CN1807453A

CN1807453A - Bacterial leaf spot resistance related protein and its coding gene and uses

Info

Publication number: CN1807453A
Application number: CN 200510002390
Authority: CN
Inventors: 翟文学; 朱立煌; 江光怀; 夏志辉
Original assignee: Institute of Genetics and Developmental Biology of CAS
Current assignee: Institute of Genetics and Developmental Biology of CAS
Priority date: 2005-01-19
Filing date: 2005-01-19
Publication date: 2006-07-26
Anticipated expiration: 2025-01-19
Also published as: CN100381465C

Abstract

The invention discloses a hoja Blanca repellence related protein as well as the coded gene and appilication. The hoja Blanca repellence related protein of this invention has the protein of SEQ ID No: 3 amino acid residue sequence in sequence table, or substituting, deleting and appending amino acid residue sequence of SEQ ID No: 3 by one to ten amino acid residue and protein which is derived from SEQ ID No: 3 and related to hoja Blanca repellence. We can use the segment of this hoja Blanca repellence related protein coded gene to check plant's hoja Blanca repellence, for example, using a pair of primer which is made up of ribonucleotide sequence of SEQ ID No: 4 and SEQ ID No: 5 in sequence table to PCR augment the DNA genome of programed plant, then checking the PCR augmentation product of getted. The invention has important significance to breed disease-resistant plant species, extend crop's planting range and improve crop's output.

Description

A kind of bacterial leaf spot resistance related protein and encoding gene thereof and application

Technical field

The present invention relates to a kind of disease resistance of plant associated protein and encoding gene and application, particularly relate to a kind of bacterial leaf spot resistance related protein and encoding gene thereof and application.

Background technology

The plant that is grown in occurring in nature can often be subjected to infringements such as various bacteriums, fungi and virus, has formed various acknowledgement mechanisms in the long-term evolution process.To disease resistance of plant and disease-resistant Study on Mechanism is the problem that plant pathology and breeding for disease resistance circle are extremely paid close attention to always.Set up famous " gene pairs gene " theory in the research in early days, it can set forth the interactively between various plants-pathogenic bacteria, has become the theoretical basis of clone's pathogenic bacteria nontoxic gene and plant disease resistance genes.From 1992 are cloned into first disease-resistant gene Hm1 from corn since, now existing more than 40 plant disease-resistant (R) gene has been cloned, their encoded protein matter product majorities have a certain specific structural domain, as NBS (Nucleotide binding site, nucleotide binding site), LRR (Leucine-rich repeat, rich leucine repeats), TM (Transmembrane domain, membrane spaning domain), PK (Protein kinase, protein kinase), LZ (Leucine zipper, leucine zipper), CC (Coiled Coil, coiled coil) and TIR (Toll-Interleukin-1 Receptor, Toll il-1 zone) etc.Whether contain these structural domains according to disease-resistant gene, they can be divided into LZ (CC)-NBS-LRR, TIR-NBS-LRR, TM-LRR, TM-LRR, LRR-TM-STK 5 classes.But also have the R gene of other specific type not contain these structural domains, contain the membranin of 6 transbilayer helixs (Membrane spanning helices) as one of the mlo genes encoding of recessive mildew-resistance (Erysiphe graminis f.sp.Hordei) of barley at least; Recessive anti-marmor upsilon (PVY) gene of the piperic pvr2 eukaryotic translation initiation factor 4E (elF4E) that then encodes.These recessive disease-resistant genes all can't be explained their disease resistance with " gene pairs gene " theory, and their the concrete mechanism of action is also unclear, has only and clones more recessive disease-resistant gene again, just helps to resolve the disease-resistant mechanism of plant comprehensively.

Bacterial leaf-blight is one of severe diseases of paddy rice in the world wide, also is the main disease of China.Up to now, at least identified 26 bacterial leaf spot resistance genes both at home and abroad, dominant gene has wherein been arranged, recessive gene has also been arranged.In recent years, paddy rice is having very quantum jump aspect the clone of dominance bacterial leaf spot resistant ospc gene and the research, successively map based cloning three dominance bacterial leaf spot resistant ospc gene Xa21, Xa1 and Xa26.Xa4 and xa5 are the main anti-sources that utilizes on China's Rice Production always, wherein Xa4 is that dominant gene all has resistance in the time of infertility to the most of bacterial leaf-blight bacterial types of China, its clone (the Wang WM that is near completion, Zhai WX, Luo MZ, Jiang GH, Chen XW, LiXB, Wing RA, Zhu LH.Chromosome landing at the bacterial blight resistancegene Xa4 locus using a deep coverage rice BAC library.Molecular GeneralGenetics.2001.265:118-125; Sun X, Yang Z, Wang S, Zhang Q.Identificationof a 47-kb DNA fragment containing Xa4, a locus for bacterial blightresistance in rice.Theor Appl Genet.2003.106 (4): 683-687); And xa5 is recessive wide spectrum bacterial leaf spot resistant ospc gene, by the xa5 gene of back cross breeding structure and the polymerization of other dominance bacterial leaf spot resistant ospc gene Xa21 and Xa4 be, (than single-gene system) significantly strengthens to the bacterial leaf-blight resistance level, anti-spectrum is widened (HuangN., Augetes E.R., Domingo J., Magpantay G., Singh S., Zhang G., KumardivelN., Bennett J.and Khush G.S. (1997) Pyramiding of bacterial blight resistancegene in rice:marker-assisted selection using RFLP and PCR.Theor.Appl.Genet.95:313-320).Current research shows that the xa5 gene is by regulating the paddy rice defence by way of the resistance that increases bacterial leaf-blight, some bacterial leaf-blight cause of disease microspecies there are partial dominance effect or additive effect (Li ZK, Sanchez A, Angeles E, et al.Are the Dominant and Recessive Plant Disease ResistanceGenes Similar?: A Case Stude of Rice R Genes and Xanthomonas oryzae pv.OryzaeRaces.Genetics.2001,159:757-765.)。Clone the xa5 gene and by genetically engineered itself and other dissimilar disease-resistant gene polymerization is expected to cultivate the rice varieties of lasting high resistance to hoja blanca.Therefore, the map based cloning of xa5 gene is the focus of studying both at home and abroad always, recessive bacterial leaf spot resistant ospc gene xa5 is resistance of wide spectrum to Filipine several physiological strains, at first by Petpisit et al (Petpisit V., Khush G.S., KauffmanH.E. (1977) Inheritance of resistance to bacterial blight in rice.Crop Sci.17:551-554) identify, and by Primary Location (Yang D. on the 5th karyomit(e), Sanchez A., Khush G.S., Zhu Y., Huang N. (1998) Construction of a BAC contig containing the xa5 locusin rice.Theor Appl Genet.97:1120-1124).

The innovation and creation content

The purpose of this invention is to provide a kind of bacterial leaf spot resistance related protein and encoding gene thereof.

Bacterial leaf spot resistance related protein provided by the present invention, name is called xa5, it is to have SEQ ID № in the sequence table: the protein of 3 amino acid residue sequences, or with SEQ ID №: 3 amino acid residue sequence is through replacement, disappearance or the interpolation of one to ten amino-acid residue and relevant with bacterial leaf spot resistance by SEQ ID №: 3 deutero-protein.

Sequence 3 in the sequence table is basic transcription factor IIA (TFIIA) small subunits with conservative aminoterminal and carboxyl terminal structural domain that are made of 106 amino-acid residues.In the sequence 3, be the aminoterminal conserved domain, have 4 helical bundles from aminoterminal 2-50 amino acids residue sequence; The the 52nd to 101 amino acids residue sequence is the carboxyl terminal conserved domain, and 12 βZhe Dies are arranged.

The encoding gene of above-mentioned bacterial leaf spot resistance related protein (name is called xa5) also belongs to protection scope of the present invention.

The encoding gene of above-mentioned bacterial leaf spot resistance related protein comprises its cDNA gene and genomic gene.Its genomic gene can have one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 1 polynucleotide;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 3 protein sequences:

3) under the rigorous condition of height can with the SEQ ID № in the sequence table: the nucleotide sequence of the 1 dna sequence dna hybridization that limits.

Sequence 1 in the sequence table is by 13228 based compositions, and its reading frame is from 5 ' end the 3080th to the 8589th bit base.2739-2834 bit base from 5 ' end is first exon of this genomic gene, 2968-3208 bit base from 5 ' end is second exon of this genomic gene, 3303-3354 bit base from 5 ' end is the 3rd exon of this genomic gene, 8450-8965 bit base from 5 ' end is the 4th exon of this genomic gene, from 5 ' the 3080-3082 bit base of end be the genomic dna initiator codon ATG of this gene, from 5 ' the 8587-8589 bit base held is the genomic dna terminator codon TAA of this gene; 2835-2967 bit base from 5 ' end is first intron of this genomic gene, from 5 ' the 3209-3302 bit base of end be second intron of this genomic gene, from 5 ' the 3355-8449 bit base held is the 3rd intron of this genomic gene.

Its cDNA sequence has one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 2 polynucleotide;

2) SEQ ID № in the code sequence tabulation: the polynucleotide of 3 protein sequences;

SEQ ID № in the sequence table: 2 by 905 based compositions, and the encoding sequence of this cDNA sequence is SEQ ID № in the sequence table: 2 from 5 ' end 209-529 bit base.

The rigorous condition of above-mentioned height is for (or in the solution of 0.1 * SSC), 0.1% SDS, hybridizing under 65 ℃ and wash film containing 0.1 * SSPE.

Experiment showed, that bacterial leaf spot resistance related protein gene xa5 is a constitutive expression.

Contain expression carrier of the present invention, clone and host bacterium and also belong to protection scope of the present invention.

Arbitrary segmental primer is to also within protection scope of the present invention among the amplification xa5.

Second purpose of the present invention provides a kind of method of utilizing above-mentioned bacterial leaf spot resistance related protein encoding gene to cultivate the resisting bacterial leaf-blight plant.

The method of cultivation resisting bacterial leaf-blight plant provided by the present invention is that above-mentioned bacterial leaf spot resistance related protein encoding gene is imported the purpose plant.

Can utilize any carrier that can guide foreign gene in plant, to express, bacterial leaf spot resistance related protein encoding gene provided by the present invention is imported vegetable cell, can obtain disease-resistant or disease-resistant enhanced transgenic cell line and transfer-gen plant.Bacterial leaf spot resistance related protein encoding gene of the present invention can add any general promotor, strengthen promotor or inducible promoter in being building up to plant expression vector the time before its transcription initiation Nucleotide.For the ease of transgenic plant or transgenic plant cells being identified and being screened, can process employed carrier, as the antibiotic marker gene (gentamicin, kantlex etc.) that adds alternative mark (gus gene, GFP and luciferase gene etc.) or have resistance.For the security that transgenic plant discharge, when making up plant expression vector, also can not carry any marker gene, inoculate the bacterial leaf-blight bacterial classification in seedling stage and screen.Contain the expression vector of bacterial leaf spot resistance related protein encoding gene of the present invention can be by using conventional biological method transformed plant cells or tissues such as Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity be led, agriculture bacillus mediated or particle gun, and the plant transformed tissue cultivating become plant.By the plant transformed host both can be monocotyledons, also can be dicotyledons, as: paddy rice, wheat, corn, cucumber, tomato, willow, turfgrass, lucerne place etc.This method is particularly suitable for cultivating the paddy rice of resisting bacterial leaf-blight.

In breeding, also can obtain the resisting bacterial leaf-blight paddy rice by the assisted selection method, as utilize resisting bacterial leaf-blight rice varieties IRBB5 and the hybridization of susceptible rice varieties to obtain F1 for plant, F1 obtains F2 for plant for the plant selfing, the F2 that obtains is carried out the resistance evaluation and utilizes molecule marker K5 or K8 or SSR3 to carry out the PCR detection for plant inoculation bacterial leaf-blight pathogenic bacterium, determine to contain from bigger among the IRBB5 and gradually ooze segmental resistant plant, described containing from bigger in the IRBB5 material gradually oozed F3 that segmental resistant plant selfing produces for resistant plant, is the resisting bacterial leaf-blight paddy rice of xa5 gene pure type.

Another object of the present invention provides a kind of method of utilizing the fragment detection plant bacterial leaf spot resistance of this bacterial leaf spot resistance related protein encoding gene.

The method of detection plant bacterial leaf spot resistance provided by the present invention, be to use by SEQ ID № in the sequence table: 4 and SEQ ID №: the genomic dna that a pair of primer that 5 nucleotide sequence is formed is treated measuring plants carries out pcr amplification, then the pcr amplification product that obtains is carried out following 1) and 2) at least a detection:

1) described pcr amplification product is carried out single nucleotide polymorphism and detect, determine whether from 5 of SEQ ID NO:6 ' end 21-22 bit base be AG;

2) cut described pcr amplification product with the XhoI enzyme, determine in the endonuclease bamhi it is to contain a 145bp band.

SEQ ID NO:6 in the sequence table is by 165 based compositions.

If the single nucleotide polymorphism detected result of pcr amplification product is from 5 of SEQ ID NO:6 ' end 21-22 bit base (5 of sequence 1 ' end 3195-3196 bit base in sequence table; 5 of sequence 2 ' end 324-325 bit base in sequence table) is AG, then treats the measuring plants resisting bacterial leaf-blight.

If cut described pcr amplification product with the XhoI enzyme, contain a 145bp band in the endonuclease bamhi that obtains, then treat the measuring plants resisting bacterial leaf-blight.

The method of this detection plant bacterial leaf spot resistance is particularly suitable for paddy rice.

The present invention enlarges the crop-planting scope to cultivating the disease-resistant plants kind, and it is significant to improve crop yield.

The present invention will be further described below in conjunction with drawings and Examples.

Description of drawings

Fig. 1 be the xa5 gene by Primary Location between RFLP mark S1546 and RG556

Fig. 2 a is that the Hind III enzyme of 23 positive colonies is cut pattern

Fig. 2 b is that 23 Hind III enzymes are cut positive colony and BAC clones the molecular hybridization that 40I13 DNA carries out as probe

Fig. 2 c is that the Sma I enzyme of striding 9 folded positive colonies is cut pattern

Fig. 3 is the meticulous genetic map and the physical map of xa5 gene locus

Fig. 4 is the separation of xa5 gene

Fig. 5 compares with other biological TFIIA small subunit aminoacid sequence

Fig. 6 is that the aminoacid sequence conservative region of bacterial leaf spot resistance related protein of the present invention is analyzed

Fig. 7 a-Fig. 7 b is Xa5 and the expression of xa5 gene in the susceptible and disease-resistant material of inoculation P1

Fig. 8 is the SSR3 marker detection result of NIP/IRBB5F3R

Fig. 9 is the physical map of complementation test expression vector pCAMBIA1301:Xa5

Figure 10 a is the performance behind the transfer-gen plant inoculation pathogenic bacteria

Figure 10 b is that T0 is for transfer-gen plant

Embodiment

The experimental technique of mentioning among the following embodiment is ordinary method if no special instructions.

The acquisition of embodiment 1, bacterial leaf spot resistance related protein of the present invention and encoding gene thereof

1, genetic analysis and the Primary Location of recessive bacterial leaf spot resistant ospc gene xa5

The same near isogenic line of disease-resistant parent IRBB5 (susceptible parent) IR24 that utilization contains the xa5 gene is hybridized, gained F1 pickup kind bacterial leaf-blight pathogenic bacterium microspecies P1 (Kauffman H.E., Reddy A.P.K., Hsieh S.P.Y.and Merca S.D. (1973) An improved technique for evaluating resistance of ricevarieties to Xanthomonas oryzae.Plant Dis.Rep.57:537-547) after two week, measure scab length, all be accredited as disease plant.Divide single-strain planting F2 colony, plant boot stage with the same microspecies of leaf-cutting method inoculation, determine the induction reactance plant according to growth curve of bacteria again, scab length＜5cm is defined as resistant plant, scab length 〉=5cm is a disease plant.In 640 strain F2 colonies, it is susceptible to have 165 strains, and 475 strains are disease-resistant, and approximate 3: 1 of induction reactance ratio shows that the disease-resistant proterties of IRBB5 is recessive single-gene control really.According to previous result of study, the xa5 gene is positioned at RFLP mark RG207, RZ390, RG556 and C597 neighbouring (Blair M.W., McCouchS.R. (1997) Microsatellite and sequence-tagged site markers diagnostic forthe rice bacterial blight resistance gene xa5.Theor Appl Genet.95:174-184; Yang D., Sanchez A., Khush G.S., Zhu Y., Huang N. (1998) Construction of aBAC contig containing the xa5 locus in rice.Theor Appl Genet.97:1120-1124).Owing to find RG207, RZ390 is marked between IR24 and IRBB5 parent does not have polymorphism, rice genetic collection of illustrative plates (the Harushima Y that the contriver sets up according to people such as Harushima, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y, Yamamoto T, Lin SY, Antonio BA, Parco A, Kajiya H, Huang N, YamamotoK, Nagamura Y, Kurata N, Khush GS and Sasaki J:1998..A high-density ricegenetic linkage map with 2275 markers using a single F2 poulation.Genetics.148:479-494), carry out polymorphism analysis between the parent with being positioned at 6 Japanese RFLP marks of C597 to the S12936 interval, C597 wherein, C919, S1546, S14158, S12936 polymorphism between the parent is very obvious, use RG556 subsequently, S1546, C597, C919, these 6 of S14158 and S12936 have polymorphic mark that F2 colony is carried out linkage analysis, determine that with MAPMAKER software they concern with the position between the xa5.With the xa5 assignment of genes gene mapping between S1546 and RG556 (Fig. 1), be respectively 0.8cM and 0.5cM apart from the genetic distance of S1546 and RG556.

2, xa5 gene locus BAC strides folded group's structure

Use C597, S1546, RZ390, C919, S12936, these 7 probes of S14158 and RG556 are to containing library (the Wang WM of xa5 trans-genetic hybrid rice strain IRBB56, Zhai WX, Luo MZ, Jiang GH, Chen XW, LiXB, Wing RA, Zhu LH.Chromosome landing at the bacterial blight resistancegene Xa4 locus using a deep coverage rice BAC library.Molecular GeneralGenetics.2001.265:118-125) screens, obtain 88 positive colonies altogether, in these 88 positive colonies, there are 23 to be RG207, C597 and S14158 detect jointly, wherein BAC clones 28N23,100N7,109H1 and 124H1 are detected 28N23 simultaneously by S12936,100N7,109H1,40I23,64G4,30N9,111B20,97B18 and 124H1 are sieved to by RG556 simultaneously.Because these 23 positive colonies that RG207, C597 and S14158 are sieved to have jointly also comprised the clone that other probe is sieved to, so emphasis is analyzed these 23 clones.These BAC cloned DNAs are cut with Hind III enzyme, according to restriction enzyme digestion and electrophoresis banding pattern (Fig. 2 a, Marker is a λ DNA/HindIII molecular weight standard) and make the molecular hybridization finger printing (Fig. 2 b) of probe with BAC clone 40I13 DNA, can be divided into two groups to these BAC clones and stride folded clone.The 1st group: 28N23,100N7,109H1,124H1,40I23,64G4,111B20,30N9 and 97B18; The 2nd group: 112G9,133O22,34G21,55J16,68F20,78H9,85N2,107P23,114I23,118M13,125I13,139M6,70P2 and 133J8.Make probe hybridization with C597 and RG207, two groups of clones provide special hybridization banding pattern respectively; Make probe hybridization with S14158 and RZ390, two groups of clones also provide special hybridization banding pattern respectively, but 64G4 clone amixia band; Make probe hybridization with RG556, have only the 1st group of clone to provide a hybrid belt, and the 2nd group of clone do not produce hybrid belt; Make probe hybridization with S12936, have only 28N23,100N7,109H1 and four clones of 124H1 of the 1st group to produce 2 hybrid belts.Infer that according to above result the 1st group is striden folded clone group from xa5 site areas on the 5th karyomit(e).9 clones of this group are carried out Sma I enzyme to be cut, according to Sma I restriction enzyme digestion and electrophoresis collection of illustrative plates (Fig. 2 c, Marker is λ DNA/HindIII molecular weight standard) determined this group clone stride folded relation mutually, obtain one cover from C597 to S12936, comprise on the 5th karyomit(e) xa5 gene be about 213Kb stride folded clone group (Fig. 3).Among Fig. 3, picture (a) is for covering the meticulous genetic map in xa5 gene locus zone, the xa5 assignment of genes gene mapping between K5 and T4 and with T2 be divided into below, the horizontal line numeral this be marked at detected exchange strain number in 4892 individual plants, Marker refers to the RFLP on the collection of illustrative plates, SSR and CAPS mark; Picture (b) is limited to xa5 in the 24kb zone for the restriction enzyme mapping (fragment less than 3kb is ignored) of folded clone group of striding of the xa5 gene locus of examination rice strain IRBB56BAC library construction and SmaI, ▲ represent the candidate gene of xa5.

3, the Fine Mapping of xa5 gene

Along with international rice genome (http: // Www.genome.arizona.edu/fpc/rice/) and the carrying out smoothly of Chinese super hybridized rice genome plan (http://btn.genomics.org.cn/rice/), increasing sequence is anchored on the rice chromosome.Stride folded BAC clone's part order-checking according to the sequence on the 5th the short arm of a chromosome and xa5 site and design a series of SSLP and CAPS mark (table 1), these marks based on PCR have quickened the Fine Mapping of xa5 gene effectively.Utilize the F that contain 4892 individual plants of these marks to enlarging ₂(the Zhong Y.M. of positional cloning colony, Jiang G.H., Chen X.W., Xia Z.H., Li X.b., Zhu L.H.and Zhai W.X. (2003) Identification and gene prediction of a 24kb regioncontaining xa5, a recessive bacterial blight resistance gene in rice (Oryzasativa L.) .Chinese Science Bulletin, 48 (24): 2725-2729) analyze, obtain to contain the dense genetic map in xa5 gene locus zone.The xa5 gene is located between CAPS mark K8 and the T25 and is divided into from, K8 marker detection to 1 an exchange individual plant wherein with T2, T25 marker detection to 3 an exchange individual plant, and the genetic distance between them is about 0.3cM (Fig. 4 (a)).Fig. 4 (b) is that it contains complete xa5 or Xa5 gene from 30N9 or 44B4 BAC clone's 13.2kb HindIII fragment; (c) site of the structure of xa5 gene and the base in disease-resistant and susceptible material thereof replacement.

In order to determine the physics site of xa5,9 the BAC clones (28N23,100N7,109H1,124H1,40I23,64G4,111B20,30N9 and 97B18) that composition striden folded clone group with designed CAPS and SSLP labeled primer increase, and the BAC that cuts with Sma I enzyme clone Sma I fragment verifies, thereby determines each the mark physical location and the Sma I incision enzyme map (Fig. 3 b) of xa5 site areas.Analytical results shows that all stride folded 9 BAC clone and all comprise K5 and T4 mark, but the 30N9 minimum.Measure according to the partial sequence in K8-T25 interval, and the sequence that provides with international rice genome plan (http: // Www.genome.arizona.edu/fpc/rice/) relatively, find that K8 and T25 all are positioned on the international rice genome AC129716 clone, the sequence length between the two is about 10.9kb.

In order to verify positioning result, utilize the cross combination of Japanese warm and fine IRBB5, made up the F2 colony that comprises nearly 20,000 individual plants again.The positioning result unanimity that its positioning result is previous.

Mark and the primer formulated in table 1 process of the present invention

Molecule marker	The forward primer sequence	The reverse primer sequence	PCR product size/bp	Restriction endonuclease or simple the repetition
Molecule marker	The forward primer sequence	The reverse primer sequence	PCR product size/bp	Restriction endonuclease or simple the repetition	SSR12 SSR16 H2 K5 K8 T2 T23 T25 T4 T7 SSR3 T10 T16 T11 J5 D5 S5 Actin	ctgaaagcattatccctccc tgcatagtagcaaatgggat tactccaaaccctcctccac actcccatcacctacctcc ctacagagaactaatcaacc ctctccttgcgccaacaagc gtatcaatcagtcctctggg tccagtcgaaaggtcttcac tctacatgccacatgccccc gtcggagtcagggcatatgc cgagatcgagatcgagatgc cgtctccactcttcatcagg cagcgacgtcttgcgtttgg ctgaaacatccctcgacagc agtttaggcgcacgcatcg gctcgccattcaagttctcg ctctctacttttgtctgg tatggtcaaggctgggttcg	cgtttcggtttctctctccc agcatggtccaagaagagcc ttcacagaccaagcctaccc tgcgatgaccagttgcctc ctcgatttcttacaatgtcc ggcaactccgtgataagagc aggggtgtagtgttatggg ttgcagactcgcagttactc gacttcaagaagcctagccc acagattgagagagggaggc cgaaaggatgggaggagaagc tacgccacacaaagggaagg gggttgtacatgacgcaggg ggttgggaatcagcatatgc aggaagggggagggtgact tgctcttgacttggttctcc ccaaacacagatgagcag ccatgctcgatggggtactt	183 238 1159 794 704 625 831 837 775 827 182 818 725 628 614 165 1024 660	(at)31 (at)46(tatg)15 Cfo?I Dde?I Hinf?I Nco?I Rsa?I Alu?I Dra?I/Alu?I Alu?I (ctt)13 Ava?II Ava?II/Hae?III/Sin?I Dde?I / Xho?I Nco?I /

With Genescan software ( Http:// genes.mit.edu/GENSCAN.html) sequence of 10.9kb is carried out predictive genes, find 1 tangible open reading frame (ORF), encoding transcription factor TFIIA small subunit; And with more than 28,000 cDNA clone of paddy rice that this 10.9kb sequence has checked order to Japan carry out the homology search ( Http:// cdna01.dna.affrc.go.jp/cDNA), the cDNA that obtains 1 coding TFAII small subunit clones AK065182, and it comprises 4 exons (size is respectively 96bp, 241bp, 52bp and 516bp) and 3 introns, and (size is respectively 133bp, 94bp and 5095bp (Fig. 4 (c)).

Candidate gene design primer enantiopathy material IRBB5 according to prediction, IRBB56, IRBB4 and susceptible material IR24, the cDNA of IR64 and genomic dna increase and check order, find the coding region of the candidate gene TFIIA small subunit of disease-resistant material, compare (5 of sequence 1 ' end 3195-3196 bit base in sequence table in aminoterminal with Xa5; In sequence table 5 of sequence 2 ' and end 324-325 bit base) replacement (TC becomes AG) of two bases is arranged, cause an amino acid whose change (sequence 3 becomes glutaminic acid residue from the 39th Xie Ansuan residue of aminoterminal in the sequence table) (Fig. 4 (c)).With this position is the protein called after xa5 of L-glutamic acid, and it has the amino acid residue sequence of sequence 3 in the sequence table, has the genome sequence of sequence 1 in the sequence table, has the cDNA sequence of sequence 2 in the sequence table.

In order further to determine the consistence of replacement in disease-resistant material and susceptible material of these two bases, according to the sequences Design of IRBB5 a pair of CAPS primer D5 to IRBB5, NIP/IRBB5F3R and more than 20 kind of susceptible variety (Nipponbare, IR24, MH63, K2908, ShuHui (another name for Sichuan Province is extensive) 527, Sdg, WP, Chuanghui (creating extensive) 11, ZYQ (narrow leaf green grass or young crops), MH (bright extensive) 86, Lijiang (Lijing), PA64S, NJ (Nanjing) 6, Zhonghua (middle flower) 11, NJ (Nanjing) 11, D62B, Zhi (system) 7,9311, TP (Taibei) 309, JingXi (capital system) 17, MianHui (continuous extensive) 725 (above susceptible material is purchased in quality institute of the Chinese Academy of Agricultural Sciences and rice in China institute) increases and XhoI (recognition site is CTCGAG) enzyme is cut, the partial sequence of xa5 gene is CAAGTTCTTGAG among Fig. 4 c, but ' terminal sequence is CAAGTTCTCG to designed D5 forward primer 3, therefore the PCR product that goes out of the DNA cloning of resistant material contains the recognition site CTCGAG of XhoI) enzyme cuts, the result shows that the PCR product that has only IRBB5 and NiP/IRBB5F3R is cut open the band that produces a 145bp, the PCR product of other susceptible material can not be cut open, show as the band of a 165bp, show this two bases replacement in disease-resistant and susceptible material with they disease-resistant and susceptible be relevant (Fig. 4 (d)).Illustrate that xa5 is a bacterial leaf spot resistance related protein.

Wherein, the preparation method of resisting bacterial leaf-blight paddy rice NIP/IRBB5F3R (transformation system that promptly is used for the checking of Xa5 functional complementation) is as follows: utilize susceptible material Ni pponbare (japonica rice) and disease-resistant material IRBB5 (long-grained nonglutinous rice) hybridization to obtain F1 for plant, F1 obtains F2 for plant for the plant selfing, the F2 that obtains is met bacterial leaf-blight pathogenic bacterium microspecies P1 for plant to carry out the resistance evaluation and utilizes 13.2kb dna fragmentation both sides molecule marker (K5, K8 and SSR3) carry out PCR and detect, determine to contain from bigger fragment (because the molecule marker K5 that gradually oozes in the IRBB5 material, K8 and SSR3 have polymorphic between IR24 (Nipponbare) and IRBB5 two parents, the PCR product enzyme that is these marks is cut the back or directly can demonstrate two banding patterns between the parent through agarose gel electrophoresis different, the DNA K5 of those F3 plant, K8, the SSR3 mark carries out demonstrating after PCR detects the banding pattern of IRBB5, the fragment of gradually oozing that this is bigger refers to that these plant have from IRBB5, and contain from K5 to the bigger dna fragmentation of this section of SSR3 mark) resistant plant, these contain from the F3 that gradually oozes segmental resistant plant selfing generation bigger in the IRBB5 material for resistant plant, bacterial leaf spot pathogenic bacteria P1 (PXO61) and P2 (PXO86) are all had resistance, and this F3 is for resistant plant and contains the xa5 genetic material NIP/IRBB5F3R (Fig. 8 has shown the result of SSR3 marker detection) that isozygotys under the japonica rice background.

Amino acid residue sequence to sequence in the sequence table 3 carries out sequential analysis, find that it is the small subunit of basic transcription factor IIA (TFIIA), by TFIIA_gamma_N, 2 conservative regions of TFIIA_gamma_C are formed, in 106 amino acid of total length, the the 2nd to the 50th amino acid is the TFIIA_gamma_N conserved regions, and 4 helical bundles are arranged; The the 52nd to 101 is the TFIIA_gamma_C conserved regions, and 12 βZhe Dies are arranged.The mutational site is positioned at TFIIA_gamma_N conserved regions (Fig. 6).Itself and other biological TFIIA small subunit sequence, as 074948 (Fission Yeast), Q39236 (Arabidopsis), 008950 (Rat), P52656 and Q9W5B9 ((Fruit fly), XP_510452 (Human), NP_012865 (Baker ' s yeast) compare, have the height conservative property (Fig. 5) (above alphanumeric is the protein code name of the TFIIA small subunit of various biologies, can from Www.ncbi.nlm.nih.govSearch their protein sequence." zero " among Fig. 5 shows the L-glutamic acid relevant with resistance.)

Embodiment 2, function complementation experiment

Stride folded clone's group time at structure xa5 gene locus, also use K8, T2, T23, T25, the examination of mark such as T4 and SSR3 contain the rice strain IR64 BAC library of xa5 dominant allele Xa5, obtain a BAC clone 44B4, and be presented at corresponding 13.2kb allele is arranged on the 44B4, after cutting 44B4 BAC clone with the HindIII enzyme, obtain a 13.2kb fragment, the nucleotide sequencing result shows that it contains complete xa5 dominant allele Xa5, from the IR64 genomic dna, separate a long 13.2kb HindIII fragment that contains the Xa5 gene, it has been cloned between two HindIII sites of pCAMBIA1300, obtained recombinant expression vector pCAMBIA1300-Xa5 (Fig. 9).And transform the paddy rice resistant variety NiP/IRBB5F3R that contains the recessive site of xa5 gene pure with it, obtained 42 strains and be the T0 of hygromycin resistance for transfer-gen plant, identify and use that isolating mark T2 or S5 (S5 is an xa5 gene inner marker) carry out PCR and detect (as Figure 10 a-Figure 10 b) altogether with the xa5 gene through inoculating P1 seedling stage, defining 37 strains shows as susceptible and contains and change target fragment over to, and that the plant that does not change target fragment over to still shows as is disease-resistant, has proved that tentatively bacterial leaf spot resistance related protein encoding gene of the present invention is a recessive gene.Subsequently, sowed their self progeny in Hainan, these T ₁Showing as 3:1 induction reactance for transfer-gen plant separates.Among Figure 10 a, 1, IRBB5; 2, IRBB5 and the fine hybridization F of Japan ₃Disease-resistant plant NiP/IRBB5F3R in generation; 3, Nipponbare; 4, T ₀For transfer-gen plant; Figure 10 b is the detected result of xa5 gene inner marker S5/NcoI to transfer-gen plant, and the PCR product of transfer-gen plant is cut through the NcoI enzyme, shows that the plant with IRBB5 and two kinds of parent's banding patterns of IR24 all contains complete 13.2kb transgenic fragment.

Embodiment 3, xa5 expression of gene are analyzed

Carrying out leaf-cutting method inoculation with bacterial leaf-blight physiological strain P1 enantiopathy material IRBB5 (containing the xa5 gene) and susceptible material Japan fine (Nipponbare) (containing the Xa5 gene) in seedling stage handles, and in contrast with water treatment, then by handling back 0,12,24, RNA is extracted in sampling in 48,96 hours, and each sample RNA is carried out RT-PCR analyze.Primer is that (this primer can expand the fragment that 614bp in cDNA for a pair of specificity amplification primer J5 in gene xa5 or the Xa5, in genomic dna, can amplify 1024bp, its forward primer is positioned at second exon, reverse primer is positioned at the 4th exon, comprise 2 introns), with the Actin primer in contrast.(M is DL2000 for result such as Fig. 7 a-Fig. 7 b; Numeral shows inoculation time; Fig. 7 a inoculates P1; Fig. 7 b, injection water are in contrast) shown in, show that xa5 or Xa5 gene are not subjected to inducing of P1.Show that this xa5 gene as other most resistant gene in plant of being cloned (as Xa21 etc.), is constitutive expression.(J5 is the mark according to xa5 or the design of Xa5 gene order, is used for detecting their expression (xa5 or Xa5 expressed sequence have only the difference of two bases).

The paddy rice of embodiment 4, cultivation resisting bacterial leaf-blight

CDNA with IRBB5 is a template, with xa5F 5 '-GT TCTAGAATCGCCCATGGCCACC-3 ' and xa5R5 '-GT CCCGGGGAGACTAACAAATACC-3 ' is that primer (contains in the sequence it is cloned into pZh01 (the Xiao H that contains 35S promoter, Wang Y, Liu D, Wang W, Li X, Zhao X, Xu J, Zhai W, Zhu L. (2003) Functional analysis of the rice AP3 homologue OsMADS16 by RNA interference.Plant Mol Biol.52 (5): restriction enzyme enzyme recognition site 957-966.) has XbaI site TCTAGA in forward primer; The SmaI site is arranged in reverse primer), the cDNA of pcr amplification xa5 gene.Wherein, reaction system: 1ng genomic dna, each 0.25 μ M of forward and reverse primer, 1.5mM MgCl ₂, 20mMTris-HCl (pH8.4), 50mM KCl, 0.8mM dNTP mixture, and the pfu polysaccharase (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) of 0.5 unit.Reaction conditions: earlier 94 ℃ 5 minutes; Again 94 ℃ 30 seconds, 55 ℃ 1 minute, 72 ℃ 3 minutes, totally 30 circulations; Last 72 ℃ 5 minutes.The 389bpDNA fragment that amplification is obtained reclaims this fragment with the scheme that gel reclaims test kit (Science and Technology Ltd. of sky, Beijing latitude Time Technology company limited) and provides by supplier, utilize restriction enzyme to connect into corresponding XbaI of the pZh01 that contains 35S promoter and SmaI site, with the connection product transformed into escherichia coli DH5 α that obtains, cut evaluation through colony screening and enzyme, obtain containing the recombinant expression plasmid pZh01-xa5 of xa5 gene cDNA.PZh01-xa5 is changed over to the callus of susceptible material Ni pponbare by the mediation of Agrobacterium LBA4404, with this callus selection substratum (inorganic salt of N6 substratum, the trace element of B5 medium and VITAMIN, caseinhydrolysate 1g/L, proline(Pro) 500mg/L, sucrose 30g/L, 2,4-D 2mg/L, plant gel 2.0g/L, Pyocianil 500mg/L, Totomycin 50mg/L pH 5.8) cultivates 21 days follow-up generations for the first time, per 14 days subcultures once about one month, grow the resistant calli of white on the callus of brown or black later on; This resistant calli sprouts and root through conventional cultivation differentiation, obtains seedling.Utilize dCAPS mark D5/XhoI to carry out PCR to the seedling that obtains and identify that obtaining 37 strains changes the xa5 gene plant.The xa5 gene plant be will change and bacterial leaf spot pathogenic bacteria P1 and P2 inoculated respectively, the result shows rotaring gene plant blade scab length much smaller than contrast (not changing the Nipponbare of xa5 gene over to), illustrates that changeing xa5 gene high expression plant all has resistance to bacterial leaf spot pathogenic bacteria P1 and P2.

Embodiment 5, cultivation resisting bacterial leaf-blight ability enhanced paddy rice

To clone the 13.2kb dna fragmentation insertion pCAMBIA1300 of 30N9 from BAC according to embodiment 2, be built into the pCAMBIA1300-xa5 plasmid; Then it is imported disease-resistant material IRBB4, IRBB3, IRBB13 and IRBB21 obtain changeing the xa5 gene plant.To change the xa5 gene plant and inoculate bacterial leaf spot pathogenic bacteria P1 respectively, P2, T3 and P6, the result shows that transgenosis plants leaf spot lesion length and be significantly less than contrast, illustrate that changeing the xa5 gene plant all has resistance to bacterial leaf spot pathogenic bacteria P1, P2, T3 and P6, and disease resistance is stronger, anti-spectrum is wideer.

Sequence table

<160>6

<210>1

<211>13228

<212>DNA

＜213〉paddy rice belongs to paddy rice (Oryza sativa var.Lansheng)

<400>1

agcttcctat?ctcgactata?acgctttgga?tttgttaaaa?aaaacttgaa?tcgtgggata 60

cgctattttt?aaatgagaac?tggaacatct?gagttgaatg?cttgacaaat?tgagttgtaa 120

gttttcttga?gttataagat?gacatctaaa?ggtttagttt?ttttttcttt?taatttgaat 180

ttcctcgcta?aaaataaggt?tgaatttaat?ctcaaatttt?agctgaacat?tgcaccgcta 240

cccattcatt?gtatcaaatt?agactgctac?atacagctac?tgtagtgtga?caatgcccat 300

ctgttttctg?aagaagaaac?aaaagaatgc?ttagctgtct?gtcgtttctt?aatcaccctc 360

ttcgtttatc?cagctttatc?tttctccaaa?ttctcatcac?ctgataaaat?ccgtatgttg 420

gatttcatgc?atgagcctgc?aaattacagg?cgtatgtttt?ccttgaaaac?actcaattcc 480

tttctgatta?gaatttcaca?gaattctata?aaaccctgca?gaattcatat?taaatcgatg 540

gcttaaactg?ctgaccgcta?attaatgctt?cataattgga?agtgcttatt?gtatgacaaa 600

aatgacaata?gcgatggctg?gtactggagc?ttccaactac?aatccttgaa?catggttagt 660

tgcctaatac?ctcccctgat?gtgcctctgc?gatctaattg?cttgcctgca?gtgaccatct 720

aattattcaa?gtgtatatac?accttgtcgg?tcggctatat?ctctatttag?tttatatttt 780

gcaaccttaa?ttacacgtaa?cacatatacg?aacacgcaac?catatcatca?agcacagggc 840

ggcacgcatc?tacagcctgc?agttcatgct?gtgttgttta?agaaggaaaa?tgattttttt 900

ttaaaaaaaa?agaagaggaa?gaagatatga?ttatctatct?actgtagtga?aagtgtcaac 960

atgacgacgt?gcagcggaat?agtacatcaa?acataaagta?gtacacctaa?ttatattggt 1020

accaaaagat?aacccgtagc?agtaacaagt?tgttaattgt?tgattctaaa?ttttgaggac 1080

atatgccgtg?aaaacgagtt?aagtattgaa?aactcgtgaa?aaatcatgaa?aaaaattaca 1140

ttctcaccga?atcttatgtt?caaacttagc?tttattcgag?agtaaaaata?aatatttttt 1200

aggtgaatag?taactatttt?caggtgaatg?gtaaaaaaga?caaataaact?caactttatt 1260

tgggaatgaa?aatccacttg?aaatttgtca?tttttattac?tctcaaatga?agctgagttt 1320

ggacttgaca?tttggtgaga?atgtacttca?aatctacaca?tatctctagc?aaatgtttca 1380

tgaatttact?aaacttttag?gtatgatttc?acgagttttc?aacacttagc?tcgttttcac 1440

agagtatttc?cctagtcgtc?gctatgcccg?cgtatacttc?gtcccccctg?gatgtcaagg 1500

tctccatgga?tgtgcacaga?tgataaactg?tagtgtgctt?agcatatcgc?gagactatcg 1560

ggtaatggac?aactcatatt?taattgtgct?agagaaaaaa?aaaagataaa?ttgcagtttg 1620

tactatatat?tcttgaaagt?gttcatatta?tatcatcgtt?taaccatttt?tttcatatac 1680

acaacatcta?actttacatt?tcattttgga?ctaccccatt?ctatccatct?tcaaggccgg 1740

tgactctaca?accattccac?gcactaactc?tttctgcctt?ttcctttttc?cttttgaaag 1800

ctagggaatc?gtcagatcca?gcaaggagga?gtccgatcta?gcttccctgc?tctttgtcgg 1860

gccagctcct?gccactccaa?gtccctgcaa?acccgacagc?ccctaacctc?aacggtgacc 1920

ataacaatag?tgtgcatgat?gacgggggag?gggaaaagac?atctcgatga?ctagagggtg 1980

tggctatgca?tgtaaaggcg?gagaggagga?acaatggtgg?tagctaatgg?aaaaaagagc 2040

ggtggtggcg?gtgtgtgtgg?agcggcaact?agtggttatt?ggtggtctaa?ggagtttgcc 2100

gttgatacaa?tccccaacct?tgtttgttgc?attttttttc?tctgagtact?atcaatatat 2160

ttgtccatca?ataatcataa?agaaatagct?agttttaaag?tagtaaaaaa?attgagataa 2220

aggtggagta?ctcgagtagg?gatgaaaacg?ctttggaaaa?agacgaaaaa?ctcttttatc 2280

gtttccattt?ccatattttg?ttcgaaatcg?aaaaccacgg?atacaaaaat?ggaatcaaat 2340

attatcgaat?acgaaaatgg?agcgaatacg?gtaacagata?tttatcggaa?tataaaagcc 2400

ccttaagctg?aacttctaaa?atccatgaag?agatatagct?caatatctct?ctgaaacaat 2460

aaatcgatat?ttataatttt?tatcaattaa?taataatata?actaggtgta?taatttattt 2520

tcttggagaa?aaagagctat?atttatctat?aattgcaatt?ataaatacta?aatatttccg 2580

attccgagaa?aaagaaaatc?tgaattcgtt?tcctgaaatt?ttccaaaatt?ggttttgggc 2640

ggatagcagc?atttccaaga?gtggcaaata?ttccctgtaa?aataactcga?gtaatggttc 2700

tctttggcgt?aaaataaaga?gaaatctggc?gtctcgtcgt?ctcctccgct?cctcctctcc 2760

ttgcgccaac?aagccgactc?gcgatctcca?tcgggcaaga?agagcagagc?agagcagggg 2820

aggggatcct?gcaggtgacc?atcctctttc?tttctttctt?tctttctctg?aattcatctc 2880

tctctctccc?accgggactc?tctacttttg?tctggaattt?gctcgcgttc?gttcgttaac 2940

cctagcttct?cttctcttct?cttctagatc?tggaagaagc?tcttaatttc?agagccttaa 3000

cctctcttaa?tactacaagt?aacaacagtt?ttgttgtttg?ttccccccac?cccaaaaagt 3060

ttaggcgcac?gcatcgccca?tggccacctt?cgagctctac?cggaggtcca?ccattggcat 3120

gtgcctcact?gagacgctcg?acgagatggt?ctccagcggc?accctcagcc?cggagctcgc 3180

cattcaagtt?cttgagcagt?ttgataaggt?atctacttta?ccatatctcc?ttccacctat 3240

tactatctat?actattgaaa?aattcgactc?ctcattttgt?ttgttatcat?ctatgtgatt 3300

agtctatgac?ggaagccttg?gagaaccaag?tcaagagcaa?ggtttctatc?aaggtatctg 3360

ctcttatcac?ggagttgcca?tgttgctgtt?cctacccccc?caaaaaaaac?caagccttac 3420

ttgtgctgtg?cataacttta?atctctatct?gtttcgagcc?tactcattat?ttatgcttga 3480

gaactcatat?gcgcttgtga?tgtaatttct?ccagtgctag?aattgataca?cttggttgtg 3540

gattcagcgt?tgccattcga?ttttcttttc?cgtacacacc?ttgctaaagg?aatcaagtct 3600

aaaatttgtt?tcttgcatat?attatattat?tattattatt?cataaaggaa?tccattcacg 3660

ttcgacacgt?acctgtcctg?tgtacgctgc?tctgagttct?gagggatatt?gcacaaactt 3720

tatagtaatg?agtaagcgag?taacagaatt?aagacctatc?agcaacataa?tacacgggca 3780

taaccagaca?aatcttgcac?ttatcacata?tatgctttta?ttttttcggc?tgtacaagca 3840

tatttccact?tatcttattt?tgcaacacat?caagtactcc?ttgagttgct?cagattccaa 3900

gctgctcatc?tgtgtttggc?cccaaaaaaa?aagaaaagaa?agaaaaacct?tttattggat 3960

aaacaagcct?gagaaatgtc?aagatctttt?cttgccagca?taatcctcac?caaaatgaaa 4020

ttatgaataa?agattagtgt?cattctttct?gatacccatg?tagtttgtta?ttctatggca 4080

tgatagagat?tcttttttgt?ttgtgaattg?ggggtaatca?cagaaatgga?ctgatatttt 4140

tgcccaacaa?tgggtgactt?gtttacgtat?cttactgtaa?tccgctttac?tcctggcccc 4200

ttgccccttt?tttataaatg?gaagtcaaaa?gtatgcaaaa?tataggcaac?tcgcacatta 4260

caatagcctc?agaccctaac?taccacatcg?caaccatgtg?cgagttagga?atgccacacc 4320

cggatgtgtg?tcctctatgc?gatcaggagg?agactataca?gcatattttg?gtgacttgtg 4380

ttttttcctg?gcaagtatgg?tttttaatct?tccaaatggt?tggatgggcg?ctgcagcact 4440

gcaaccatca?atgaatcgct?tgtctagctg?gtggttcaaa?acagttaagg?atactcctaa 4500

agaggtaaag?aaagggctga?actctttgat?tatcctagtg?gcatgggaaa?tatggaagca 4560

tcgcaatgat?tgtgtcttca?atggtgcctc?cccgagaatc?tcggctgttt?tgcatgcagt 4620

ggctagagag?agttctcttt?ggtgtactgc?tggagcaaag?gcactcctcg?aaattctgtg 4680

tgggttgctc?cccctggacg?gctagtttct?cctagggggt?gtttcggttg?cacgtcgcgt 4740

tccgtgatgt?ttttttgtgt?ttctgtaggg?gtcctttggg?tcactcggtt?gtacaatttc 4800

tcttcttaat?gaaatgaatc?gcagtcctcc?tgtggtttcg?agaaaaaaaa?actcacacat 4860

tgcaatattg?cccatattaa?aacactgatt?tttccccata?aaccaaaaca?agaaataaag 4920

taactaagtg?accctggtgt?gtacatgttt?attagaactt?ctttatctgc?aatattgtgc 4980

aagagaaaca?agccgcaaac?agcgttggag?ctcaataaca?aaccagtaat?gatgctagaa 5040

accgtaccaa?acataagacg?gtactctgct?agaaaccttt?tttttttgtg?ccaagaagcg 5100

acttgaccac?tcaacatctc?aatttccctt?ctgatcacaa?gcaatctagg?gctcatcgct 5160

gggttcgtac?gataatcaca?cttccctgtt?ctccattctt?gtcatagttc?agtgctctgc 5220

tcctctaact?gtgcttgtag?tatcaatcag?tcctctgggc?cattcgtaga?cgcaacaggc 5280

agctcaccaa?gttcgggtga?atcgttttgt?cgtgtttatt?cttgtcccat?tagtcactag 5340

atagttcagc?actgttcttg?ttattctatt?gatgcatttg?tatatgactc?attttcacga 5400

aaggtgcatc?aagagcatta?tattactgta?gctatgtagt?tgttatcggt?gagctttgct 5460

ccatgctaaa?agagttgggc?taaatctata?gcatttaaga?attagttata?gctggaaaga 5520

tcatgtttgt?cttgtagatt?cgactacctg?atagcagcta?tccacctgga?tgatgaacag 5580

atctgtccat?gacaacctgc?tgggctatgg?tgcatgcatg?cacccatgtg?ataagtatgt 5640

aaaacgctat?cctagatata?gttttgcaag?aattgatctc?tattgctacc?ggagactaga 5700

aaggtgttat?ggattggcta?gggcaagggt?ccgaagaccg?ggggatatag?cactcgccct 5760

ctaatagcag?aggcagggct?tctccctgct?gagctaaaag?aggctatgag?gcttagggct 5820

aactttagag?attcattgat?tgattgataa?gagtacatgg?ggtcacttta?tatataggga 5880

ggacaggctt?gacatccaag?gaactaatct?ctagtactac?agaaaccagt?ccaatctcta 5940

tctctaactt?tctaataaac?ctcatctctt?tcctaattag?ataatctcct?acctatatat 6000

gagtaattcg?taatttatga?tgcctaaact?gctgcatggg?cctggtccat?gcccataaca 6060

ctacacccct?cgcggacaga?tagtcttcga?gcactagcag?atatcttctt?ggaaagaact 6120

tcaatggtag?cagtcggcaa?atcatcaaag?cgaagtttga?tatttttctt?gagttctggc 6180

caagtttgaa?ttccgtaggc?tcgctcaatc?aactcatacc?acattgcggc?aaacctggtc 6240

cggtggcttg?atgcaatcca?ccacttctct?tcctccataa?attcgctgct?caacaaagaa 6300

ctgctcaata?ctctccaacc?aaatttgcgg?atcatcctca?ccattgaacg?ttgggagagg 6360

ttcaaggtgg?cgaaatctcc?acatccaatt?gaaatccccg?ctgcacgcca?tcgagggtgg 6420

agcatcagtt?ggctctgata?ccaaatgtta?tggattggct?agggtaaggg?tgcaaagact 6480

gggggatagg?gcactcgccc?tctaatagca?gaggcagggc?ttcttcctgc?tgagctaaga 6540

ggctctgagg?cctagggcta?gctttagaga?ttcattgatt?gattgattga?taatgcagta 6600

cgtgggaccc?ctttatatat?agggaggaca?ggcttgatat?ccaaggaact?aatatctagt 6660

accatagaaa?ccagtgcaat?ctctatctct?aactttctaa?tagacctcat?ctctttccta 6720

actagataat?ctcctacctt?tatatgagta?attcctaatt?tataatgcct?aaactgctgc 6780

atgggcctgg?tccatgccca?taacaaaagg?aggtaaacgc?tatcttatag?cttctaaata 6840

cggcacacct?ttatcatcca?tttctagttt?tggcttatgg?aaaaatcttc?agttaaagca 6900

tttatgatat?tacaaaattg?cagatgacgt?tttgtcggca?tctgaactct?cgtgaatctg 6960

ctgcttgccc?cttcttagtt?gttccttaag?ttgtttcggc?ctttccaatt?tagcagtaca 7020

cttaatcctc?atgatccaac?catggccatc?aattttcaat?tttcaactct?gagcactctc 7080

gaccaatctc?ccatcagctg?ggacctattc?agctgtctaa?gacatacatt?cacaaaggag 7140

attgcatgtt?ctgattttca?tttttacttg?taaaatgtaa?tgtttgcata?gccattttgt 7200

atgtttagcc?tgaaaatggt?tgaagcatag?ttaccagttc?atttgttttg?gtgttttacc 7260

tgataatgtc?cagtgtatga?agacatgcga?taattgataa?attcatatat?ccggccactc 7320

ttttacaact?gtcactgtgt?gggtttaaga?aatccctctt?ttgacaaacc?gcagttctct 7380

ttttcttttc?caaagaattg?ttaatcccac?actgaattgc?tgtattagga?agggatcacc 7440

tctacaatat?gtcatttatg?atatgtggtg?ttgagatgtt?acgtgttctg?ttttattttt 7500

gacgaaaatg?caggagaact?ggcattccat?taaccattag?ctaagaaatg?tacatggttt 7560

tatcagtcat?aaactggact?tactatttta?gaatcatgaa?ctagagtttt?gctaatggaa 7620

attttaccat?tttaaaaatc?atgaactgga?gtttgaatta?atctctgttt?tatttatttt 7680

tgagtaaatt?tcataaaact?acatatactt?tgcatgatct?atcacaaaac?tatagattta 7740

agaacttatt?tcacaaaact?acaaatttaa?tgtcttcgtt?tatcacaaaa?ctacaggtat 7800

tttacacaat?atatcacaaa?actacagatt?taagaacttg?tttcacaaaa?ctacagattt 7860

aatatcttca?tttatcataa?aactacaggt?ttagtgtctt?cattatcaca?aaactacagg 7920

ttttagcatt?gtcaaaacct?gtagttttgt?gataatggag?acactaaatt?tgtagttttg 7980

tgataaatga?agacactaaa?tgtgtagtcc?tatgataaac?gaatacacta?attctatagt 8040

tttgtgaaac?aagttcttaa?atctgtagtt?ttgtgataga?ttgtacaaag?tacctgtagt 8100

tttgtgataa?acgggcatac?taaatctgta?gttttgtgaa?acaagctctt?aaatctgtag 8160

ttttgtgata?aattgtgcaa?aatacatgta?gttttgtgaa?atttactctt?tatttttcta 8220

acttgctatc?ctgctccaga?aattttccat?tctagttaca?tgagtttaag?cctcttgtca 8280

ttttggacgc?aatgtcgaac?agacctgtat?ttgatggatt?ttttttgttt?atttaagaat 8340

aagttctctg?gtacagctta?gatacgatgg?atgattgact?aactttttga?gcctgtattt 8400

cagatatttt?gtagctgggc?tgtttactga?tgcatgttct?tttctcaggg?ccacctgcac 8460

acttacaggt?tctgtgacaa?tgtatggaca?ttcatcttga?ctgaagcatc?attcaagaac 8520

gaggagacta?cagaacaagt?tggcaaggtg?aagattgtgg?cctgtgattc?caaactactc 8580

agccaataaa?ttgataactg?cgaggtcagg?gtttgcctgg?tatttgttag?tctcttctgc 8640

tagacctggc?tccgcctgaa?gtgtactgta?ccaccacatt?gtttgtttca?taatcaatgt 8700

gtgtcaatac?aatcgtatgt?gctaccagag?tatatcacag?cagcaactgt?tttaatttgt 8760

atgcttatgt?aattgttatg?ctactgctgt?gttgataatg?tgatataaat?gactaaacga 8820

tgagtagtag?aaattgtgcg?gagtcaccct?cccccttcct?catttctgaa?ccctttggtt 8880

ctgtgtgact?ctttgtatgt?aacatgaaca?aatacctcct?ttcccgtctt?ttttttggat 8940

cctatgttaa?tggtaccttt?acattatgat?gtgctctttg?ggcatgtttc?atttcttgcc 9000

aaaatcaacc?ctagcaacat?ttggcattac?cgaaatgcca?aaaaaattgc?tatggttgga 9060

agtggtaaca?aatcaaacgt?gctggatctt?cagaaatgtt?tggtgctttg?tgtttacctg 9120

cttttttaat?atcaagattc?agagtattgt?ttggattata?acttgattaa?tgttctaaat 9180

gatactgtcc?tgctacccag?ttgaggtgtt?ctcataatct?tgcagaactt?ggatggattt 9240

ttgttcccca?gttgcattat?tagagatgaa?atgagtcaga?ccttggtcat?aagcatgcat 9300

gtgtggcaga?attctctaag?gacaaaagtt?taatccttgt?cagtacaaag?taagtactat 9360

aattatctgc?gacagtttga?tggccaattg?caaggtgatc?atcaggacgc?agattaatta 9420

agggtgtaga?actagaagag?ccaccggtcg?aaacgtgtct?gagaaagttg?gaaatatctt 9480

gccaactctt?tgctagtaca?actagtacca?aggtactctt?cctaccagta?acaacaatcc 9540

tagagggcat?gagcatgaca?ggccagcact?gcagggaatc?aatcagctca?gcacagcact 9600

gcacagctga?ggctgatcag?cattcagcaa?tggcatgcac?aagccaacat?ggaaaaagac 9660

aagcaagcag?atggatctgc?cttcaagaaa?ggacgatgag?agaaaaaaaa?catgattttt 9720

tactctagtt?gttttcctta?atctcttttt?cccctaaacc?ccaggacaga?gagaaaaagg 9780

tggcctctaa?ctccaagtta?agctccagtc?gaaaggtctt?cacatagtaa?tgttttttct 9840

taattaaacg?cagattttac?attagtttcc?gttagcatgt?ctttaagcta?ctaaacaata 9900

tgtttcataa?aaaactttct?atatagaagt?cgctataaaa?tacagatata?ataattaaaa 9960

cttaactaat?catgtgtatt?aatagctttc?ttgtttacgt?aatttccgtc?tttatttctc 10020

tttagataat?ggaaacttcc?atcttcatat?ttggtgctag?aaacaaacac?caccataata 10080

ttgcggtgca?acacaacact?gcaagactct?actactccaa?cacacaaagc?tgggcacacg 10140

cacatcacaa?cctcactgcc?attgagggag?tgactgctga?gtggacacac?acacacacat 10200

attcacagag?agagagagag?agagagagtg?agtgagagaa?tcagagaacc?ctgacaatgg 10260

ctgtctctat?ctgtctgctt?tttgaggatg?taaggtgtgt?ggcaagagag?gccagagaga 10320

gagagagaga?gaggaatggc?gatggcaatg?gcaatggtga?gatggcttcc?acaactccac 10380

aagacgcctt?tcagctttca?ttgctgctgc?agtcctgccc?caggctagct?gctgccgtgc 10440

tgtgctgtgc?tgtgctgacc?accaaagata?ctgtcacaca?cttcacggag?aacggggtgg 10500

tggtggtggt?gttcagtgca?ctccctccgt?caaaaataaa?ccaaactcgt?acgatgaatc 10560

tgatatgaac?tgaggtgtta?catctcatat?gaaattggtt?tattttgata?cagaaagaaa 10620

gagtaactgc?gagtctgcaa?cttctttttc?cggccttccg?ggttcaccgg?aaaccgtctc 10680

gagcgacgag?tgttgcaatg?ggaaacaatc?ctcctatact?gaagttctca?acattccagg 10740

attttgtgat?tgtttattac?attaattaac?agaaaattca?tccccctata?aaggagtatt 10800

tacttacaaa?tgcagagctc?tgtgtgacaa?ttggcatata?ctacctctct?gtttccaaat 10860

gtatggcatt?tttttcaata?ataaaatgta?tgacattgat?taattcaaca?tcaaacaaaa 10920

aagagatgaa?gggagtagaa?gaaaaatgta?tgtgtaaatt?agtgaaaggg?acatacataa 10980

aagtgttctg?ttttagcttt?cctcctgctg?atgcttttcc?attagacttg?gcttccaagt 11040

ttccaaaaag?gtttatctaa?acgcgataaa?aggcaaccat?aaaaggagaa?aaatgaaaca 11100

tttaaagtaa?gacacgagca?agactggtca?caaagaacac?taggctaatc?agcaacgacc 11160

ctctgctagc?ttgactgttc?cttttttcct?ttcactaatt?agcagcacaa?gttgcaatgt 11220

tagtttatct?acatgccaca?tgcccccaat?gatctctaca?ccattttttc?ttgttttctg 11280

atggagttcc?gtacaatgca?gtgtgttttg?ttagtgatag?ctgacaaaag?atgaaagtgc 11340

cttgatcagg?cttcagcatg?tttgtgtaat?ccaaagtact?aactccgtcc?agaaacaccg 11400

tagttttgca?ccgtttatgt?ctaacattta?gtcatccgtc?ttatttgaaa?gatttctatg 11460

attagtattt?tttttattta?gatgataaaa?catgaataat?gctttatgtg?tgactttttt 11520

tttaaaaaaa?ttaaataagg?ctgacggtga?atattgaaca?cggaaatcca?taactgcatt 11580

taaaataaga?cggaagtaaa?ttaagcctct?atattgaccc?cacatgtttg?tgtaatctaa 11640

agttggacac?tctggataag?agcaagatgc?atgagagtaa?cctatcttaa?tacgtagtac 11700

taatttctag?ctgactcttc?aaattgctgg?caaatgcaga?tgattactgc?attacactat 11760

tatattactt?tcattaacac?atggagatat?ttctctacat?atatttaaga?cagcttccat 11820

gtgatgttgg?ctcatgagaa?tgtgcagtgg?tgtctggtgt?gtcttgttta?ataatttctg 11880

aggaaaagta?gaaagtaata?tctcattatt?ttgccttttt?accagccttt?tatttccact 11940

ttgccttttg?agatgcacac?tgaaatattc?ctgcagctaa?aagggctagg?cttcttgaag 12000

tcctgacagc?cacatataaa?tacacaggaa?gagccaggag?caacaaaggc?ttttccaact 12060

cctctctttg?catgtgttgt?tgttgtggag?gtaaacaaga?ggaggatagt?gaagactgaa 12120

gagaggagta?gtactagtga?atagtgagtg?gtgagagggg?agagagatgg?aagtggaggc 12180

tcaccatggc?ttcctaccac?cagcagcagg?gaggcagcac?ctttatggcc?atccccacta 12240

tcaactttca?ggtatctaca?tgttggtcac?tttgatctct?tcttggttgg?ttgttgaatg 12300

ttctttggcc?tgcctgtatg?tcttgttagg?tgatctttgt?tttgtgctgt?gccaaggaaa 12360

ttttggttct?tggtggatcc?tttgagctcc?tcgagtggtt?cttatggttg?ggtattcagt 12420

tcagttcagt?tctcggagtg?ttttctcttg?tctgtgtttc?ctcttttttt?ttccatgttt 12480

actgatttct?tgacaatggc?ctcctgtctt?gcatatgttt?gatctcttat?catcaaaaga 12540

atcagcaatt?tttgggaggt?ttttgtggcg?agaatttctc?ctggtgtttg?acatctgttc 12600

cattggaact?aattcaggat?tcctttcaga?gaaaaggaga?attaattcag?gatcattata 12660

tgcattttca?tgtggtgttt?accggtttaa?tctcttttgt?gaatgtaaat?cgaaaggttc 12720

gcagtgcgga?tcacatgaga?gtgtgtgtga?gagaggtatt?gttggtgttt?agtgtgaact 12780

tactaccatt?gtcaaataac?caacacaatg?tcacacaaaa?agttcagaaa?aggaaccttc 12840

actgttgctt?ggaatttata?tgcattgtga?gcttcatttt?tttttcctaa?aaaaacatat 12900

tgcccccctt?ttcttttgtt?tgtttcagat?gtactctgaa?attgcaggtg?tgggagaaag 12960

aactgcaatt?gtgaatttac?cggttaaaag?ttttctcctt?ttttttttca?ggagatgatg 13020

agtggtggga?gtacatccct?tgccccttct?gctacattga?ggtggaggtt?catttccttt 13080

gtgaccatct?ccaggaggag?cattgctttg?acatgaaaaa?tgctgtaaga?agaacgcacc 13140

gcacctgcta?tctattcctt?ttcttctctt?cttgctgcaa?atgcattctc?atgtgcctgt 13200

cgatgcatct?ctgaattttg?atgaatca 13228

<210>2

<211>905

<212>DNA

＜213〉paddy rice belongs to paddy rice (Oryza sativa var.Lansheng)

<400>2

gtctcctccg?ctcctcctct?ccttgcgcca?acaagccgac?tcgcgatctc?catcgggcaa 60

gaagagcaga?gcagagcagg?ggaggggatc?ctgcagatct?ggaagaagct?cttaatttca 120

gagccttaac?ctctcttaat?actacaagta?acaacagttt?tgttgtttgt?tccccccacc 180

ccaaaaagtt?taggcgcacg?catcgcccat?ggccaccttc?gagctctacc?ggaggtccac 240

cattggcatg?tgcctcactg?agacgctcga?cgagatggtc?tccagcggca?ccctcagccc 300

ggagctcgcc?attcaagttc?ttgagcagtt?tgataagtct?atgacggaag?ccttggagaa 360

ccaagtcaag?agcaaggttt?ctatcaaggg?ccacctgcac?acttacaggt?tctgtgacaa 420

tgtatggaca?ttcatcttga?ctgaagcatc?attcaagaac?gaggagacta?cagaacaagt 480

tggcaaggtg?aagattgtgg?cctgtgattc?caaactactc?agccaataaa?ttgataactg 540

cgaggtcagg?gtttgcctgg?tatttgttag?tctcttctgc?tagacctggc?tccgcctgaa 600

gtgtactgta?ccaccacatt?gtttgtttca?taatcaatgt?gtgtcaatac?aatcgtatgt 660

gctaccagag?tatatcacag?cagcaactgt?tttaatttgt?atgcttatgt?aattgttatg 720

ctactgctgt?gttgataatg?tgatataaat?gactaaacga?tgagtagtag?aaattgtgcg 780

gagtcaccct?cccccttcct?catttctgaa?ccctttggtt?ctgtgtgact?ctttgtatgt 840

aacatgaaca?aatacctcct?ttcccgtctt?ttttttggat?cctatgttaa?tggtaccttt 900

acatt 905

<210>3

<211>106

<212>PRT

＜213〉paddy rice belongs to paddy rice (Oryza sativa var.Lansheng)

<400>3

Met?Ala?Thr?Phe?Glu?Leu?Tyr?Arg?Arg?Ser?Thr?Ile?Gly?Met?Cys?Leu

5 10 15

Thr?Glu?Thr?Leu?Asp?Glu?Met?Val?Ser?Ser?Gly?Thr?Leu?Ser?Pro?Glu

20 25 30

Leu?Ala?Ile?Gln?Val?Leu?Glu?Gln?Phe?Asp?Lys?Ser?Met?Thr?Glu?Ala

35 40 45

Leu?Glu?Asn?Gln?Val?Lys?Ser?Lys?Val?Ser?Ile?Lys?Gly?His?Leu?His

50 55 60

Thr?Tyr?Arg?Phe?Cys?Asp?Asn?Val?Trp?Thr?Phe?Ile?Leu?Thr?Glu?Ala

65 70 75 80

Ser?Phe?Lys?Asn?Glu?Glu?Thr?Thr?Glu?Gln?Val?Gly?Lys?Val?Lys?Ile

85 90 95

Val?Ala?Cys?Asp?Ser?Lys?Leu?Leu?Ser?Gln

100 105

<210>4

<211>20

<212>DNA

＜213〉paddy rice belongs to paddy rice (Oryza sativa var.Lansheng)

<400>4

gctcgccatt?caagttctcg 20

<210>5

<211>20

<212>DNA

＜213〉paddy rice belongs to paddy rice (Oryza sativa var.Lansheng)

<400>5

tgctcttgac?ttggttctcc 20

<210>6

<211>165

<212>DNA

＜213〉paddy rice belongs to paddy rice (Oryza sativa var.Lansheng)

<400>6

gctcgccatt?caagttcttg?agcagtttga?taaggtatct?actttaccat?atctccttcc 60

acctattact?atctatacta?ttgaaaaatt?cgactcctca?ttttgtttgt?tatcatctat 120

gtgattagtc?tatgacggaa?gccttggaga?accaagtcaa?gagca 165

Claims

1, bacterial leaf spot resistance related protein, it is to have SEQ ID № in the sequence table: the protein of 3 amino acid residue sequences, or with SEQ ID №: 3 amino acid residue sequence is through replacement, disappearance or the interpolation of one to ten amino-acid residue and relevant with bacterial leaf spot resistance by SEQ ID №: 3 deutero-protein.

2, the encoding gene of the described bacterial leaf spot resistance related protein of claim 1.

3, gene according to claim 2 is characterized in that: described encoding gene has one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 1 polynucleotide;

4, gene according to claim 2 is characterized in that: described encoding gene has one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 2 polynucleotide;

5, contain claim 2 or 3 or 4 described expression carrier, clone and host bacterium.

6, cultivating the method for resisting bacterial leaf-blight plant, is that claim 2 or 3 or 4 described bacterial leaf spot resistance related protein encoding genes are imported the purpose plant.

7, method according to claim 6 is characterized in that: described plant is a paddy rice.

8, a kind of method that obtains the resisting bacterial leaf-blight paddy rice, be to utilize resisting bacterial leaf-blight rice varieties IRBB5 and the hybridization of susceptible rice varieties to obtain F1 for plant, F1 obtains F2 for plant for the plant selfing, the F2 that obtains is carried out the resistance evaluation and utilizes molecule marker K5 or K8 or SSR3 to carry out the PCR detection for plant inoculation bacterial leaf-blight pathogenic bacterium, determine to contain from bigger among the IRBB5 and gradually ooze segmental resistant plant, described containing from bigger in the IRBB5 material gradually oozed F3 that segmental resistant plant selfing produces for resistant plant, is the resisting bacterial leaf-blight paddy rice of xa5 gene pure type.

9, detect the method for plant bacterial leaf spot resistance, be to use by SEQ ID № in the sequence table: 4 and SEQ ID №: the genomic dna that a pair of primer that 5 nucleotide sequence is formed is treated measuring plants carries out pcr amplification, then the pcr amplification product that obtains is carried out following 1) and 2) at least a detection:

10, method according to claim 9 is characterized in that: described plant is a paddy rice.