1 gene.
Embodiment 2
The acquisition of OsCen1 and the complete ORF of OsCen2
(A) acquisition of the complete ORF of OsCen1
For genetically modified needs, must obtain complete ORF, so before the initiator codon of OsCen1 gene, design 5 ' primer, i.e. OsCen1-ORF-5 ':
ttacctgtccctccaaggc(SEQ ID NO：3)
And after terminator codon, design 3 ' primer, i.e. OsCen1-ORF-3 ':
cacaatctag tgatgtggc(SEQ ID NO：4)
And be template with the reverse transcription product of the mRNA in the paddy rice inflorescence meristem, the RT-PCR ORF that amplified OsCen1 adds the preceding paragraph 3 ' UTR zone routinely, total length is 643bp, be cloned in the pGEM-T carrier, positive colony be numbered pCSL0034.
The length of the OsCen1 that amplifies is that the cDNA of 643bp is shown in Fig. 1 and SEQ ID NO:1.The proteic aminoacid sequence of OsCen1 of coding is shown in SEQ ID NO:2.
(A) acquisition of the complete ORF of OsCen2
Before the initiator codon of OsCen2 gene, design 5 ' primer, i.e. OsCen2-ORF-5 ':
gtctgctcctctaaacatgtctag(SEQ ID NO：7)
And after terminator codon, design 3 ' primer, i.e. OsCen2-ORF-3 ':
cgactacatc gtcttcttgc(SEQ ID NO：8)
And be template with the reverse transcription product of the mRNA in the paddy rice inflorescence meristem, the ORF that RT-PCR has amplified OsCen2 adds the preceding paragraph 3 ' UTR zone, total length is 638bp, be cloned in the pGEM-T carrier, positive colony be numbered pCSL0035.
The length of the OsCen1 that amplifies is that the cDNA of 638bp is shown in Fig. 2 and SEQ ID NO:5.The proteic aminoacid sequence of OsCen1 of coding is shown in SEQ ID NO:6.
Embodiment 3
The structure of OsCen1 and OsCen2 sense expression vector
(A) structure of OsCen1 sense expression vector
Cutting the back with the SpeI enzyme mends flat, cutting length with the OsCen1 in the pCSL0034 plasmid with the NcoI enzyme again is that the cDNA of 643bp scales off, forward is linked on the intermediate carrier pJIT163 (can available from Britain JOIN INNES research centre), the strong promoter that will contain 2 35S then adds that fragment cloning that forward OsCen1 cDNA gene connects CaMV polyA again is in plant expression vector pCAMBIA1301 (can available from the CAMBIA research centre), obtain the expression vector of OsCen1 justice, called after pCSL0040, this carrier total length is 14000bp, resistance in intestinal bacteria is a kalamycin resistance, resistance in plant materials is a hygromycin resistance, and this carrier also has gus gene in the T-DNA zone.The pCSL0040 plasmid map as shown in Figure 3.
(B) structure of OsCen2 sense expression vector
The same OsCen1 of the building process of OsCen2 sense expression vector.Mend flat with cut the back with the SacII enzyme, cutting length with the OsCen2 in the pCSL0035 plasmid with the SalI enzyme again is that the cDNA of 638bp scales off, forward is linked on the intermediate carrier pJIT163, the strong promoter that will contain 2 35S then adds that forward OsCen1 cDNA gene connects the fragment cloning of CaMV polyA again in plant expression vector pCAMBIA1301, obtain the expression vector of OsCen2 justice, called after pCSL0042, this carrier total length is 14000bp, resistance in intestinal bacteria is a kalamycin resistance, resistance in plant materials is a hygromycin resistance, and this carrier also has gus gene in the T-DNA zone.The pCSL0042 plasmid map as shown in Figure 4.
PCSL0040, the pCSL0042 plasmid is to the conversion of Agrobacterium EHA105
(A). the Agrobacterium competent cell of preparation electric shock conversion method
Agrobacterium EHA105 (can available from the CAMBIA research centre) grows on the flat board of YEB solid medium, appoints to choose a single bacterium colony and insert in the 5mlYEB liquid nutrient medium and jolt overnight incubation in 28 ℃;
In 1: 100 ratio above-mentioned bacterium liquid is inoculated in the fresh YEB liquid nutrient medium of 100ml, 28 ℃, 200rpm jolt and are cultured to the growth logarithmic phase;
4000rpm, 4 ℃, the centrifugal collection of 15min Agrobacterium thalline;
Abandon supernatant, add the ddH of precooling
2O is resuspended, and moisturizing adds to 50ml;
4000rpm, 4 ℃, 15min are centrifugal;
Abandon supernatant, add the ddH of precooling
2O is resuspended, and moisturizing adds to 50ml;
4000rpm, 4 ℃, 15min are centrifugal;
Abandon supernatant, add the ddH of the 100ul of precooling
2O is resuspended, and 20ul/ pipe branch is installed on ice, prepares electric shock.
(B) pCSL0040, the pCSL0042 plasmid transforms and identifies the electric shock of Agrobacterium EHA105
The cup wash clean that will shock by electricity, dehydrated alcohol flushing dries up on the super clean bench;
Respectively get 1ul pCSL0040, the pCSL0042 plasmid joins respectively in the above-mentioned Agrobacterium competent cell of 20ul;
Electric shock, the SOC substratum of adding 900ul;
28 ℃ are shaken bacterium, and coated plate after 1 hour is inverted for 28 ℃ and is cultivated;
The picking mono-clonal shakes bacterium after 2 days, extracting Agrobacterium plasmid;
PCR and enzyme are cut and are identified positive colony.
The result has obtained to carry the Agrobacterium of OsCen1 sense expression vector, and the Agrobacterium of OsCen2 sense expression vector.
Embodiment 5
The Agrobacterium that contains expression vector is to spending 11 conversion in the paddy rice
In the present embodiment, by the method for agroinfection paddy rice rataria, respectively with the rataria of spending 11 paddy rice (japonica rice, Oryza sativajaponic) in the agroinfection that contains OsCen1 sense expression vector and OsCen2 sense expression vector.
(A) the rice callus tissue induces
Get 12-15 days the paddy rice immature seed in pollination back and in 2% NaClO solution, (add 2-3 and drip polysorbas20) sterilization after 1 minute more than 60 minutes, choose rataria and be incubated at N with scalper and tweezers then for 4-5 time with aseptic water washing through 70% alcohol immersion
6D
2Or N
6D
0.5Evoked callus on the substratum can be seen tangible callus lines after 4 days, can be used as the acceptor material of Agrobacterium-mediated Transformation this moment.
(B) cultivation of agrobacterium tumefaciens and rice conversion
The Agrobacterium bacterial classification is inoculated into 3ml and contains in the YEB liquid nutrient medium of kantlex 50mg/L in 28 ℃ of jolting overnight incubation on YEB (containing 50mg/L km) flat board, contained in the AB liquid nutrient medium of Km50mg/L by the 1% inoculum size 50ml that transfers in the 2nd day, 200rpm continues to be cultured to OD
600Be about 0.8, fresh nutrient solution is collected and is resuspended in the AAM liquid nutrient medium of 1/3 volume in 5000g, 4 ℃ of centrifugal 10min, be used for the conversion of rice material.
(C) the common cultivation of rice material and agrobacterium tumefaciens transforms
Preparation N before transforming
6D
2C (or N
6C) time, at dull and stereotyped upper berth one deck aseptic filter paper, and it is moistening with a small amount of fresh AAM liquid nutrient medium, water paddy rice acceptor material after will cultivating in advance in the 6cm culture dish is soaked in the fresh AAM Agrobacterium bacterium liquid and shakes frequently, behind the 20min rice material is shifted out, on aseptic filter paper, inhale and go too much bacterium liquid promptly to transfer to above-mentioned N
6D
2C cultivates and cultivated altogether 3 days based on 26 ℃.When cultivating altogether, except that special processing, be total to culture medium A AM, N
6D
2C or N
6All add the activation inductor of the Syringylethanone (AS) of 100umol/L among the C as Agrobacterium Vir gene.
After cultivating 3 days altogether, take out the rice transformation material, with aseptic washing once and on aseptic filter paper, blot bacterium liquid and moisture, change the moment expression of selecting substratum to carry out screening and culturing or being used to detect gus gene then over to from substratum altogether.
By GUS dyeing preliminary observation expression of gene situation, the reaction of the overwhelming majority's callus as a result is positive, and shows that tentatively foreign gene has been transferred in the rice callus tissue.
Embodiment 6
The screening of resistant calli and plant regeneration
After 4 days rataria of pre-cultivation and Agrobacterium are cultivated 3 days altogether, cut plumule and change over to and select substratum N
6D
2S
1Select to cultivate, the callus morsel that goes out from rataria scultellum director after 2 weeks forwards N to
6D
2S
2Select to continue on the substratum 2 generations of screening (2 week/generation), 6 week the back select eugonic resistant calli to transfer to division culture medium MSRCH to go up and break up (12 hours illumination/skies); Regenerated seedling strong plantlets and rootage on 1/2MSENH moves into the greenhouse subsequently or phytotron is potted plant.
Result: by the method for agroinfection paddy rice rataria, respectively with the rataria of spending 11 paddy rice in the agroinfection that contains OsCen1 sense expression vector and OsCen2 sense expression vector, obtained deriving from the 34 strain OsCen1 justice transgenic paddy rice of 17 different callus, wherein Molecular Detection derive from 12 individual plants of different callus, GUS detects has only an individual plant to be negative, all the other all are positive, and Southern detects most of for unit point inserts, and minority is that multidigit point inserts; Obtained deriving from the 104 strain OsCen2 justice transgenic paddy rice of 14 different callus, wherein Molecular Detection derive from 14 individual plants of different callus, GUS detects 4 individual plants and is negative, all the other all are positive, Southern detects most of for unit point inserts, and minority is that multidigit point inserts.
In 34 strain OsCen1 justice transgenic paddy rice and 104 strain OsCen2 justice transgenic paddy rice, most of OsCen1 and OsCen2 transgenic paddy rice are spent 11 wild-types in the fringe portion phenotype in T0 generation all obviously is different from, present the characteristics of dense cluster.Because T0 generation is the plant that is obtained by the tissue culture differentiation, and tissue culture causes some abnormal phenotypes of plant sometimes, thus the T1 generation of transgenic paddy rice will be planted, and observe whether heredity and separating of phenotype.
Embodiment 7
The plantation and the phenotype analytical in OsCen1 and OsCen2 transgenic paddy rice T1 generation
GUS tests positive and Southern detection are planted for the seed (being T1 generation) of knot for OsCen1 and the OsCen2 justice transgenic paddy rice T0 that unit point inserts, T1 is for separation has taken place, the transgenosis phenotype is separated with wild-type than meeting 3: 1, GUS detects positive the separation with feminine gender than also meeting 3: 1, and GUS positive with the transgenosis phenotype be isolating altogether.Therefore, conclusion is, overexpression OsCen1 cDNA gene and OsCen2 cDNA gene have obtained stable, heritable, as to be different from wild-type phenotype in paddy rice.
The phenotype of OsCen1 and OsCen2 justice transgenic paddy rice is as follows:
(A) spend the short 8-25cm of 11 wild-types in the aspect ratio of transgenic rice plant, the stem of transgenic paddy rice than in spends 11 wild-types thick, is difficult for lodging.
(B) sword-like leave of transgenic paddy rice than in spends the sword-like leave of 11 wild-types long, and is wide.
(C) spend 11 wild-types during the fringe portion feature of transgenic paddy rice obviously is different from:
The number of the small ear that transgenic paddy rice is total is Duoed one times than wild-type;
The tassel of transgenic paddy rice is slightly shorter than wild-type, first and second stalk of transgenic paddy rice and small ear stalk respectively than in spend first and second stalk of 11 wild-types and small ear stalk short;
The number of the branch stalk of transgenic paddy rice increases, and a lot of new branch stalks are arranged again on the secondary branch stalk, and the number of total small ear is Duoed one times than wild-type;
The tassel of transgenic paddy rice obviously is the characteristics of dense cluster, is ghost but the small portion small ear is arranged.
(C) spent 11 wild-types late 10-15 days in the heading time ratio.(wild-type is heading in after planting 65 days, transgenic paddy rice then at after planting 75 days to 80 talent heading.)
Embodiment 8
OsCen1 and OsCen2 transgenic paddy rice T2 generation is homozygotic separates, phenotype analytical
GUS tests positive and Southern detection are planted for the seed (being T2 generation) of knot for OsCen1 and the OsCen2 justice transgenic paddy rice T1 that unit point inserts.Two kinds of situations in having the transgenic paddy rice of transgenosis phenotype, are arranged: first in T2 generation, the generation that has separation, separating than still is 3: 1, the transgenosis phenotype is separated with wild-type than meeting 3: 1, GUS detects positive the separation with feminine gender than also meeting 3: 1, and GUS positive with the transgenosis phenotype be isolating altogether; The second, what have does not separate, and all individualities all are the transgenosis phenotype, and GUS detects and to be positive, and Southern detects to single copy inserts, and just definite such individual plant is a homozygote.Therefore according to such method, now obtained an OsCen1 justice transgenic paddy rice homozygotic strain of T2 generation system, obtain homozygotic three strains of OsCen2 justice transgenic paddy rice T2 generation system, and the T3 that has obtained these four strains systems is for seed, T3 does not still have in generation and separates and the transgenosis phenotype is stablized.The transgenosis phenotype in T2 homozygote and the homozygotic transgenosis phenotype of T3 and T1 generation is consistent or slightly strong.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Fudan University of Shanghai Inst. of Plant Physiology, Chinese Academy of Sciences
＜120〉produce the method for the transgenic paddy rice that spikelet number increases
<130>006340
<160>8
<170>PatentIn version 3.0
<210>1
<211>643
<212>DNA
＜213〉paddy rice (Oryza sativa)
<220>
<221>CDS
<222>(27)..(545)
<400>1
ttacctgtcc ctccaaggct ccaacc atg tct agg tct gtg gag cct ctt gtt 53
Met Ser Arg Ser Val Glu Pro Leu Val
1 5
gtt ggg cgg gta atc gga gaa gtt att gat tca ttc aac cca tgt acg 101
Val Gly Arg Val Ile Gly Glu Val Ile Asp Ser Phe Asn Pro Cys Thr
10 15 20 25
aag atg ata gta acc tac aat tca aac aag ctt gtc ttt aat ggc cat 149
Lys Met Ile Val Thr Tyr Asn Ser Asn Lys Leu Val Phe Asn Gly His
30 35 40
gag ttc tac cca tca gca gtt gta tct aaa cca aga gtc gag gtc caa 197
Glu Phe Tyr Pro Ser Ala Val Val Ser Lys Pro Arg Val Glu Val Gln
45 50 55
ggg ggt gat atg cgt tct ttc ttc aca ttg gtt atg aca gac cca gat 245
Gly Gly Asp Met Arg Ser Phe Phe Thr Leu Val Met Thr Asp Pro Asp
60 65 70
gtg cca gga cca agt gat cca tgt cta agg gaa cac cta cat tgg att 293
Val Pro Gly Pro Ser Asp Pro Cys Leu Arg Glu His Leu His Trp Ile
75 80 85
gta act gat ata cct gga aca acg gat gcc tct ttt gga cgg gaa atc 341
Val Thr Asp Ile Pro Gly Thr Thr Asp Ala Ser Phe Gly Arg Glu Ile
90 95 100 105
ata agc tat gag agc cca aag ccc agc att ggt atc cac agg ttc gtt 389
Ile Ser Tyr Glu Ser Pro Lys Pro Ser Ile Gly Ile His Arg Phe Val
110 115 120
ttt gtg ctc ttc aag cag aag cgt agg cag gct gta gtt gtg cca tcc 437
Phe Val Leu Phe Lys Gln Lys Arg Arg Gln Ala Val Val Val Pro Ser
125 130 135
tct agg gat cat ttc aat aca cgc cag ttt gct gag gag aac gaa ctt 485
Ser Arg Asp His Phe Asn Thr Arg Gln Phe Ala Glu Glu Asn Glu Leu
140 145 150
ggc ctt cct gtc gct gct gtc tac ttc aat gct cag aga gag act gct 533
Gly Leu Pro Val Ala Ala Val Tyr Phe Asn Ala Gln Arg Glu Thr Ala
155 160 165
gcc agg aga cgc taaaaaattc cagctgtcat tatccccgct gtgataaata 585
Ala Arg Arg Arg
170
aaaaccatcc aatagtttct cctgtcgtct acattatctg ccacatcact agattgtg 643
<210>2
<211>173
<212>PRT
＜213〉paddy rice (Oryza sativa)
<400>2
Met Ser Arg Ser Val Glu Pro Leu Val Val Gly Arg Val Ile Gly Glu
1 5 10 15
Val Ile Asp Ser Phe Asn Pro Cys Thr Lys Met Ile Val Thr Tyr Asn
20 25 30
Ser Asn Lys Leu Val Phe Asn Gly His Glu Phe Tyr Pro Ser Ala Val
35 40 45
Val Ser Lys Pro Arg Val Glu Val Gln Gly Gly Asp Met Arg Ser Phe
50 55 60
Phe Thr Leu Val Met Thr Asp Pro Asp Val Pro Gly Pro Ser Asp Pro
65 70 75 80
Cys Leu Arg Glu His Leu His Trp Ile Val Thr Asp Ile Pro Gly Thr
85 90 95
Thr Asp Ala Ser Phe Gly Arg Glu Ile Ile Ser Tyr Glu Ser Pro Lys
100 105 110
Pro Ser Ile Gly Ile His Arg Phe Val Phe Val Leu Phe Lys Gln Lys
115 20 125
Arg Arg Gln Ala Val Val Val Pro Ser Ser Arg Asp His Phe Asn Thr
130 135 140
Arg Gln Phe Ala Glu Glu Asn Glu Leu Gly Leu Pro Val Ala Ala Val
145 150 155 160
Tyr Phe Asn Ala Gln Arg Glu Thr Ala Ala Arg Arg Arg
165 170
<210>3
<211>19
<212>DNA
＜213〉primer
<400>3
ttacctgtcc ctccaaggc 19
<210>4
<211>19
<212>DNA
＜213〉primer
<400>4
cacaatctag tgatgtggc 19
<210>5
<211>638
<212>DNA
＜213〉paddy rice (Oryza sativa)
<220>
<221>CDS
<222>(17)..(535)
<400>5
gtctgctcct ctaaac atg tct agg tct gtg gag cct ctt gtt gta ggg cgc 52
Met Ser Arg Ser Val Glu Pro Leu Val Val Gly Arg
1 5 10
gtg att ggg gaa gtt ctt gat acc ttt aac cca tgc atg aag atg ata 100
Val Ile Gly Glu Val Leu Asp Thr Phe Asn Pro Cys Met Lys Met Ile
15 20 25
gtg acc tat aac tcc aac aag ctt gta ttt aat ggt cat gag ctc tac 148
Val Thr Tyr Asn Ser Asn Lys Leu Val Phe Asn Gly His Glu Leu Tyr
30 35 40
cca tca gca gtt gtg tct aaa cca aga gtt gag gtc caa ggg ggt gac 196
Pro Ser Ala Val Val Ser Lys Pro Arg Val Glu Val Gln Gly Gly Asp
45 50 55 60
ctg cga tct ttc ttc aca ttg gtt atg aca gac cca gat gtg cca gga 244
Leu Arg Ser Phe Phe Thr Leu Val Met Thr Asp Pro Asp Val Pro Gly
65 70 75
cca agt gat cct tat cta agg gag cac ctt cat tgg att gtt act gat 292
Pro Ser Asp Pro Tyr Leu Arg Glu His Leu His Trp Ile Val Thr Asp
80 85 90
ata cct ggg aca acg gat gct tct ttt ggg cgc gag gtc ata agc tat 340
Ile Pro Gly Thr Thr Asp Ala Ser Phe Gly Arg Glu Val Ile Ser Tyr
95 100 105
gag agt cca aag ccg aac att ggc atc cat agg ttc att ttt gtg ctc 388
Glu Ser Pro Lys Pro Asn Ile Gly Ile His Arg Phe Ile Phe Val Leu
110 115 120
ttc aag cag aag cgc agg caa act gta att gtg cca tcc ttc agg gac 436
Phe Lys Gln Lys Arg Arg Gln Thr Val Ile Val Pro Ser Phe Arg Asp
125 130 135 140
cat ttc aac acc cgc cgg ttc gcc gag gag aat gat ctt ggc ctt cct 484
His Phe Asn Thr Arg Arg Phe Ala Glu Glu Asn Asp Leu Gly Leu Pro
145 150 155
gtg gct gct gtc tac ttc aat gcc cag aga gag act gca gcc agg agg 532
Val Ala Ala Val Tyr Phe Asn Ala Gln Arg Glu Thr Ala Ala Arg Arg
160 165 170
cgc tgagaaatgc agctccaatt gtcccaaaat tacgactctc tgaaatcaaa 585
Arg
ccttttctgc catattactt tctcatgaat caacgttctt ctgctacatc agc 638
<210>6
<211>173
<212>PRT
＜213〉paddy rice (Oryza sativa)
<400>6
Met Ser Arg Ser Val Glu Pro Leu Val Val Gly Arg Val Ile Gly Glu
1 5 10 15
Val Leu Asp Thr Phe Asn Pro Cys Met Lys Met Ile Val Thr Tyr Asn
20 25 30
Ser Asn Lys Leu Val Phe Asn Gly His Glu Leu Tyr Pro Ser Ala Val
35 40 45
Val Ser Lys Pro Arg Val Glu Val Gln Gly Gly Asp Leu Arg Ser Phe
50 55 60
Phe Thr Leu Val Met Thr Asp Pro Asp Val Pro Gly Pro Ser Asp Pro
65 70 75 80
Tyr Leu Arg Glu His Leu His Trp Ile Val Thr Asp Ile Pro Gly Thr
85 90 95
Thr Asp Ala Ser Phe Gly Arg Glu Val Ile Ser Tyr Glu Ser Pro Lys
100 105 110
Pro Asn Ile Gly Ile His Arg Phe Ile Phe Val Leu Phe Lys Gln Lys
115 120 125
Arg Arg Gln Thr Val Ile Val Pro Ser Phe Arg Asp His Phe Asn Thr
130 135 140
Arg Arg Phe Ala Glu Glu Asn Asp Leu Gly Leu Pro Val Ala Ala Val
145 150 155 160
Tyr Phe Asn Ala Gln Arg Glu Thr Ala Ala Arg Arg Arg
165 170
<210>7
<211>24
<212>DNA
＜213〉primer
<400>7
gtctgctcct ctaaacatgt ctag 24
<210>8
<211>20
<212>DNA
＜213〉primer
<400>8
cgactacatc gtcttcttgc 20
Claims (10)
1. method that produces the transgenic paddy rice that spikelet number increases is characterized in that it comprises step:
(a) OsCen1 and/or the OsCen2 gene with external source changes rice cell or tissue over to, obtains to have changed over to the rice cell or the tissue of external source OsCen1 and/or OsCen2 gene;
(b) with the rice cell or the tissue that have changed external source OsCen1 and/or OsCen2 gene over to that obtain in the step (a), regeneration rice plant.
2. the method for claim 1 is characterized in that, in step (a), changes the OsCen1 and the OsCen2 gene both of external source over to rice cell or tissue.
3. the method for claim 1 is characterized in that, in step (a), with the agroinfection rice callus tissue that carries OsCen1 sense expression vector and/or OsCen2 sense expression vector.
4. method as claimed in claim 3 is characterized in that, in step (a), described OsCen1 sense expression vector is pCSL0040, and described OsCen2 sense expression vector is pCSL0042.
5. the method for claim 1 is characterized in that, the albumen shown in the described OsCen1 genes encoding SEQ IDNO:2, and the albumen shown in the described OsCen2 genes encoding SEQ ID NO:6.
6. the method for claim 1 is characterized in that, described OsCen1 gene contains the nucleotide sequence of 27-545 position among the SEQ IDNO:1, and described OsCen2 gene contains the nucleotide sequence of 17-535 position among the SEQ ID NO:5.
7. an expression vector is characterized in that, it contains the gene that is selected from down group: OsCen1 gene and OsCen2 gene.
8. carrier as claimed in claim 7 is characterized in that, the albumen shown in the described OsCen1 genes encoding SEQ IDNO:2, and the albumen shown in the described OsCen2 genes encoding SEQ ID NO:6.
9. an oryza plant cell is characterized in that, is integrated with the OsCen1 gene and/or the OsCen2 gene of external source in its genome.
10. oryza plant cell as claimed in claim 9 is characterized in that it is a rice cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB021105340A CN1191354C (en) | 2002-01-11 | 2002-01-11 | Method for producing transgene paddy with amount of spikelet being increased |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB021105340A CN1191354C (en) | 2002-01-11 | 2002-01-11 | Method for producing transgene paddy with amount of spikelet being increased |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1431300A CN1431300A (en) | 2003-07-23 |
| CN1191354C true CN1191354C (en) | 2005-03-02 |
Family
ID=4741139
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB021105340A Expired - Fee Related CN1191354C (en) | 2002-01-11 | 2002-01-11 | Method for producing transgene paddy with amount of spikelet being increased |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1191354C (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105693837A (en) * | 2016-04-26 | 2016-06-22 | 中国水稻研究所 | Rice spikelet development regulation protein, encoding genes MS1 thereof and application |
| CN110066808B (en) * | 2019-03-14 | 2021-02-02 | 华中农业大学 | Application of GY3 gene in controlling number of glumes per ear and yield of rice per plant |
| CN114292862B (en) * | 2022-01-12 | 2022-10-04 | 华南农业大学 | Application of OsCEN2 gene in regulation and control of rice seed germination rate |
-
2002
- 2002-01-11 CN CNB021105340A patent/CN1191354C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1431300A (en) | 2003-07-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1618972A (en) | Regulation of quinolate phosphoribosyl transferase expression | |
| CN1807453A (en) | Bacterial leaf spot resistance related protein and its coding gene and uses | |
| CN1796559A (en) | Using gene of transcriptional factor OSNACX of paddy to increase drought resistance and salt tolerant abilities of plants | |
| CN1844396A (en) | Gene adjusting and controlling rice tillering angle and its coded protein and use | |
| CN1420932A (en) | Apomixis conferred by expression of SERK interacting proteins | |
| CN1185350C (en) | DNA comprising rice anther-specific gene and transgenic plant transformed therewith | |
| CN1854154A (en) | Rice blast resistant related protein, its coding gene and use | |
| CN1809640A (en) | Method and means for delaying seed shattering in plants | |
| CN1831127A (en) | Key gene for controlling chlorophyll metabolism and method for establishing plant green residence character therewith | |
| CN1840542A (en) | Rice tillering related protein, genes encoding same, and use thereof | |
| CN1246464C (en) | Novel transcriptional factor enhancing resistance of plants to osmotic stress | |
| CN101062944A (en) | Vegetable disease-resistant protein and its coding gene and application | |
| CN1887904A (en) | URO gene and its use | |
| CN1191354C (en) | Method for producing transgene paddy with amount of spikelet being increased | |
| CN1807611A (en) | Alfalfa cysteine prolease and its coding gene and uses | |
| CN1289523C (en) | Paddy rice potassium, sodium ion transport gene and its application | |
| CN100339479C (en) | Gene participating in the synthesis of brassinosteroid | |
| CN1289664C (en) | EPSP synthase of variable halomonas high resistance glyphosate and its encoding sequence | |
| CN1778925A (en) | Plant epidermal hair specific expression promoter | |
| CN1817900A (en) | Transcription factor for regulating plant fallen, its coding gene and use | |
| CN1566146A (en) | Paddy rice stalk extension gene, coded protein and application thereof | |
| CN1295334C (en) | Wheat antidisense related gene TaEDR1 and its application | |
| CN1232530C (en) | Ethane cyclic amp receptor protein of wheat and its coding sequence | |
| CN1234870C (en) | Novel miniature inverted-repeat transposable elements (MITE)-like element and transcriptional activation element | |
| CN1557952A (en) | Solanum lycopersicoides dun. S1Ve1 receptor protein encoding sequence and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee |
Owner name: SHANGHAI INST. OF LIFE SCIENCE, CAS Free format text: FORMER NAME OR ADDRESS: SHANGHAI INST. OF PLANT PHYSIOLOGY, CHINESE ACADEMY OF SCIENCES |
|
| CP03 | Change of name, title or address |
Address after: 200031 No. 320, Yueyang Road, Shanghai Co-patentee after: Fudan University Patentee after: Shanghai Institute of life Sciences, Chinese Academy of Sciences Address before: 200032 Shanghai Fenglin Road No. 300 Co-patentee before: Fudan University Patentee before: Shanghai Botanical Physiology Inst., Chinese Academy of Sciences |
|
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20050302 Termination date: 20120111 |