CN1297661C - A rice blast resistance gene, its encoded protein and use thereof - Google Patents

Abstract

The present invention discloses a rice blast resistant gene, and an encoded protein and application thereof. The rice blast resistant gene provided by the present invention is one of the following nucleotide sequences: 1) SEQ ID No: 1 in a sequence list; 2)SEQ ID No: 2 in the sequence list; 3) SEQ ID No: 3 polyribonucleotide of a protein sequence in an encoding sequence list; 4) a DNA sequence which has more than 90 % of homology with DNA limited by the SEQ ID No: 1 or the SEQ ID No: 2 in the sequence list and can encode proteins having the same functions. The encoding protein of the rice blast resistant gene has an amino acid residue radical sequence of the SEQ ID No: 3 in the sequence list, or is derived by the SEQ ID No: 3 by replacing, deleting, or adding one or a plurality of amino acid residue radicals of the amino acid residue radical sequence of the SEQ ID No: 3, and has the same activity of the amino acid residue radical sequence of the SEQ ID No: 3. The gene of the present invention has significance for culturing disease resistant plant varieties, enhancing crop yield and enlarging crop planting areas.

Description

A kind of blast resistant gene and proteins encoded thereof and application

Technical field

The present invention relates to a kind of plant disease resistance genes and proteins encoded thereof and application, particularly relate to a kind of blast resistant gene and proteins encoded thereof and application.

Background technology

Plant tends to be subjected to the attack of various diseases such as bacterium, fungi, virus and nematode at occurring in nature, shows as disease-resistant (Resistance) or susceptible (Susceptibility) reaction.To disease resistance of plant and disease-resistant Study on Mechanism is the problem that plant pathology and breeding for disease resistance are extremely paid close attention to always.

From 1992 are cloned into first disease-resistant gene of plant Hm1 from corn since, be cloned into more than 40 plant disease-resistant (R) gene at present, these disease-resistant genes relate to Different Kinds of Pathogens microorganisms such as bacterium, fungi, virus and nematode.The most encoded protein products of these genes have similar constitutional features such as NBS (Nucleotidebinding site, nucleotide binding site), LRR (Leucine-rich repeat, rich leucine repeats), TM (Transmembrane domain, membrane spaning domain), PK (Protein kinase, protein kinase), LZ (Leucine zipper, leucine zipper), CC (Coiled Coil, coiled coil) and TIR (Toll-Interleukin-1 Receptor, Toll il-1 zone) etc.And whether contain these structural domains according to them, also these disease-resistant genes can be divided into LZ (CC)-NBS-LRR, TIR-NBS-LRR, TM-LRR, TM-LRR, 5 classes such as LRR-TM-STK.But, except above-mentioned 5 class R genes, also cloned the R gene of other specific type at present.As the Hm1 gene of corn is to belong to a genoid of representing in the plant disease resistance genes with the effect of the pathogenic bacteria affinity factor, its toxin reductase enzyme of encoding, because it doesn't matter for resistance that produces and the nontoxic gene of pathogenic bacteria, thereby its disease-resistant mechanism does not meet gene-for-gene theory; The Hs1 of the anti-Cyst nematode of beet ^Pra-1The albumen of coded by said gene contains incomplete LRR and strides the film district; Membranin that contains 6 transmembrane protein spirals (Membranespanning helices) at least of the recessive mildew-resistance of barley (Erysiphegraminis f.sp.Hordei) mlo genes encoding, and do not have the similar structural domain of other R gene; The mildew-resistance gene RPW8 encoded protein of Arabidopis thaliana has a coiled coil district of striding in membrane structure and the born of the same parents, and comprises RPW8.1, and two different sites of RPW8.2 can produce resistance of wide spectrum to pathogenic bacteria; The resisting tobacco mosaic virus gene Rtm1 of Arabidopis thaliana and the Rtm2 heat shock protein of encoding respectively; The TIR-NBS-LRR albumen though the disease-resistant gene RRS1-R in the Arabidopis thaliana also encodes, but its proteic C-terminal comprises the nuclear localization signal structure that the transcription activating protein of being made up of 60 amino acid with WRKY family has similar structures, and this gene pairs pathogenic bacteria, Ralstoniasolanacearum, have non-microspecies specificity resistance, and be recessive inheritance; Tomato is to be similar to the cell surface Glycine Receptors albumen that participates in the endocytosis signal pathway to the disease-resistant gene Ve of pathogenic bacteria Verticillium alboatrum coding, in addition the anti-stem rust gene Rpg1 encoded protein of in barley, cloning recently contain two kinases districts and hydrophobicity more weak stride the film district.Therefore, the classification for disease-resistant gene is not a simple process.Only be cloned into more disease-resistant gene, just may understand the feature of plant disease resistance genes more all sidedly, and resolve the real mechanism of plant disease-resistant.

Paddy rice is one of main in the world food crop, is supporting the population in the whole world nearly 1/4.Great disease such as rice blast, bacterial leaf spot is the major reason that influences its output always, disease resistance and the resistance mechanism thermalization day by day of research paddy rice, as having located more than 20 rice blast resistance gene and more than 10 rice blast resistance QTLs site at present, localized bacterial leaf spot resistant ospc gene has also reached more than 20.But since nineteen ninety-five is cloned into first rice bacterial blight resistance gene Xa21, other three disease-resistant genes such as bacterial leaf spot resistant ospc gene Xa1, blast resisting Pi-b and Pi-ta only in paddy rice, have been cloned at present.This is for monocotyledonous model plant, and some is slow really for the progress of clone's resistant gene.And the Xa21 that is cloned, Xa1, four disease-resistant gene encoded protein products such as Pi-b, Pi-ta all contain NBS and LRR structure, belong to the big class of disease-resistant gene.And set out according to the disease-resistant gene constitutional features of on plant, being cloned into, infer in the paddy rice also should have polytype disease-resistant gene.Therefore, clone the disease-resistant gene more, that kind is wider more adding system in depth disclose the disease-resistant mechanism of paddy rice, also could be used for the disease resistance of genetically engineered improvement paddy rice better, improve its output.

The innovation and creation content

The purpose of this invention is to provide a kind of blast resistant gene and proteins encoded thereof.

Blast resistant gene provided by the present invention, name is called Pi-d2, derives from paddy rice (Oryza sativavar.Lansheng), is one of following nucleotide sequences:

1) the SEQ ID № in the sequence table: 1;

2) the SEQ ID № in the sequence table: 2;

3) SEQ ID № in the code sequence tabulation: the polynucleotide of 3 protein sequences.。

Sequence 1 is the genomic dna sequence of Pi-d2 in the sequence table, and by 6261 based compositions, its reading frame is from 5 ' end the 3361st to the 5835th bit base; Sequence 2 is full length cDNA sequences of Pi-d2 in the sequence table, and by 2935 based compositions, its reading frame is from 5 ' end the 125th to the 2599th bit base; Sequence 3 is aminoacid sequences of Pi-d2 encoded protein matter Pi-d2 in the sequence table.Pi-d2 is expressed as constitutive expression.

The proteins encoded Pi-d2 of blast resistant gene Pi-d2, be to have SEQ ID № in the sequence table: the protein of 3 amino acid residue sequences, or with SEQ ID №: 3 amino acid residue sequence is through replacement, disappearance or the interpolation of one or several amino-acid residue and have the № with SEQ ID: 3 amino acid residue sequence is identical active by SEQ ID №: 3 deutero-protein.

The serine/threonine protein acceptor class kinases that sequence 3 is made up of 825 amino-acid residues in the sequence table.In the sequence 3, being a membrane spaning domain (TM) from aminoterminal 12-34 amino acids residue sequence, is the structural domain with signal peptide function; From aminoterminal 48-165 amino acids residue sequence is an allosome recognition structure territory (B-Lectin) similar to exogenous agglutinin protein, participates in the identification of pathogen; From aminoterminal 436-458 amino acids residue sequence is a membrane spaning domain (TM), is the intermediary that above-mentioned recognition signal is passed to serine/threonine protein kitase (STYK) structural domain of carboxyl terminal; From aminoterminal 501-771 amino acids residue sequence is a serine/threonine protein kitase (STYK) structural domain, and its phosphorylation can be conducted signal to disease-resistant defense response system.Infer that signal peptide participates in identification to rice blast pathogen ZB15 nontoxic protein with allosome recognition structure territory, excites the STYK zone then.

Contain expression carrier of the present invention and clone and all belong to protection scope of the present invention.

Arbitrary segmental primer is to also within protection scope of the present invention among the amplification Pi-d2.

Utilize any carrier that can guide foreign gene in plant, to express, blast resistant gene Pi-d2 provided by the present invention is imported vegetable cell, can obtain disease-resistant or disease-resistant enhanced transgenic cell line and transfer-gen plant.Gene of the present invention can add any general promotor, strengthen promotor or inducible promoter in being building up to plant expression vector the time before its transcription initiation Nucleotide.For the ease of transgenic plant or transgenic plant cells being identified and being screened, can process employed carrier, as the antibiotic marker thing (gentamicin, kantlex etc.) that adds the alternative mark (gus gene, luciferase gene etc.) of plant or have resistance.For the security that transgenic plant discharge, when making up plant expression vector, also can not carry any marker gene, directly screen in seedling stage with the Pyricularia oryzae inoculation.The expression vector of Pi-d2 of the present invention can be by using conventional biological method transformed plant cells or tissues such as Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, electricity be led, agriculture bacillus mediated or particle gun, and the plant transformed tissue cultivating become plant.By the plant transformed host both can be monocotyledons, also can be dicotyledons, as: paddy rice, wheat, corn, cucumber, tomato, willow, turfgrass, lucerne place etc.Gene pairs of the present invention is cultivated the disease-resistant plants kind, enlarges the crop-planting scope, and it is significant to improve crop yield.

The present invention will be further described below in conjunction with drawings and Examples.

Description of drawings

Figure 1A is the Fine Mapping synoptic diagram of Pi-d2

Figure 1B is the folded group's synoptic diagram of striding of Pi-d2 designation of chromosome zone

Fig. 2 is the predictive genes result of GENSCAN to the dna sequence dna of 180kb

Fig. 3 is the domain analyses of Pi-d2 proteins encoded

Fig. 4 A is the cluster analysis in Pi-d2 and Pto and Xa21 serine/threonine kinase district

Fig. 4 B is that the sequence similarity in Pi-d2 and Pto and Xa21 serine/threonine kinase district compares

Fig. 5 is the Southern results of hybridization of the copy number of Pi-d2 full-length gene in rice genome

Fig. 6 A is complementation test expression vector pZH01/Pi-d2

Fig. 6 B is that Pi-d2 transgenosis T0 is for the Molecular Detection result

Fig. 6 C is for the resistance qualification result to part transgenic line T1

Fig. 6 D is that the T2 of transgenic line T0-10 is for the Molecular Detection result

Fig. 7 A is the RT-PCR analytical results of Pi-d2 on transcriptional level

Fig. 7 B is the Northern analytical results of Pi-d2 on transcriptional level

Embodiment

Embodiment 1, the discovery and the evaluation of paddy blast resistant gene

Use the stronger rice blast physiological strain ZB15 of rice district, China south virulence paddy and susceptible rice varieties Lijiang xintuanheigu (LTH), south of the River perfume (or spice) glutinous (JNXN) and the F of hybridizing acquisition over the ground ₁, BC ₁F ₁, F ₂Colony inoculates evaluation, and the result is as shown in table 1, and ground paddy shows as disease-resistant to ZB15, Lijiang xintuanheigu, the south of the River fragrant glutinous all show as susceptible, the F of ground paddy and Lijiang xintuanheigu, the fragrant glutinous hybridization acquisition in the south of the River ₁Plant also all shows as disease-resistant to ZB15, and ground paddy and Lijiang xintuanheigu, the fragrant glutinous hybridization in the south of the River, the B of colony of acquisition further backcrosses ₁F ₁In disease-resistant individual plant and susceptible individual plant meet 1: 1, and each F ₂The disease-resistant susceptible separation of colony is than all meeting 3: 1.These results show that rice varieties ground paddy is controlled by endonuclear single-gene to the resistance of rice blast microspecies ZB15, and are complete dominant inheritance, name to be Pi-d2.

Table 1 parent ground paddy (Digu), Lijiang xintuanheigu (LTH), south of the River perfume (or spice) glutinous (JNXN) and filial generation thereof are to the disease-resistant susceptible situation (R=is disease-resistant, and S=is susceptible) of rice blast pathogenic bacteria microspecies ZB15

Parent and progeny population thereof	Disease-resistant, susceptible individual plant number		The expectation ratio	x 2	P 0.05，0.01
							R	S	R∶S
Digu	37
				LTH			32
‘Digu/LTH’F 1	18
				‘LTH/Digu’F 1		26
‘(Digu/LTH)/LTH’F 1	23	18	1∶1		0.2602						3.84-6.63
				‘(LTH/Digu)/Digu’F 1		32	28	1∶1	0.2667	3.84-6.63
‘Digu/LTH’F 2	372	100	3∶1		3.406						3.84-6.63
				‘LTH/Digu’F 2		422	118	3∶1	2.8643	3.84-6.63
JNXN		21
				‘Digu/JNXN’F 1		17
‘JNXN/Digu’F 1	23
				‘(Digu/JNXN)/JNXN’F 1		19	17	1∶1	0.1111	3.84-6.63

‘(JNXN/Digu)/Digu’F 1	21	16	1∶1	1.3889	3.84-6.63
						‘Digu/JNXN’F 2	84	37	3∶1	2.0083	3.84-6.63
’JNXN/Digu’F 2	105	39	3∶1	0.3333	3.84-6.63

Embodiment 2, Pi-d2 and other known blast resistant gene relationship analysis

The Japan that contains known disease-resistant gene is differentiated the F of system and ZYQ8 and they and ground paddy hybridization acquisition with rice blast microspecies ZB15 ₁And F ₂Colony inoculates evaluation.As shown in table 2, BL-1, K60, Pi-4 number, K1, Fu Jin, No. 5, rattan slope, plum rains are bright etc., and 7 kinds all show susceptible reaction to ZB15, and the F that obtains with the hybridization of ground paddy ₁All show disease resistance response, hybridize the F that obtains with ground paddy ₂Disease-resistant, susceptible separation meet 3: 1 than all, show that the contained blast resistant gene of the contained blast resistant gene Pi-d2 of ground paddy and these 7 kinds is different.

Table 2 ground paddy and each rice blast differential variety filial generation F ₁And F ₂Colony is to the disease-resistant susceptible separation case (R=is disease-resistant, and S=is susceptible) of rice blast pathogenic bacteria ZB15

Rice blast differential variety (disease-resistant gene)	Differential variety is disease-resistant/susceptible response situation	F 1Disease-resistant/susceptible response situation of plant	F 1Disease-resistant/susceptible response situation of plant
										The plant sum	Disease-resistant strain number	Susceptible strain number	Chi-square test
			The expectation ratio	x 2	P 0.05，0.01
						New No. 2 (Pik ') likes to know No. 5 (Pi-i) plum rains of the careless flute e of the rising sun (Pia) (Pik) BL-1 (Pi-b) K60 (Pi-k ") Pi.No.4 (Pi-ta ') K1 (Pi-ta) good fortune brocade (Pi-z) rattan slope bright (Pi-k ") blue or green No. 8 (Pi-11) of No. 1 (Pi-z ') K59 of Zhai (Pi-t) narrow leaf	S S S S S S S S S S R R R	R R R R R R R R R R R R R	93 117 196 198 215 205 231 195 228 250 231 218 265				73 85 141 141 153 150 155 158 157 157 229 192 227	20 32 55 57 62 55 76 37 71 53 2 26 38	3∶1 3∶1 3∶1 3∶1 3∶1 3∶1 3∶1 3∶1 3∶1 3∶1 -- -- --	0.6057 0.3447 0.9800 1.3878 1.4900 0.2748 1.8185 0.8654 4.2632 1.7280 -- -- --	3.84-6.63 3.84-6.63 3.84-6.63 3.84-6.63 3.84-6.63 3.84-6.63 3.84-6.63 3.84-6.63 3.84-6.63 3.84-6.63 -- -- --

And rice varieties K59, the F of narrow leaf blue or green No. 8 and No. 1, Zhai and they and ground paddy hybridization acquisition ₁ZB15 is all shown as disease resistance response, but its corresponding F ₂Colony all separates and susceptible individual plant occurred, and its separation did not meet 3: 1 than both, did not meet 15: 1 yet, showed K59, may also contain the blast resistant gene to ZB15 among No. 1, narrow leaf blue or green No. 8 and the Zhai, but different with Pi-d2 in the ground paddy, nor equipotential.

Embodiment 3, to the location of blast resistant gene

With ground paddy and Lijiang xintuanheigu is the parent, has developed a F ₂Colony, with ZB15 to F ₂Colony inoculates processing, identify disease-resistant and susceptible individual plant, and disease-resistant individual plant and susceptible individual plant resisted, feel and hiving off, 6 individual plants of difference picked at random from disease-resistant and disease plant, get the equivalent blade, and, form disease-resistant and susceptible DNA pond with the blade of disease-resistant and susceptible individual plant mixed extraction DNA respectively, the disease-resistant and susceptible DNA pond of ZB15 is named respectively be BR15 and BS15.Successively parent ground paddy and Lijiang xintuanheigu are carried out dna polymorphism screen with being distributed in 12 chromosomal 127 RFLP marks of paddy rice and 322 SSR marks more fifty-fifty, find wherein to have 72 RFLP marks and 119 SSR marks can disclose the polymorphism of two parent DNA, and then analyze with these 191 molecule marker enantiopathies, susceptible DNA pond, and further with this assignment of genes gene mapping on paddy rice the 6th karyomit(e).

The Fine Mapping of embodiment 4, blast resistant gene

Utilizing ground paddy and Lijiang xintuanheigu to make up the F of expansion for the parent ₂Colony, and with this F ₂Colony plants in the greenhouse, and in its one core phase of three leaves, ZB15 carries out spray inoculation with the rice blast physiological strain, and keeps 100% humidity and 25-28 ℃ culture environment, inoculates after 10 days F ₂Individual plant resists susceptible evaluation.Obtain the susceptible especially significantly F of about 4000 strains ₂Individual plant is to these F ₂The blade of individual plant mixes by 5 strains builds pond extraction DNA, obtains about 800 susceptible DNA ponds, is used for Fine Mapping.With with the molecule marker of Pi-d2 positioning analysis, and the sequences Design primer that provides according to CIDC's cara gene (http://btn.genomics.org.cn) and international genome plan (http://rgp.dna.affrc.go.jp), 800 susceptible DNA ponds are analyzed, be located between molecule marker CAPs1 and CAPs8, wherein molecule marker CAPs1 and CAPs8 and target gene have 1 and 3 exchanges respectively, and molecule marker CAPs2, dCAPs1, dCAPs2 then with target gene be divided into from, shown in Figure 1A.

The acquisition of embodiment 5, candidate gene

At first to molecule marker CAPs1 and CAPs8 near trans-regional PACs sequences several analyze the back and make up its PAC and stride folded group (shown in Figure 1B), and find this regional karyomit(e) exchange frequency very low (about 500kb/cM), therefore, be difficult to target gene is positioned at the limited range of one or two gene.So the physical groups that CAPs1 and CAPs8 stride folded 180KB has been carried out predictive genes with GENSCAN, predict the outcome as shown in Figure 2, this zone contains 33 genes (as shown in table 3) altogether, serine/threonine receptor kinase protein (STK Protein) wherein, DNA conjugated protein (DNA Binding PROTEIN), ATP zymoprotein (ATPases), unknown function albumen (Unkown function Protein), each 1 of the rich proline(Pro) structural domain (Proline rich domain) of shearing associated protein, 2 of ThermoScript II (Reverse transcriptase), 5 in a type games albumen (MviN-like protein) in the bacterium, infer albumen (Putative Protein) 21, infer that the gene of the serine/threonine protein receptor kinase of wherein encoding is likely target gene.So, according to its dna sequence dna design primer of transcribing the zone carry out 5 ' and 3 ' the terminal amplification (RapidAmplification cDNA Ends, RACE) and transcription amplification (RT-PCR) obtain its full-length cDNA.Detailed process is as follows: for 5 ' terminal amplification, with primer 5 ' (P) TGAATGGGTGAC 3 ' RNA (having removed DNA) in the paddy rice ground paddy is carried out reverse transcription earlier and obtain cDNA, be template with this cDNA then, use special primer A1:5 ' CTTGCAGTGGTTCACATGGC 3 ' and S1:5 ' CCAAAGCCAAAGACAGAGCC 3 ' to carry out first round amplification, be template with the first PCR product that obtains again, carry out two with special primer A2:5 ' CAGTCTGGTCTGCCAATCCT 3 ' and S2:5 ' CTTGCAGTGGTTCACATGGC 3 ' and take turns amplification.Similarly, for 3 ' terminal amplification, earlier template ribonucleic acid is carried out reverse transcription, use special primer Con3R:5 ' TCGACCCGCCCATCCTTGT 3 ' and Adapter:5 ' GACTCGAGTCGACATCGA3 ' then increasing that reverse transcription obtains with 5 ' GACTCGAGTCGACATCGA (T) 163 '.For the zone between 5 ' and 3 ' end, with the cDNA in 3 ' the terminal amplification procedure is template, with two couples of special primer S1+CON2R (5 '-CCAAAGCCAAAGACAGAGCC-3 ', and 5 '-ATTTGAAGGCGTTTGCGTAGA-3 ') and CON2F+CON3R (5 '-TTGGCTATCATAGGCGTCC-3 ' and 5 '-TCGACCCGCCCATCCTTGT-3 ') acquisition of increasing respectively.By this full-length cDNA of analysis revealed 825 amino acid of encoding altogether, shown in the sequence in the sequence table 3.Simultaneously with primer GenRF: upstream 5 ' end: 5 ' AGCATCAACATAGACGTAGCGTGG 3 ', downstream 3 ' end: 5 ' CTAGTTACAGATCACTGTGCCAT 3 '; Utilize high-fidelity enzyme Pfu amplification, obtained the genome sequence that this gene pairs is answered, shown in the sequence in the sequence table 1, by relatively its genome and cDNA sequence are found this gene, only contain an open reading frame, it has comprised the complete area of cDNA coding, and this result shows that this gene does not contain intron.

Table 3GENSCAN is to the predictive genes of the dna sequence dna of 180kb II as a result

The gene numbering	Amino acid length	Homologous gene
			1	825	The serine/threonine receptor kinase protein
2	358	Infer albumen
			3	91	Infer albumen
4	383	Infer albumen
			5	123	Infer albumen
6	484	Infer albumen
			7	666	Motion albumen
8	105	Infer albumen
			9	150	Infer albumen
10	559	Infer albumen
			11	335	Infer albumen
12	381	Motion albumen
			13	877	Infer albumen
14	1027	ThermoScript II
			15	445	Infer albumen
16	1001	Motion albumen
			17	353	Infer albumen

The gene numbering	Amino acid length	Homologous gene
			18	450	Infer albumen
19	358	Motion albumen
			20	668	Infer albumen
21	448	Motion albumen
			22	375	Infer albumen
23	691	Rich proline(Pro) structural domain
			24	207	Infer albumen
25	357	Unknown function albumen
			26	140	Infer albumen
27	750	Infer albumen
			28	447	Infer albumen
29	690	DNA is conjugated protein
			30	75	Infer albumen
31	261	Infer albumen
			32	1721	ThermoScript II
33	911	The ATP zymoprotein

The structural analysis of embodiment 6, Pi-d2 proteins encoded

With Simple Modular Architecture Research Tool (SMART) (http://smart.embl-heidelberg.de/) method the coded albumen full length amino acid sequence of gene Pi-d2 is analyzed, the result as shown in Figure 3, this proteic amino least significant end promptly in sequence table the aminoterminal 1-32 amino acids residue sequence of sequence 3 be a membrane spaning domain (TM), be one and comprise 23 amino acid whose signal peptide structures (Signaling domain); The aminoterminal 48-165 amino acids residue sequence of sequence 3 is allosome recognition structure territories (B-Lectin) similar to exogenous agglutinin protein in sequence table, participates in the identification of pathogen; The aminoterminal 436-458 amino acids residue sequence of sequence 3 is membrane spaning domains (TM) in sequence table, is the intermediary that above-mentioned recognition signal is passed to serine/threonine protein kitase (STYK) structural domain of carboxyl terminal; The aminoterminal 501-771 amino acids residue sequence of sequence 3 is a serine/threonine protein kitase (STYK) structural domains in sequence table, and its phosphorylation can be conducted signal to disease-resistant defense response system; In sequence table the aminoterminal 419-431 amino acids residue sequence of sequence 3 and in sequence table the aminoterminal 797-808 amino acids residue sequence of sequence 3 be low complexity zone.Infer that signal peptide participates in identification to rice blast pathogen ZB15 nontoxic protein with allosome recognition structure territory, excite the activity in STYK zone then, thereby the intravital disease-resistant defense response of activated plant system realizes the disease resistance to pathogenic bacteria ZB15.

The comparison of embodiment 7, Pi-d2 and Pto and Xa21 serine/threonine kinase region amino acid sequence

Because in the present plant disease resistance genes of cloning, only there are the Pto of tomato and the Xa21 of paddy rice to have the serine/threonine kinase structural domain, therefore, from NCBI (http://www.ncbi.nlm.nih.gov/), search the aminoacid sequence of Pto and the corresponding STYK structural domain of Xa21 and compare with the aminoacid sequence of the STYK structural domain of Pi-d2, the result is shown in Fig. 4 A, show between Pi-d2 and Pto, Xa21 relative very conservatively, estimate that these zones are that such serine/threonine kinase performance is active necessary in some zone.Three's similarity comparative result show that the homology of the STYK of Pi-d2 and Pto, Xa21 is respectively 32.3%, 26.2%, and the homology of STYK only is 21.2% between Pto and Xa21 shown in Fig. 4 B.Explanation is on evolving, and Pi-d2 may be than nearer with Xa21 with the sibship of Pto.

Embodiment 8, genome copy number are analyzed

Paddy, Lijiang xintuanheigu, the Taibei 309 (TP309) change film according to the rice material genomic dna of SDS method extraction after enzymes such as ScaI, DraI are cut over the ground, utilize the Pi-d2 full length cDNA sequence to be probe, carry out Southern hybridization, the result as shown in Figure 5, show that cutting three samples hybridization of Hou Digu, Lijiang xintuanheigu, TP309 through ScaI, DraI enzyme all shows a band line, and the hybrid belt line is all variant between disease-resistant variety ground paddy and susceptible variety Lijiang xintuanheigu, TP309.Show that this gene exists with single copy form in rice genome, and dna sequence dna there are differences in disease-resistant material and susceptible material.1,2,3 genomic dnas of representing paddy rice ground paddy, Lijiang xintuanheigu, the Taibei 309 respectively among the figure.

Embodiment 9, have complementary functions

Because this gene does not contain intron, paddy cDNA is a template with paddy rice ground, with 5 '-TTGGG TCTAGAAGCATCAACATAGACGTAGCGTGG-3 ' and 5 '-TTTGC GTCGACCTAGTTACAGATCACTGTGCCAT-3 ' is that (wherein band is respectively restriction enzyme XbaI in the zone of setting-out down to primer, the recognition site of SalI, the protection base is cut for enzyme in the italic zone), utilize the high-fidelity pcr amplification to obtain the total length of this gene, and by after repeatedly order-checking verifies that repeatedly its sequence is correct, it is structured in contains 35S promoter pZH01 and go up as the expression vector that has complementary functions, the result as shown in Figure 6A, show that gene Pi-d2 is implemented in the downstream of the tobacco mosaic disease virus promoter 35S of expression vector pZH01, the expression vector pZH01/Pi-d2 that obtains having complementary functions, and utilize the susceptible rice varieties TP309 of agrobacterium mediation converted, 41 transgenic lines have been obtained, to these 41 strains is to carry out Molecular Detection in T0 generation, and the primer is upstream a 5 ' end: 5 ' TTGGCTATCATAGGCGTCC 3 '; Downstream 3 ' end: 5 ' ATTTGAAGGCGTTTGCGTAGA 3 '.The result is shown in Fig. 6 B, wherein 3 strains are the genotype that shows as TP309,35 strain systems show as the heterozygous of ground paddy and TP309, the performance of 3 strain systems closely is a ground paddy type, showing has 38 positive transgenic lines, and wherein genotype three strains systems being ground paddy type are likely that multi-copy integration has taken place target gene.Among Fig. 6 B, A is the Taibei 309; B is a ground paddy; C is a Lijiang xintuanheigu; 1-41 is transgenosis T0 generation, and totally 41 strains are three kinds of molecule banding patterns; * be the Taibei 309 types (the strain system that does not change over to), totally 3; # is ground paddy type (may be multiple copied strain system), totally 3; Heterozygous, totally 35.

Tie up to T1 for spraying respectively and injection inoculation in seedling stage and division Sheng phase to wherein obtaining seed-bearing 20 strains, the result is shown in Fig. 6 C, show that the 8th, 10 strains tie up to T1 for obviously ZB15 being had resistance, further these two strains being tied up to T2 inoculates for individual plant, and disease-resistant, the susceptible individual plant that is to each strain carries out Molecular Detection, used special primer 5 ' TTGGCTATCATAGGCGTCC 3 ' and 5 ' ATTTGAAGGCGTTTGCGTAGA 3 ', and PCR product enzyme is cut rear electrophoresis with restriction enzyme MluI.The result shows in disease-resistant individual plant all can detect target gene shown in Fig. 6 D, then fails to detect the target transgenosis in susceptible individual plant, illustrates that transfer-gen plant is to be provided by target disease-resistant gene Pi-d2 to the resistance of ZB15 really.Among Fig. 6 D, DL2000 is a molecular weight standard; A, B, C represent disease-resistant ground paddy successively, susceptible Lijiang xintuanheigu, the susceptible Taibei 309; 1 to 12 represents the disease-resistant individual plant of this strain system respectively; The susceptible individual plant of this strain system of 13 to 17 expressions.

Further these two disease-resistant transgenic line offsprings are inoculated with other rice blast physiological strains, the result shows that these two transgenic lines are to rice blast microspecies ZB13, Zhong-10-8-14, Zh2-1, Zk-10-2 etc. are susceptible, this result has verified that further transgenic line is by due to the disease-resistant gene Pi-d2 that changes over to the disease resistance of ZB15, and has disease-resistant specificity.Simultaneously proved that also this gene is exactly target disease-resistant gene Pi-d2.

The expression analysis of embodiment 10, disease-resistant gene

With rice blast physiological strain ZB15 over the ground paddy and Lijiang xintuanheigu carry out spray inoculation in seedling stage and handle, by handling back 0,12,24,48, RNA is extracted in 96 hours (hr) sampling according to a conventional method then.And each sample RNA is carried out being used for RT-PCR after DNA removes analyze, primer is a pair of specificity amplification primer (5 '-TTGGCTATCATAGGCGTCC-3 ' and 5 '-ATTTGAAGGCGTTTGCGTAGA-3 ') in the gene Pi-d2, and the cDNA sequences Design Actin primer of the paddy rice Actin gene Rac1 that delivers according to (Plant Mol.Biol.14 (2), 163-171 (1990)) such as McElroy (5 '-CCTCGTCTCGACCTTGCTGGG-3 ' and 5 '-GAGAACAAGCAGGAGGACGGC-3 ') in contrast.The result is shown in Fig. 7 A, and disease-resistant gene Pi-d2 is not subjected to inducing of ZB15, and at rice root, stem and Ye Zhongjun expression is arranged.Also the result with RT-PCR is consistent shown in Fig. 7 B for the result of Northern.Show that this gene as other most resistant gene in plant of being cloned (as Xa21 etc.), is constitutive expression, its expression amount is not very high, obtains but all can detect by RT-PCR and Northern hybridization.

Sequence table

<160>3

<210>1

<211>6261

<212>DNA

＜213〉paddy rice belongs to paddy rice (Oryza sativa var.Lansheng)

<400>1

agcatcaaca tagacgtagc gtggccgtat ccatttttta atgcatatat aaatttctcc 60

atcttttgcg atctctctgt tgctcacagt gtggccgtac acgctaaaca aatactccag 120

tactactact ccttattata ctcagcgtcc caaaatataa cttctatgct tcaaatttta 180

tctcgaaatt acactctcct cccaatcaat cacaaccttt caattccacc atttttataa 240

tcccgtattt aacaaacatt ttatatttca gaatgaaggt agttgtataa tattagtaat 300

aaataaacta ttcttttttc aaaaaataca ggacgcaatt tgataatgta aagcgtaaat 360

gcacacttaa ctagcacaac tctactaaat tcctttcaaa attctacacc atgagatctc 420

tggttctatt tagtgtctgt attgtatttt tttagtatga tatgatctaa acggtaaggt 480

aataataata acttttacta cctccattcc aaattagtag tcgctttcac ttttttcttt 540

tttcttgtaa cgtttgacca ttcgtcttat ttaaaaaatt agtgcaaata taaaaataga 600

gaagtcatac ttaaagtgct tttaataata aagcaaatca taaaaaaaac aaatattaat 660

tcgagtaaat tgcacccaca gtacaacaac ttgataggtg ggtgcgatat agtgcaagaa 720

cttgagaatt gaacgttcga gtgcaacaac ttgacaagtg ggtgcgtttt agtacaagaa 780

cttgacaatt tagtattttg gtgcatcaac taagctaagc atatgctagg tgagtttttc 840

tcacgatatc aatatgccat tacatagcaa tcatacggat attaccttgt aatattgaat 900

tttatcttta agaattatac tgcatatccc aatttacaac caattacctt taagaatttt 960

tgttttcttc acattcctaa atctcaaccg aaatataata atttctacat ctagttaatt 1020

gacttttagt tattagttat tagaataaaa atataaatat gcttatatgc aaatccacgc 1080

tagtatattg tcaaaataag aacttaaaaa ttgaatatgc ataaaaagtg ctccaaataa 1140

ttaagttgtc gcataacttc ttatcttatt gtatcaaaat cgtacgtatc ttacaagttg 1200

ttgcatttat acaatcactt ataaaatttt ttagctaaac tgcacatacc tgcgaagttg 1260

atgcactaga atgctcgttt ctcaagttat tgcaccaaat tgcacccacc tactaagttg 1320

atacatcatg ggtgtaattt actctattaa ttctataatt tttgaataag acgaaagatt 1380

aaaagttaaa aaaaactcaa agcgacaagt actgtaggac ggagaaagta tttattttta 1440

cgtgtcttgt agttaagtac agtatatttt taggtggagg gatgaataat ctccctggtt 1500

gagaggtgga gagagaagga tggtacccat tgaaaaatga agaattccaa taccacttgc 1560

aggtaggttg ttgctcgttt taattcctac tgccctcttg ctgctcacca actgctactc 1620

tctcctctcc caccatttcg tcaccctgcc tcctcctgcc tctgcctctg ctcggctagt 1680

ctagtgtact actctatctt ctcctcctct ctttctccta cccaaatcca tccacccaac 1740

atcttttttc tcagccgtcg tctcatctcg ccttcgtagc gttgcgtcgc gccgcgtcta 1800

ccctttccag gtgagcctcc ccgattacat cgctcgttct agctagctag ctagctagct 1860

cctgtgttct tgctgtttct ttgtttcttt ttgcgttttt aattttcctt tcttggatct 1920

ttctttgcta gctcgttttg atttgtgtgc ttctgtattt gtgtgttttg tgggcgaaag 1980

gggggctttc ttggttcttg ttccgggcga ttgttattct tgttctggag aatcggatta 2040

cgagtgtgcc ttgcagtgga gttttgtaat gttaggctcc aattgagcaa gaaaaagatg 2100

aggttcttgt taaattctag gttatccagc tcttgtttgg ttggctggtc tggaactctg 2160

aattccctct gtagcttttt actaggtaat ggaatcccct ttgtaatgca aaatgtagat 2220

gcctctgcca tggctatgtt ttatctttag atgtccggaa ttctcttcta agggagccta 2280

aacacggcag ttcagttcag attaattatg ggtctgggtt tgaagaaaag aataaaggga 2340

gtgaaataaa gaaacaaaca ggtctgaatt tgtgaccctg tttagctgaa agtgaaactg 2400

aaaaggggaa cagaaaggaa gaattgacca tcgatttaat gttaggtgtt actgcatatg 2460

tgcaagcaaa gattgttctt ttggcagtgg ataatgctct gatggtctct ggccgtgatc 2520

aagtggttgt ttttctctgc aggatgtggt ttaccttttg ctgttggtca aaaggaactt 2580

gtgccaccac tttctagttt gtttgttttg acacttggtg ctggcaattc ggttgctcac 2640

gggctgatca attccttttg ctgatttctt tttgagagaa atcccttttt ctttttcttt 2700

tttatatata tgccttttta tcttgcaact cattcatttc tcatgtttct gaaggtaacc 2760

tggataagac ggtggaggag ctatcaaatg tttatagagg agctcaagaa accaatagaa 2820

agctctatca ggaactgttc ccaattcagg tagtatactg gtttccgttt accaattgtt 2880

tcttgctatc gatcgatatc attaatcatc atatcttgtt caagccttct tgaaggttca 2940

aacatccttg taaatctgaa ctgagacatc atcttagtca ctgttgtttg tccagcagcc 3000

cacctgcatg ttcacatgta atctgacacc actaatttga acctactgtt actgtcaggc 3060

attgaaaaaa ccaggcatct ctgaatatcc tctatttgta gctatcatga acaacctgtt 3120

tgagacccct cataagattc ttgcatgctt gccagtgcaa tttagaatca agttacttag 3180

caaaattttc tgaataaatt ttgtagtatg ctcctcagct atatttattc tgcctatggt 3240

ctgatatttc tcaccaaaca gagcttctaa caatcttcat tctgtgcact gcagattatg 3300

caaatgtgtg gatggttact gaaggttgtt cgttgggaaa acttaaattg tgtgcacatg 3360

gaagctcatg gcaatcgtcg cagcagtcca acataccttg ttatgctgtg gatgatttcg 3420

gtagctagcc tattgataac atgtcgtggc agtatccaga agcaagttct ctttccaggg 3480

ttcactgccg cgcaaatgga ttacattgat aacgatggga tatttctgct ttctaatggc 3540

tctgtctttg gctttggttt tgtcacgagc aatgtctcag acaacacgtt ctacattctt 3600

gcagtggttc acatggccac tactaccaca gtctggtctg ccaatcctaa ctctcctgtc 3660

acccattcag atgacttttt tttcgacaag gatggcaatg ccttcctgca gtcaggagga 3720

ggctccaatg tatgggctgc caatatctcc gggaaaggga ctgccacctc tatgcaacta 3780

ctggactctg gcaatcttgt agtgcttggg aaagatgcct cttctcctct ctggcaaagt 3840

ttcagccatc cgacagacac tcttctgtct ggtcagaatt tcatcgaagg gatgacgctg 3900

atgagcaagt ccaacacagt acagaacatg acctatacac ttcagatcaa atctgggaac 3960

atgatgttat acgccggctt cgagacacct caaccatact ggtctgcaca gcaggatagc 4020

aggataattg tcaacaagaa cggtgacagc atctactctg caaacctcag ttcagcttct 4080

tggtccttct atgatcaatc agggtccctt ctatcacaac ttgtcatcgc gcaagaaaat 4140

gccaatgcca cattgtctgc tgtccttggt agtgatggat tgatagcttt ctatatgctg 4200

cagggtggaa atggcaagag taaattctcg atcacagttc cggcagactc ttgtgacatg 4260

ccagcctact gcagtcctta caccatttgc agtagtggga caggttgcca atgcccttcg 4320

gccctcggct cgtttgcaaa ctgcaatcct ggtgttacat cagcatgcaa atcgaacgag 4380

gagtttccgc tggttcaact ggatagtgga gttggatatg taggcactaa cttcttccct 4440

cctgcggcta agacgaacct tacgggttgt aagagtgcct gtacaggcaa ctgctcttgt 4500

gttgctgtgt tctttgatca atcttcaggc aattgtttcc ttttcaacca gatcggaagc 4560

ttgcagcaca aaggtgggaa tacaactcgt ttcgcatctt ttatcaaggt atcaagcaga 4620

ggaaaaggtg ggagtgatag tggcagtggg aagcacaata ccattattat tgtcattata 4680

ctcggaactt tggctatcat aggcgtcctt atttatattg gtttctggat ctacaagagg 4740

aagaggcatc ctccaccatc acaagacgac gctggttcat cggaagatga tggatttctg 4800

caaacaatat ccggagcacc agtgcggttc acttacaggg agctccagga tgcgacaagc 4860

aacttctgta acaagcttgg tcagggaggg tttggatctg tgtatcttgg tacactccca 4920

gacggcagtc gtattgctgt gaagaagctg gagggcatag gccaaggaaa gaaagagttc 4980

cgctctgagg taacgatcat tggtagtatc caccacatcc atcttgtcaa actccgaggc 5040

ttttgtactg agggaccaca caggcttctt gcctacgagt acatggcgaa tgggtcgctg 5100

gataagtgga ttttccattc taaagaagat gatcacctgc tcgactggga tacaaggttt 5160

aacattgcgc ttggaacggc aaagggattg gcatacctcc atcaggactg cgattcgaag 5220

attgtacact gtgacattaa gcctgagaat gttctacttg acgacaactt catcgcaaag 5280

gtatctgatt ttggccttgc caagttgatg accagggagc agagccatgt tttcactacg 5340

ctcagaggca cgcgtgggta ccttgcacct gagtggctca ccaactatgc catctcagag 5400

aagagtgatg tgtacagcta cggcatggtt ttgcttgaga taatcggtgg gaggaagagc 5460

tacgatccct cggagatctc cgagaaggct cacttccctt cctttgcatt caagaagctg 5520

gaggaaggtg atcttcagga catcttcgac gccaagctga agtacaatga caaggatggg 5580

cgggtcgaga ccgcgatcaa ggtcgcgctc tggtgcatcc aggatgattt ctaccagaga 5640

ccatccatgt caaaggttgt gcagatgctc gaaggcgtct gcgaggtgct ccagccaccg 5700

gtgtcgtcgc agatcgggta caggctctac gcaaacgcct tcaaatcgag cagcgaggag 5760

gggacttcat cagggatgtc ggactacaac agtgatgctc tgctttcagc tgtgaggctc 5820

tctggtccca gatgatgtga agaatcccat gtacagtgcc ttgtctagtt aggttgcaaa 5880

gtgtgcaaat tttgctgtag tttccagtgt tttggtgatc atttgcttca cactattgta 5940

catatcttct tggtcatttc tggtggtagt ttatacatat cttgctgatt atttatggtg 6000

gtagtttatc ggtgccattc tttttttgtt gcccttttgc ttatacataa ggtctccaaa 6060

acctttgaca attacctttt gtagttatgt cttagtaaaa ataataggaa atgcaatgat 6120

acaaaagcct ttttcatcag acctttcagt atcattttca agtcacaatt cttgtaacct 6180

tttgtgtatt caagaggtca ttgtttctga aatttgacat taaaaaaatg gcataacaat 6240

ggcacagtga tctgtaacta g 6261

<210>2

<211>2935

<212>DNA

＜213〉paddy rice belongs to paddy rice (Oryza sativa var.Lansheng)

<400>2

tcttcattct gtgcactgca gattatgcaa atgtgtggat ggttactgaa ggttcagtcc 60

aacatacctt gttatgctgt ggatgatttc ggtagttcgt tgggaaaact taaattgtgt 120

gcacatggaa gctcatggca atcgtcgcag cagtccaaca taccttgtta tgctgtggat 180

gatttcggta gctagcctat tgataacatg tcgtggcagt atccagaagc aagttctctt 240

tccagggttc actgccgcgc aaatggatta cattgataac gatgggatat ttctgctttc 300

taatggctct gtctttggct ttggttttgt cacgagcaat gtctcagaca acacgttcta 360

cattcttgca gtggttcaca tggccactac taccacagtc tggtctgcca atcctaactc 420

tcctgtcacc cattcagatg actttttttt cgacaaggat ggcaatgcct tcctgcagtc 480

aggaggaggc tccaatgtat gggctgccaa tatctccggg aaagggactg ccacctctat 540

gcaactactg gactctggca atcttgtagt gcttgggaaa gatgcctctt ctcctctctg 600

gcaaagtttc agccatccga cagacactct tctgtctggt cagaatttca tcgaagggat 660

gacgctgatg agcaagtcca acacagtaca gaacatgacc tatacacttc agatcaaatc 720

tgggaacatg atgttatacg ccggcttcga gacacctcaa ccatactggt ctgcacagca 780

ggatagcagg ataattgtca acaagaacgg tgacagcatc tactctgcaa acctcagttc 840

agcttcttgg tccttctatg atcaatcagg gtcccttcta tcacaacttg tcatcgcgca 900

agaaaatgcc aatgccacat tgtctgctgt ccttggtagt gatggattga tagctttcta 960

tatgctgcag ggtggaaatg gcaagagtaa attctcgatc acagttccgg cagactcttg 1020

tgacatgcca gcctactgca gtccttacac catttgcagt agtgggacag gttgccaatg 1080

cccttcggcc ctcggctcgt ttgcaaactg caatcctggt gttacatcag catgcaaatc 1140

gaacgaggag tttccgctgg ttcaactgga tagtggagtt ggatatgtag gcactaactt 1200

cttccctcct gcggctaaga cgaaccttac gggttgtaag agtgcctgta caggcaactg 1260

ctcttgtgtt gctgtgttct ttgatcaatc ttcaggcaat tgtttccttt tcaaccagat 1320

cggaagcttg cagcacaaag gtgggaatac aactcgtttc gcatctttta tcaaggtatc 1380

aagcagagga aaaggtggga gtgatagtgg cagtgggaag cacaatacca ttattattgt 1440

cattatactc ggaactttgg ctatcatagg cgtccttatt tatattggtt tctggatcta 1500

caagaggaag aggcatcctc caccatcaca agacgacgct ggttcatcgg aagatgatgg 1560

atttctgcaa acaatatccg gagcaccagt gcggttcact tacagggagc tccaggatgc 1620

gacaagcaac ttctgtaaca agcttggtca gggagggttt ggatctgtgt atcttggtac 1680

actcccagac ggcagtcgta ttgctgtgaa gaagctggag ggcataggcc aaggaaagaa 1740

agagttccgc tctgaggtaa cgatcattgg tagtatccac cacatccatc ttgtcaaact 1800

ccgaggcttt tgtactgagg gaccacacag gcttcttgcc tacgagtaca tggcgaatgg 1860

gtcgctggat aagtggattt tccattctaa agaagatgat cacctgctcg actgggatac 1920

aaggtttaac attgcgcttg gaacggcaaa gggattggca tacctccatc aggactgcga 1980

ttcgaagatt gtacactgtg acattaagcc tgagaatgtt ctacttgacg acaacttcat 2040

cgcaaaggta tctgattttg gccttgccaa gttgatgacc agggagcaga gccatgtttt 2100

cactacgctc agaggcacgc gtgggtacct tgcacctgag tggctcacca actatgccat 2160

ctcagagaag agtgatgtgt acagctacgg catggttttg cttgagataa tcggtgggag 2220

gaagagctac gatccctcgg agatctccga aaaggctcac ttcccttcct ttgcattcaa 2280

gaagctggag gaaggtgatc ttcaggacat cttcgacgcc aagctgaagt acaatgacaa 2340

ggatgggcgg gtcgagaccg cgatcaaggt cgcgctctgg tgcatccagg atgatttcta 2400

ccagagacca tccatgtcaa aggttgtgca gatgctcgaa ggcgtctgcg aggtgctcca 2460

gccaccggtg tcgtcgcaga tcgggtacag gctctacgca aacgccttca aatcgagcag 2520

cgaggagggg acttcatcag ggatgtcgga ctacaacagt gatgctctgc tttcagctgt 2580

gaggctctct ggtcccagat gatgtgaaga atcccatgta cagtgccttg tctagttagg 2640

ttgcaaagtg tgcaaatttt gctgtagttt ccagtgtttt ggtgatcatt tgcttcacac 2700

tattgtacat atcttcttgg tcatttctgg tggtagttta tacatatctt gctgattatt 2760

tatggtggta gtttatcggt gccattcttt ttttgttgcc cttttgctta tacataaggt 2820

ctccaaaacc tttgacaatt accttttgta gttatgtctt ggtaaaaata ataggaaatg 2880

caatgataca aaagcctttt tcatcagaaa aaaaaaaaaa aaaaaaaaaa aaaaa 2935

<210>3

<211>825

<212>PRT

＜213〉paddy rice belongs to paddy rice (Oryza sativa var.Lansheng)

<400>3

Met Glu Ala His Gly Asn Arg Arg Ser Ser Pro Thr Tyr Leu Val Met

1 5 10 15

Leu Trp Met Ile Ser Val Ala Ser Leu Leu Ile Thr Cys Arg Gly Ser

20 25 30

Ile Gln Lys Gln Val Leu Phe Pro Gly Phe Thr Ala Ala Gln Met Asp

35 40 45

Tyr Ile Asp Asn Asp Gly Ile Phe Leu Leu Ser Asn Gly Ser Val Phe

50 55 60

Gly Phe Gly Phe Val Thr Ser Asn Val Ser Asp Asn Thr Phe Tyr Ile

65 70 75 80

Leu Ala Val Val His Met Ala Thr Thr Thr Thr Val Trp Ser Ala Asn

85 90 95

Pro Asn Ser Pro Val Thr His Ser Asp Asp Phe Phe Phe Asp Lys Asp

100 105 110

Gly Asn Ala Phe Leu Gln Ser Gly Gly Gly Ser Asn Val Trp Ala Ala

115 120 125

Asn Ile Ser Gly Lys Gly Thr Ala Thr Ser Met Gln Leu Leu Asp Ser

130 135 140

Gly Asn Leu Val Val Leu Gly Lys Asp Ala Ser Ser Pro Leu Trp Gln

145 150 155 160

Ser Phe Ser His Pro Thr Asp Thr Leu Leu Ser Gly Gln Asn Phe Ile

165 170 175

Glu Gly Met Thr Leu Met Ser Lys Ser Asn Thr Val Gln Asn Met Thr

180 185 190

Tyr Thr Leu Gln Ile Lys Ser Gly Asn Met Met Leu Tyr Ala Gly Phe

195 200 205

Glu Thr Pro Gln Pro Tyr Trp Ser Ala Gln Gln Asp Ser Arg Ile Ile

210 215 220

Val Asn Lys Asn Gly Asp Ser Ile Tyr Ser Ala Asn Leu Ser Ser Ala

225 230 235 240

Ser Trp Ser Phe Tyr Asp Gln Ser Gly Ser Leu Leu Ser Gln Leu Val

245 250 255

Ile Ala Gln Glu Asn Ala Asn Ala Thr Leu Ser Ala Val Leu Gly Ser

260 265 270

Asp Gly Leu Ile Ala Phe Tyr Met Leu Gln Gly Gly Asn Gly Lys Ser

275 280 285

Lys Phe Ser Ile Thr Val Pro Ala Asp Ser Cys Asp Met Pro Ala Tyr

290 295 300

Cys Ser Pro Tyr Thr Ile Cys Ser Ser Gly Thr Gly Cys Gln Cys Pro

305 310 315 320

Ser Ala Leu Gly Ser Phe Ala Asn Cys Asn Pro Gly Val Thr Ser Ala

325 330 335

Cys Lys Ser Asn Glu Glu Phe Pro Leu Val Gln Leu Asp Ser Gly Val

340 345 350

Gly Tyr Val Gly Thr Asn Phe Phe Pro Pro Ala Ala Lys Thr Asn Leu

355 360 365

Thr Gly Cys Lys Ser Ala Cys Thr Gly Asn Cys Ser Cys Val Ala Val

370 375 380

Phe Phe Asp Gln Ser Ser Gly Asn Cys Phe Leu Phe Asn Gln Ile Gly

385 390 395 400

Ser Leu Gln His Lys Gly Gly Asn Thr Thr Arg Phe Ala Ser Phe Ile

405 410 415

Lys Val Ser Ser Arg Gly Lys Gly Gly Ser Asp Ser Gly Ser Gly Lys

420 425 430

His Asn Thr Ile Ile Ile Val Ile Ile Leu Gly Thr Leu Ala Ile Ile

435 440 445

Gly Val Leu Ile Tyr Ile Gly Phe Trp Ile Tyr Lys Arg Lys Arg His

450 455 460

Pro Pro Pro Ser Gln Asp Asp Ala Gly Ser Ser Glu Asp Asp Gly Phe

465 470 475 480

Leu Gln Thr Ile Ser Gly Ala Pro Val Arg Phe Thr Tyr Arg Glu Leu

485 490 495

Gln Asp Ala Thr Ser Asn Phe Cys Asn Lys Leu Gly Gln Gly Gly Phe

500 505 510

Gly Ser Val Tyr Leu Gly Thr Leu Pro Asp Gly Ser Arg Ile Ala Val

515 520 525

Lys Lys Leu Glu Gly Ile Gly Gln Gly Lys Lys Glu Phe Arg Ser Glu

530 535 540

Val Thr Ile Ile Gly Ser Ile His His Ile His Leu Val Lys Leu Arg

545 550 555 560

Gly Phe Cys Thr Glu Gly Pro His Arg Leu Leu Ala Tyr Glu Tyr Met

565 570 575

Ala Asn Gly Ser Leu Asp Lys Trp Ile Phe His Ser Lys Glu Asp Asp

580 585 590

His Leu Leu Asp Trp Asp Thr Arg Phe Asn Ile Ala Leu Gly Thr Ala

595 600 605

Lys Gly Leu Ala Tyr Leu His Gln Asp Cys Asp Ser Lys Ile Val His

610 615 620

Cys Asp Ile Lys Pro Glu Asn Val Leu Leu Asp Asp Asn Phe Ile Ala

625 630 635 640

Lys Val Ser Asp Phe Gly Leu Ala Lys Leu Met Thr Arg Glu Gln Ser

645 650 655

His Val Phe Thr Thr Leu Arg Gly Thr Arg Gly Tyr Leu Ala Pro Glu

660 665 670

Trp Leu Thr Asn Tyr Ala Ile Ser Glu Lys Ser Asp Val Tyr Ser Tyr

675 680 685

Gly Met Val Leu Leu Glu Ile Ile Gly Gly Arg Lys Ser Tyr Asp Pro

690 695 700

Ser Glu Ile Ser Glu Lys Ala His Phe Pro Ser Phe Ala Phe Lys Lys

705 710 715 720

Leu Glu Glu Gly Asp Leu Gln Asp Ile Phe Asp Ala Lys Leu Lys Tyr

725 730 735

Asn Asp Lys Asp Gly Arg Val Glu Thr Ala Ile Lys Val Ala Leu Trp

740 745 750

Cys Ile Gln Asp Asp Phe Tyr Gln Arg Pro Ser Met Ser Lys Val Val

755 760 765

Gln Met Leu Glu Gly Val Cys Glu Val Leu Gln Pro Pro Val Ser Ser

770 775 780

Gln Ile Gly Tyr Arg Leu Tyr Ala Asn Ala Phe Lys Ser Ser Ser Glu

785 790 795 800

Glu Gly Thr Ser Ser Gly Met Ser Asp Tyr Asn Ser Asp Ala Leu Leu

805 810 815

Ser Ala Val Arg Leu Ser Gly Pro Arg

820 825

Claims (9)

1, a kind of blast resistant gene is one of following nucleotide sequences:

1) the SEQ ID № in the sequence table: 1;

2) the SEQ ID № in the sequence table: 2;

3) SEQ ID № in the code sequence tabulation: the polynucleotide of 3 protein sequences.

2, gene according to claim 1 is characterized in that: described blast resistant gene is the SEQ ID № in the sequence table: 1 or SEQ ID №: 2.

3, gene according to claim 2 is characterized in that: the reading frame of described blast resistant gene is SEQ ID № in the sequence table: 1 SEQ ID № in 5 ' end the 3361st to the 5835th bit base or sequence table: 2 from 5 ' end the 125th to the 2599th bit base.

4, the proteins encoded of blast resistant gene, be to have SEQ ID № in the sequence table: the protein of 3 amino acid residue sequences, or with SEQ ID №: 3 amino acid residue sequence is through replacement, disappearance or the interpolation of one or several amino-acid residue and have the № with SEQ ID: 3 amino acid residue sequence is identical active by SEQ ID №: 3 deutero-protein.

5, protein according to claim 4 is characterized in that: the proteins encoded of described blast resistant gene is the SEQ ID № in the sequence table: 3.

6, according to claim 4 or 5 described protein, it is characterized in that: SEQ ID № in the described sequence table: 3 be a membrane spaning domain from aminoterminal 12-34 amino acids residue sequence; From aminoterminal 48-165 amino acids residue sequence is an allosome recognition structure territory similar to exogenous agglutinin protein; From aminoterminal 436-458 amino acids residue sequence is a membrane spaning domain; From aminoterminal 501-771 amino acids residue sequence is a serine/threonine protein kitase structural domain.

7, the expression vector that contains the described blast resistant gene of claim 1.

8, the transgenic cell line that contains the described blast resistant gene of claim 1.

9, the application of the described blast resistant gene of claim 1 in cultivating the disease-resistant plants kind.

Images