CN1821406A - Resistance gene Pi 36 of rice blast and its use - Google Patents

Abstract

The present invention discloses the nucleotide sequence, coded amino acid polypeptide sequence and application of one new rice resistance gene Pi36. The gene is member of nonTIR-NBS-LRR resistance gene family, and is one constitutive expression gene. The present invention also relates to the application of the gene in transforming rice or other plant to breed disease resisting variety and the application of the molecular marker generated based on the gene sequence in breeding variety.

Description

Resistance gene Pi 36 of rice blast and application thereof

Technical field

The present invention relates to gene engineering technology field, be specifically related to a kind of separating clone and application of resistance gene Pi 36 of rice blast.

Background technology

Plant usually is subjected to the infringement of multiple pathogen in the process of growth, plant then takes multiple defence policies to protect self, avoids being subjected to it to attack.A most important defense mechanism is exactly the defence answering system that can discern the existence of obligate pathogenic microorganism and start self in the plant.Plant is mediated by disease-resistant gene the identification of pathogenic bacteria.Therefore, the analysis of disease-resistant gene product structure and research are the bases of understanding plant disease-resistant mechanism, also have important directive significance for the prevention and the control of Plant diseases.

So far, from 3 kinds of monocotyledonss and 5 kinds of dicotyledonss, separated more than 40 disease-resistant gene.To the structure of these disease-resistant genes and discovering of product, though host plant difference, the pathogen of institute's antagonism also has fungi, bacterium, differences such as virus and nematode, but the structure of disease-resistant gene and product have many common constitutional featuress, there is rich leucine tumor-necrosis factor glycoproteins (leucine-rich repeat as the C-end, LRR), there is nucleotide binding site (nucleotide binding site in the N-end, NBS), and leucine zipper (leucine zipper, LZ), coiled coil structural domain (coiled-coil, CC), and membrane spaning domain (transmembrane domain, TM), protein kinase (protein kinase, PK), and fruit bat Toll albumen and Mammals interleukin-1 receptor (Toll andinterleukin-1 receptor, TIR) etc.According to they coded proteic constitutional featuress, disease-resistant gene can be divided into 7 classes (Hammond-Kosack ﹠amp; Jones, 1997; Dangl ﹠amp; Jones 2001; Iyer ﹠amp; McCouch2004).

The first kind, toxin reduction enzyme disease-resistant gene.As corn disease-resistant gene Hm1, it is the 1st plant disease resistance genes that quilt is cloned, and it is responsible for the resistance to fungi Cochliobolus carbonum microspecies 1.Hm1 coding separate the HC toxin that toxenzyme can the passivation pathogenic fungi be produced, and the HC toxin is the virulence factor that fungi C.carbonum microspecies 1 produce, it determines this germ can only infect some genotype of corn (Johal etc., 1992).Second class, NBS-LRR class disease-resistant gene.The nearly N end of their encoded protein is NBS, and nearly C end then is made up of LRR.As RPS2 (Bent etc., 1994), RPM1 (Grant etc., 1995), I2 (Simon etc., 1998), RPP5 (Parker etc., 1997), N (Dodd etc., 2001), L6 (Lawrence etc., 1995), Mla1 (Zhou etc., 2001), Mla6 (Halterman etc., 2001); Disease-resistant gene of paddy rice such as Xa1 (Yoshimura etc., 1998), Pib (Wang etc., 1999), Pita (Bryan etc., 2000) etc.The 3rd class, PK class disease-resistant gene.As tomato Pto gene, its product is one and is positioned at intracellular serine-threonine protein kinase enzyme, do not have LRR structural domain (Martin etc., 1993).The 4th class, LRR-TM class disease-resistant gene.Gene C f-2 (Dixon etc., 1996), Cf-4 (Thomas etc., 1997), Cf-5 (Dixon etc., 1998), the Cf-9 (Jones etc., 1994) of the different physiological strains of the anti-leaf mold of tomato, and the gene Hs1 of the anti-Cyst nematode of beet ^Ppro-1(Cai etc., 1997) etc.The 5th class, LRR-TM-PK class disease-resistant gene is representative with rice bacterial blight resistance gene Xa21 (Song etc., 1995).The 6th class is representative with the RPW8 of Arabidopis thaliana, and its encoded protein only contains complete CC and NBS structural domain (Xiao etc., 2001).The 7th class is representative with the xa5 gene of paddy rice, and its encoded protein is a transcription factor (TFIIA γ) (Iyer ﹠amp; McCouch, 2004).

The disease-resistant proteic disease-resistant gene of coding NBS-LRR class is a class disease-resistant gene maximum in the plant disease resistance genes, constructional feature according to the disease-resistant protein N terminal of NBS-LRR class, this genoid can be divided into two big class TIR-NBS-LRR (TNL) and CC-NBS-LRR (CNL) (Meyers etc., 1999 again; Pan etc., 2000; Cannon etc., 2002; Richly etc., 2002).TNL class disease-resistant gene is mainly found in dicotyledons, does not also find (Bai etc., 2002 so far in the monocotyledons genome; Meyers etc., 2002).The disease-resistant gene that in monocotyledons, identifies the at present disease-resistant albumen of CNL class of mainly encoding, also there is a large amount of CNL class disease-resistant genes in the dicotyledons, comparatively speaking, the CNL class disease-resistant gene in the monocotyledons is than more rich and varied (Cannon etc., 2002) in the dicotyledons.

Studies show that NBS, CC, TIR structural domain may participate in signal conduction (Hammond-Kosack ﹠amp; Jones 1997), although this class R albumen does not have the intrinsic kinase activity, NBS can activate kinases or G albumen, NBS has in conjunction with ATP or GTP and hydrolytic enzyme activities (Traut, 1994).The signal conduction (Jones, 1994) in the disease-resistant defense response of TIR structure possibility involved in plant downstream.Nearest evidence shows that the L family diversity of flax selects to also occur in the TIR zone, and this zone forms specificity (Luck etc., 2000) with corresponding LRR zone coevolution.The function of LRR structural domain be mainly concerned with protein-protein and with interaction (the Jones ﹠amp of part; Jones, 1996; Kajava, 1998), be product or the indirect interactional position of product (Bent, 1996 that the disease-resistant gene product is direct and the pathogenic bacteria nontoxic gene is encoded by inference; Baker etc., 1997).Jia etc. (2000) are processed as one the 176 specific exciton of amino acid whose activated protein AVR-Pita176 microspecies by yeast two-hybrid proof AVR-Pita encoded protein, be delivered to plant cytoplasm and combine with the LRD zone of Pita acceptor specifically, thus the defense response of Pita mediation in the activating cells.Av-rPita176 can not combine with LRD after the Ala among the Pita becomes Ser, thereby shows susceptible.This result has proved that directly the LRR structural domain may be exactly the zone of pathogenic bacteria identification; Mutual " gene pairs gene " relation of making to have verified from molecular level for the first time paddy rice and Pyricularia oryzae of Pita and AvrPita.

Paddy rice is one of most important food crop in the world, and it is staple food with rice that population over half is arranged approximately.(no condition: Pyricularia grisea Sacc.) rice blast that causes is that Rice Production is endangered one of severe diseases, annually all causes serious grain loss by pathogenic fungi Magnapothe grisea Barr..From the viewpoint of Sustainable development of environment protection with agricultural, breed and the utilization of disease-resistant variety is the safe and effective procedure of control rice blast.But, because the diversity and the volatility of rice blast fungus population, people lack effective utilization of antagonism gene in addition, and antagonism mechanism lacks understanding fully, so that the susceptibleization problem of disease-resistant variety not only is not resolved, and becomes thremmatology man stubborn problem the most because of the shortage of effective anti-source gene and short-livedization of disease-resistant variety on the contrary.Therefore, excavate, identify and clone disease-resistant gene and reasonably be applied to the breeding for disease resistance plan and become the preferential major issue that solves in the agri-scientific research.

Along with molecular biological fast development, so far, have at least more than 80 rice blast master to imitate resistant gene and be in the news, wherein located for 60 by molecule.At present, also not identified the rice blast master on the 3rd karyomit(e) of paddy rice imitates the resistant gene, all identified the main resistant gene site of imitating on remaining 11 karyomit(e), and contain a plurality of rice blast resistances site on the karyomit(e) that has, and the resistant gene of some gene locus is that cluster exists.It is worthy of note in the localized resistant gene of numerous quilt successes, to have only two resistant genes of resistant gene Pib and Pita successfully to be cloned, they lay respectively on the 2nd karyomit(e) and the 12nd karyomit(e) of paddy rice.Before proposing, the present patent application also do not have the report that rice blast resistance gene is cloned on paddy rice the 8th karyomit(e).

Clone's disease-resistant gene is the prerequisite to the research of paddy rice resistance mechanism, discloses the molecule mechanism of rice anti-rice blast and can control and reduce the harm of Pyricularia oryzae to paddy rice better.Simultaneously,, can control and increase the disease resistance of plant artificially, widen the anti-spectrum of plant clone's the modification and the transformation of disease-resistant gene.These aspects are that employing conventional plant breeding and improving technology institute are inaccessiable.

Summary of the invention

A rice blast resistance gene that the objective of the invention is to carry among the separating clone rice varieties Q61 and the dna fragmentation that comprises the promotor of regulating and control this gene.

Another object of the present invention provides the coded protein of above-mentioned rice blast resistance gene.

Another object of the present invention provides the above-mentioned carrier that contains above-mentioned resistant gene.

Another object of the present invention provides above-mentioned carrier transgenic plant transformed.

Another object of the present invention provides the application of above-mentioned protein in preparation resisting rice blast bacteria medicine.

Further purpose of the present invention provides molecule marker that above-mentioned resistant gene produces and rice blast is had application in the paddy rice of disease resistance in seed selection.

The present invention relates to separate and use a kind of dna fragmentation of the Pi36 of comprising gene, this fragment is given plant produces specificity (specialization) to the caused disease of Pyricularia oryzae (Magnaporthe grisea) disease resistance response.This invention is applicable to all plants to this pathogenic bacteria sensitivity.These plants comprise monocotyledons and dicotyledons.Wherein, described fragment perhaps is equivalent to the dna sequence dna shown in the SEQ ID NO:1 basically shown in sequence table SEQ ID NO:1, and perhaps its function is equivalent to the subfragment of sequence shown in the SEQ ID NO:1.A kind of NBS-LRR proteinoid of this dna sequence encoding, its aminoacid sequence such as SEQ ID NO:2 are listed, and structure is as shown in Figure 6.Dna fragmentation shown in the present is constitutive expression at the leaf tissue of paddy rice.

The Pi36 resistant gene coding NBS-LRR albumen that separates, clones.This albumen comprises two main structural domain: NBS and LRR zone, and wherein the NBS structural domain contains conservative kinase 1a:GMGGLGKTT, kinase 2a:IVIDDIWDKP and kinase 3a:GSKILVTTRK.And this proteic C-end is 13 LRR repetitions, and its leucine content is 17.0%.The nucleotide fragments of coding NBS or LRR may have independently function in the Pi36 gene.Fragment and the reorganization of other nucleic acid fragments with coding different structure territory in the Pi36 gene can constitute mosaic gene or protein, make it to have new function.The Pi36 gene is modified or transformed, can change or increase certain function of gene.For example, the LRR zone of this gene is replaced with the structural domain of other resistant genes, maybe the NBS structural domain with this gene carries out rite-directed mutagenesis, may cause the change of the anti-spectrum of the forfeiture of gene resistance or gene.

The present invention comprises that equally the primary structure part with the Pi36 resistant gene connects the upward formed mosaic gene of proper regulation sequence effectively, and comprises the plant of this gene and the seed of this kind of plant in genome.As this gene can be natural or chimeric.For example, will comprise the fragment of this gene and the promotor of a constitutive expression and be connected, this promotor can and be expressed under any condition cytocerastic any period.The promotor of this constitutive expression comprises the promotor of cauliflower mosaic virus 35S etc.On the other hand, also promotor that can the promotor of this gene and a tissue specific expression or developmental stage is specific expressed or accurately the promotor of environmental induction be connected, these promotors are referred to as inducible promoter.Like this, the change of environment, the difference of developmental stage can change this expression of gene, and is same, also this expression of gene can be limited in some tissues, makes by this gene induced disease resistance response and obtains artificial control.Wherein envrionment conditions comprises attack, anaerobic condition and the light etc. of pathogenic bacteria, and tissue and developmental stage comprise leaf, fruit, seed and flower etc.

According to Pi36 gene order information provided by the invention (SEQ ID NO:1), those skilled in the art can easily obtain the gene that is equal to Pi36 by the following method: (1) obtains by database retrieval; (2) with the Pi36 gene fragment be genomic library or the acquisition of cDNA library of probe Screening of Rice or other plant; (3) according to Pi36 gene order information design oligonucleotides primer, from genome, mRNA and the cDNA of paddy rice or other plant, obtain with the method for pcr amplification; (4) on the basis of Pi36 gene order, obtain with the gene engineering method transformation; (5) method with chemosynthesis obtains this gene.

Rice blast resistance gene Pi36 provided by the invention has important use and is worth.One of application is that described Pi36 gene order is connected to any plant conversion carrier, with any method for transformation the Pi36 disease-resistant gene is imported paddy rice or other plant cell, can obtain the transgenosis disease-resistant variety of expressing said gene, thereby be applied to produce.Of the present invention gene constructed in plant conversion carrier, can suitably modify described gene or its regulating and controlling sequence, also can before its transcription initiation codon, replace the original promotor of described gene, thereby widen and strengthen the resistance of plant pathogenic bacteria with other promotor.

The Another application of resistant gene provided by the invention is to produce specific molecule marker according to described gene order information, includes but not limited to SNP (mononucleotide polymorphic), SSR (simple sequence repeats polymorphic), RFLP (restriction enzyme length is polymorphic), CAP (the cutting amplified fragments is polymorphic).Can identify the resistant gene type of paddy rice or other plant with these marks, be used for the molecular marker assisted selection breeding, thereby improve the efficiency of selection of breeding.

The present invention has following beneficial effect: change clone's disease-resistant gene over to susceptible plant, help to produce new disease-resistant plants.Particularly can be with transformation technology a plurality of disease-resistant genes that in plant, add up, and can not produce the chain problem of bad gene in the genome of following appearance in the traditional breeding technology, and can shorten breeding time.The clone of disease-resistant gene overcomes the prerequisite that can not shift the problem of disease-resistant gene in the traditional breeding method between plant species.In addition, disease-resistant transfer-gen plant that the present invention can further provide or the above-mentioned dna fragmentation of applications exploiting obtains and corresponding seed, and with gene of the present invention or based on the recombinant chou plants transformed of this gene or the seed that obtains by this class plant.Can gene of the present invention be changed over to other plant with the mode of sexual hybridization.

Description of drawings

Fig. 1 is the map based cloning synoptic diagram of resistance gene Pi 36 of rice blast;

Fig. 2. be the high-res genetic map and the electronics physical map of resistance gene Pi 36 of rice blast;

Fig. 3 is the PCR (3a) and Southern (3b) the detected result figure of selective marker hygromycin gene of the partial resistance transformant of resistance gene Pi 36 of rice blast;

Fig. 4 is that the resistance of resistance gene Pi 36 of rice blast transformed plant is identified figure;

Fig. 5 is the gene structure figure of resistance gene Pi 36 of rice blast;

Fig. 6 is a resistance gene Pi 36 of rice blast amino acids coding peptide sequence structure iron;

Fig. 7 is that the RT-PCR of resistance gene Pi 36 of rice blast and allelotrope pi36 expression characterization thereof detects figure;

The Pi36 loci gene type that Fig. 8 identifies parent and disease plant for molecule marker CRG3 is figure as a result;

Wherein, A is the high-res genetic map in Pi36 site among Fig. 2, and sea line is represented chromosomal region, and the top is mark/resistant gene, and the below numeral is the genetic distance (cM) between mark; B is the BAC/PAC clone electronics contig of Pi36 site areas, and sea line is represented the BAC/PAC clone, and vertical line is represented the landing position of linked marker; C is the electronics physical map in Pi36 site, and bracket inner digital is the recombinant chou number of each marker site, and sea line is represented genome area, and the below numeral is the physical distance (kb) between mark.

Swimming lane 1-8 is the pcr amplification product of hygromycin gene of the conversion seedling of resistance gene Pi 36 among Fig. 3; Swimming lane 9 is the PCR product of the hygromycin gene of carrier pCAMBIA1300 plasmid; Swimming lane 10 is the non-transformant of acceptor Q1063; M is molecular weight marker DL2000; The arrow indication is the part fragment 760bp of Hpt gene.

Green square box is represented the exon of resistance gene Pi 36 among Fig. 5, and the square box of band oblique line is respectively 5 ' and 3 ' non-translational region, and straight line is then represented intron.

Underlined letter is for forming 6 zones of inferring NBS among Fig. 6; The 590th amino-acid residue reflected the difference of protein sequence between the anti-sense of Pi36 allelotrope, is aspartic acid in susceptible allelotrope pi36; The amino-acid residue that independently list the lower section is the terminal LRR of C-zone.

A is that disease-resistant variety Q61 is before inoculation and the expression conditions of inoculation back 6,12,24,48,72h among Fig. 7; Actin is an internal reference; B is susceptible variety Q13, i.e. LTH is before inoculation and the expression conditions of inoculation back 6,12,24,48,72h; Actin is an internal reference.

P1 is disease-resistant parent Q61 among Fig. 8; P2 is that susceptible parent likes to know the rising sun; S1-S5, S6 and S7 are F ₂Disease plant, gene pi36pi36; R1 is F ₂Disease-resistant plant, genotype are Pi36pi36; Banding pattern before undigest:2 parent enzyme cut; M: molecular weight marker DL2000; The arrow indication is mark CRG3.

Embodiment

Embodiment 1: the genetic analysis of resistance gene Pi 36 of rice blast and Primary Location

As Fig. 1, the present invention utilizes the map based cloning method to clone resistance gene Pi 36.At first, in order to excavate and identify the rice blast new resistance gene, long-grained nonglutinous rice disease-resistant variety Q61 and japonica rice susceptible variety are liked to know the rising sun and Lijiang xintuanheigu (Lijiangxintuanheigu, LTH) F of 2 cross combination origin ₂(the F of colony ₂-1 and F ₂-2), inoculation is to the bacterial strain CHL39 of the clearly demarcated non-affinity/compatible host response of parents' kind performance.The result shows, these 2 F ₂Disease-resistant plant and disease plant separates than meeting 3: 1 in the colony.Infer that thus the resistance to inoculating strain CHL39 that Q61 showed is controlled by a pair of dominant gene.

In order to determine main chromosome position of imitating resistant gene apace, made up by 40 disease-resistant individualities and 580 F that susceptible individual is formed ₂For mapping population, and utilize randomly amplified polymorphic DNA (randomamplified polymorphic DNA, RAPD) labeling technique, in conjunction with based on population mixture compartment analysis method (bulked-segregant analysis, BSA) (recessive-class analysis RCA), has screened 1200 random primers to recessive population analysis method altogether, 3 marks that polymorphism is good have been obtained, BA1126 ₅₅₀, BA253 ₄₅₀And OPP09 ₁₈₀₀Because these 3 marks all are positioned at a side in this site, and BA1126 ₅₅₀Repeated best, so, this mark is cloned and is checked order.The reference sequences Japanese fine by flag sequence and order-checking kind carries out homology relatively, and this mark is landed on paddy rice the 8th karyomit(e).For the result who confirms that RAPD analyzes, we have quoted 4 sequence tagged site (sequencetagged site from public database, STS) mark, S5014, C30376, E60275 and C61344, and 3 little satellites (simple sequence repeats, SSR) mark, RM8018, RM1374 and RM5647 utilize the susceptible F of 580 plant height degree ₂Individuality has carried out linkage analysis.The result shows that this resistant gene site is positioned on the 8th chromosomal galianconism, the zone of 5.8cM between the mark RM8018-RM5647.Because the position of oriented 4 rice blast resistance genes is different on this zone and the 8th karyomit(e), therefore, is Pi36 with this new unnamed gene.

Embodiment 2: the Fine Mapping of rice blast new resistance gene Pi36 and electronics physical mapping

In order to determine the position in Pi36 site subtly, we utilize the reference sequences in the public database, developed the mark of 5 polymorphisms, 1 STS mark R36STS2 and 4 candidate resistance gene (candidateresistance gene, CRG) mark, CRG1, CRG2, CRG3 and CRG4, and to the susceptible F of 580 plant height degree ₂Individuality has carried out linkage analysis.The result shows, the Pi36 site is by the zone of Fine Mapping 0.6cM between CRG2-RM5647, and with mark CRG3 and CRG4 be divided into fully from.In order to make up the physical map in this site, we utilize fine bacterial artificial chromosome (the bacterialartificial chromosome with reference to kind Japan, BAC) and artificial chromosome (the P1-derived artificialchromosome of P1 mediation, PAC) clone, by bioinformatic analysis (bioinformatics analysis, BIA), made up the electronics physical map in this site.The result shows, the Pi36 site by physical positioning in the zone of about 17kb.

Embodiment 3: the prediction note and the sequential analysis of rice blast new resistance gene Pi36 candidate gene

In order to determine the candidate gene of Pi36, we utilize the fine reference sequences of Japan, by 3 kinds of predictive genes software RiceGAAS (http://ricegaas.dna.affrc.go.jp), Gramene (http: // 143.48.220.116/resources/) and the FGENESH (http://www.softberry.com) of Softberry predictive genes and note analysis have been carried out in the goal gene zone, the candidate resistance gene of tentatively having determined Pi36 is Pi36-1, Pi36-2 and Pi36-3, and wherein Pi36-3 has comprised Pi36-1 and Pi36-2.Therefore, with Pi36-3 by following its function of functional complementation experimental verification.

Embodiment 4: the conversion of rice blast new resistance gene Pi36 and the resistance of transformant are identified

Utilize long segment PCR (long-range PCR, LR-PCR) technology increased one the 16.0kb that contains Pi36 fragment and be cloned into binary vector transformation system pCAMBIA1300, imported agrobacterium strains EHA105.Will height susceptible variety Q1063 mature seed evoked callus on inducing culture.The EHA105 that contains the goal gene conversion carrier was cultivated 1 day for 28 ℃ at the YM nutrient agar, be collected in the MB liquid nutrient medium of the Syringylethanone that contains 100 μ mol/L.The rice callus tissue was immersed bacterium liquid 20 minutes, blot and transfer to the MB nutrient agar behind the bacterium liquid and cultivate.Shift callus to the culture medium culturing that contains the 50mg/L Totomycin, subculture was 1 time in per 14 days, subculture 2 times.Behind the resistance screening, change regeneration culture medium over to and differentiate the conversion seedling, obtained 274 strain transformant.

CRG3 has carried out the PCR-CAPS detection to transformant with the CRG mark.2 primers have been used in this experiment, and wherein, primer CRG3F is: gctagcaagcatggagttcgt-3 ', primer CRG3R is: 3 '-agcgggtaaggtagcataggt.The step of pcr amplification is: 94 ℃ of pre-sex change 4min; Next be 30 circulations, cycling program is as follows: 94 ℃ of sex change 30sec, and 60 ℃ of annealing 30sec, 72 ℃ are extended 2min; Last 72 ℃ are extended 7min, and temperature drops to 4 ℃ and promptly finishes amplification.Amplified production carries out enzyme with restriction enzyme HigfI to be cut, and system is 10 * enzyme cutting buffering liquid, 2 μ l, PCR product 8 μ l, and restriction enzyme HinfI10U adds two aqua sterilisa to 20 μ l that steam.

Simultaneously, the PCR and the Southern blot evaluation (Fig. 3) of hygromycin gene transformed plant have been carried out.Detected result proof order gene fragment has imported these transformant.The resistance qualification result shows that resistance gene Pi 36 has showed the identical resistance with resistant gene donor Q61 under susceptible variety Q1063 genetic background, shows that resistance gene Pi 36 successfully cloned (Fig. 4).

The structure of embodiment 5:Pi36 gene

The employing method of moving one's steps is measured the dna sequence dna of Pi36.Utilize 5 ' and 3 ' RACE reaction, obtained the full-length cDNA of Pi36 and it is checked order.Sequence 1 and 2 in the sequence table is respectively DNA and the cDNA sequence of Pi36.Pi36 gene DNA length is 16.0kb, and its full-length cDNA is 3963bp, contains the opening code-reading frame of a 3171bp, and 5 ' and 3 ' non-translational region is respectively 65bp and 726bp.By icp gene group DNA and cDNA, find that the opening code-reading frame of this gene contains 4 introns and 5 exons, and 3 ' non-translational region contains 1 intron (Fig. 5).

The structure of embodiment 6:Pi36 resistance protein

The protein sequence of Pi36 genes encoding is shown in SEQ ID NO:2 in the sequence table.1 protein polypeptide of forming by 1056 amino-acid residues of resistance gene Pi 36 coding, molecular weight is 120KD, iso-electric point is 6.61.Utilize 14-45 amino-acid residue of this protein polypeptide of COIL analysis revealed to have 95% possibility to be CC (coil-coil) structural domain.Pi36 albumen belongs to NBS-LRR albumen, and conservative kinase 1a (GMGGLGKTT) is positioned at the 206th amino-acid residue of this polypeptide in the NBS structural domain; Kinase2 (IVIDDIWDKP) is positioned at the 286th amino-acid residue of this polypeptide; Kinase 3a (GSKILVTTRK) is positioned at the 310th amino-acid residue of this polypeptide.And the 581-921 of this a proteic C-end amino-acid residue is 13 LRR repetitions, and its leucine content is 17.0%.

The database comparative analysis finds that coding proteic nucleotide sequence of Pi36 and barley powdery mildew resistant gene Mla1 and Mla6 have 40% and 37% homology respectively, have 30%, 27% and 24% homology respectively with resistance gene of rice blast Pib, Pita and paddy rice bacterial leaf spot resistant gene Xa1.

Embodiment 7:Pi36 expression of gene specificity analysis

With RT-PCR Pi36 expression of gene pattern is analyzed.From the blade of disease-resistant variety Q61 and susceptible variety LTH, extract total RNA, utilize reverse transcription test kit SuperScript ^TMReverseTranscriptase II carries out the synthetic of reverse transcription cDNA article one chain.The RT-PCR primer is R36RT F:CGAGCTGCTGAAGGAGAAGT; R36RT R:AGCTCATCCCTTGGCTCATC.The PCR reaction is: 94 ℃ of pre-sex change 4min; Next be 35 circulations, cycling program is as follows: 94 ℃ of sex change 30sec, and 56 ℃ of annealing 30sec, 72 ℃ are extended 1.5min; Last 72 ℃ are extended 7min, and temperature drops to 4 ℃ and promptly finishes amplification.

Experimental result shows, the RNA reverse transcription template of the leaf tissue before and after the inoculation of resistant variety and susceptible variety all can amplify special fragment, illustrate that Pi36 and allelotrope pi36 thereof all can express in leaf tissue, promptly belong to the gene (Fig. 7) of constitutive expression.

Embodiment 8: transform the application of the resistant variety of Pi36 gene generation

The Pi36 gene clone to plant conversion carrier pCAMBIA1300, is imported agrobacterium strains EHA105, be used to transform susceptible rice varieties, obtained 274 strain transformed plants.T with the transformant generation ₁Evaluation is sowed, sprouts and inoculated to seed, finds wherein to have 35 to transform (the T of system ₁) the performance resistance separates, and the resistance of transformed plant and Pi36 gene be divided into from.This explanation can be used Pi36 gene transformation paddy rice susceptible variety, is used for producing.

The application of embodiment 9:Pi36 gene order in the molecular marker assisted selection breeding

Utilize Pi36 gene order information provided by the invention can produce molecule marker, be used to identify that the range gene type that has on the Pi36 site is the plant of Pi36Pi36, Pi36pi36 and pi36pi36, can in the molecular marker assisted selection breeding process, be applied.

Resistance gene Pi 36 of rice blast and application sequence table thereof

SEQUENCE?LISTING

＜110〉Agricultural University Of South China

＜120〉resistance gene Pi 36 of rice blast and application thereof

<130>

<160>2

<170>PatentIn?version?3.2

<210>1

<211>14450

<212>DNA

＜213〉Oryza paddy rice (Orysa sativa L.)

<220>

<221>5’UTR

<222>(2489)..(2553)

<220>

<221>exon

<222>(2554)..(2972)

<220>

<221>gene

<222>(2554)..(11611)

<220>

<221>Intron

<222>(2973)..(3405)

<220>

<221>exon

<222>(3406)..(3834)

<220>

<221>Intron

<222>(3835)..(8904)

<220>

<221>exon

<222>(8905)..(10943)

<220>

<221>Intron

<222>(10944)..(11067)

<220>

<221>exon

<222>(11068)..(11334)

<220>

<221>Intron

<222>(11335)..(11593)

<220>

<221>exon

<222>(11594)..(11611)

<220>

<221>3’UTR

<222>(11612)..(11780)

<220>

<221>Intron

<222>(11781)..(11903)

<220>

<221>3’UTR

<222>(11904)..(12459)

<400>1

Resistance gene Pi 36 of rice blast and application sequence table thereof

cttcgacacg?caaacgtgca?cacagccacc?tatcgtgacc?tcctcagcct?ccacgcatcc 60

gtacgtcctc?tagtgcagcc?actaaactgt?aagtccaagt?tctaaattgt?aaccgacttt 120

gtacatatat?tcgatacaaa?ctctaacaat?atcttcacta?accctatctt?agccgaataa 180

caactaaaat?tttttctatt?caaacatagc?taaaccatgg?ttaacaaata?caacaatcct 240

aacaaccaca?taaggtaaca?gttggaatcg?aacgctatat?tgttacaaca?ctgatacatt 300

tgtcgtgcac?aggtagcttg?aaatttgcac?aagtcacgaa?tattgtcgtc?aaacggagat 360

agaacaaatc?ctgcaagaag?ctctggtaca?ctttaaaatg?accgctctag?tcctcaaaat 420

ccagagatct?cctacaaagc?aattttagga?tacggctcgt?ttaaattgta?aaagatgtat 480

tgtgtaattt?caacagactt?gacgatgcac?atgctgattt?ttaagagctt?accattgtcc 540

actttaatgc?acctggacca?cggtcggttt?cacagttcgc?cgcaccaacc?ggttccggaa 600

ggtgagcgtg?ctggctgctg?agaagaaaaa?tagcttccca?acgtggcttc?aattaggggg 660

tgtttaggag?agagggactt?accaaacacc?cccttaatca?acgtgtggct?gtcttttcag 720

atgacccttt?tcctaagccc?tctctctcat?ttttcacaag?cacatttttc?aaattgttaa 780

acggtgtatt?tttttaaaaa?aaaagtttat?atactaaagt?tgcttaaaaa?attaaattaa 840

ttatttttta?aaaaaatagc?aaatgtttaa?ttaattacgt?tctattggac?cgtttcggtt 900

ttcgtaggta?ccatgcacct?ccccatccga?ctgtagcgaa?catcttccca?tccggctgta 960

gcgatcacac?ccagagggtc?tcatgtgacg?cgttcgaggt?ggagccaacg?gcgtcttaca 1020

agttgagtaa?cttgagtgat?aaacacagta?ttgcctacca?cgcgttttga?aacttaatta 1080

cacgtgtttt?cgccctcttg?ttatgttcat?gctccaatgg?aaacaaacaa?atcggatata 1140

acacttcaat?cctgaggcag?gattttgtat?gcaaaatggt?actatactca?gataaatggc 1200

tcatcaatta?taatgatggg?tttacaatta?caaatgaaga?tatttaagca?acttaattta 1260

ttcattctag?ttgcataggt?ctagaactcg?ttgcatttgg?agtgagatgg?agtaaatatt 1320

atttcacatt?ttgtcaattc?aaacatttac?acgttttaat?gttttttcga?gaatggatgg 1380

cgtgagctcc?gataagagta?ctataagatt?ataaaccagc?tataaacata?ttttaagaaa 1440

ataaaagagg?agagataaga?gcaacggatt?ataaatttat?agccagctgc?agcatagact 1500

ccaagataca?tgtgtgtatg?ataggtgaga?tcaaacatta?atcatatagt?acatgtttat 1560

agataactat?tgtatgaatt?gactttagaa?gatttggagc?caatagttga?atatactact 1620

cccttctttc?caaattaatc?atcatgtaag?aataggtaca?acagcagatt?attagccagc 1680

tataaacata?ttttaatgag?ataaaagatg?agagagaaga?gcagcaggct?atagatctgt 1740

agccagctat?aacacggact?ccaagacgca?atgggtgtat?gacatgtggg?accatatatt 1800

aatagtataa?taagcaacta?ttgtatgaat?tggctattag?atcggctata?gatgaattgg 1860

agctagtagt?gggctatact?agtaaacttg?ctctaataga?atttaaaatt?tttcaaattg 1920

gtcattatat?aactgcatgg?acacggattt?catcggaata?caattaatac?agtatgagag 1980

aatatgtgta?tgctagggtg?taattgacat?gaggttttaa?ttgagtatag?gagaatgtgt 2040

gtatgttgtc?ttgattgatg?tgatttaaat?tgtcattggt?cttggtgcat?aaaattatac 2100

tccctccgtt?ccataatata?aggcacaact?atttttttta?tgttccataa?tataaggcat 2160

acatgcatgt?atacaattaa?ttaggacatc?ttctccatta?aattattatt?tttttaaatc 2220

attcactctc?aagatctcta?aatttattgg?atgcatgcat?gtattatatt?tattaggatg 2280

Resistance gene Pi 36 of rice blast and application sequence table thereof

atccaaatta?gaaaataata?ataattgttt?cttgaaaaag?tggttgtacc?ttatattttg 2340

gaacatatgg?agtatgatga?ttaatttggg?aaggagggag?tattaaactt?gctctaaccc 2400

aattgtgaca?agtccattaa?ttaacctatc?agctagtagg?ctagtagttg?cacatatata 2460

caggagtgca?atgtatctgc?tcctacccag?ctaccaaccc?agcaatacca?tccactcaac 2520

tcaagtcaag?tcaaccacag?ctagctagca?agc?atg?gag?ttc?gtc?act?ggg?gcg 2574

Met?Glu?Phe?Val?Thr?Gly?Ala

1 5

atg?agt?agc?ctg?atc?ccc?aag?ctg?ggc?gag?ctg?ctg?aag?gag?aag?tac 2622

Met?Ser?Ser?Leu?Ile?Pro?Lys?Leu?Gly?Glu?Leu?Leu?Lys?Glu?Lys?Tyr

10 15 20

aat?ctg?cag?aag?aac?ata?agg?ggg?aag?atc?gag?tct?ctc?tcg?gcg?gag 2670

Asn?Leu?Gln?Lys?Asn?Ile?Arg?Gly?Lys?Ile?Glu?Ser?Leu?Ser?Ala?Glu

25 30 35

ctc?cgg?cga?gcg?caa?gcc?gtc?ctc?cgc?atg?gtc?ggc?gag?gtg?cca?caa 2718

Leu?Arg?Arg?Ala?Gln?Ala?Val?Leu?Arg?Met?Val?Gly?Glu?Val?Pro?Gln

40 45 50 55

gac?cag?cag?aac?gag?ctg?gtg?aag?ctc?tgg?gcg?agc?gac?ctc?agg?gag 2766

Asp?Gln?Gln?Ash?Glu?Leu?Val?Lys?Leu?Trp?Ala?Ser?Asp?Leu?Arg?Glu

60 65 70

gcg?tcc?tac?gac?atg?gag?gat?atc?atc?gac?gcc?ttc?ttg?gtt?cat?gtc 2814

Ala?Ser?Tyr?Asp?Met?Glu?Asp?Ile?Ile?Asp?Ala?Phe?Leu?Val?His?Val

75 80 85

gac?gac?gat?ggc?ccc?aag?cca?gcc?gac?cca?cat?gtg?ctc?agg?cgc?ctc 2862

Asp?Asp?Asp?Gly?Pro?Lys?Pro?Ala?Asp?Pro?His?Val?Leu?Arg?Arg?Leu

90 95 100

ggc?aag?cag?gtg?aag?aaa?ctg?ttc?aag?aag?acc?aag?cat?cgc?gtc?acc 2910

Gly?Lys?Gln?Val?Lys?Lys?Leu?Phe?Lys?Lys?Thr?Lys?His?Arg?Val?Thr

105 110 115

atc?gcg?gac?gca?atc?caa?gaa?atg?gaa?aag?aag?ctc?ctg?gag?att?gat 2958

Ile?Ala?Asp?Ala?Ile?Gln?Glu?Met?Glu?Lys?Lys?Leu?Leu?Glu?Ile?Asp

120 125 130 135

gca?agg?cat?ggc?ag gtatggaaaa?tatttactcc?ctccgtccca?aaaaaaattc 3012

Ala?Arg?His?Gly?Arg

aatttctaag?tttccgtatc?caacatttga?ttgtccgtct?tatatgaaat?ttttctatga 3072

ttagtatttt?tattgttgtt?agatgataaa?acataaataa?tactttatgc?gtgcgtgatt 3132

tatcttttta?ttttttttat?aattttttca?aataagacgg?acggtcaaac?gttgaacacg 3192

gaaacccaaa?aattgagtta?ttttaagacg?aagggagtaa?tatggaagaa?atcttaataa 3252

tatgttgtat?tatattgcat?tatattgatc?tgtcatgagg?tacatacata?tatagtacga 3312

gttatagctg?atttatctca?agaattctat?ttcttgtagt?cttacattcg?tcatctcttg 3372

atgttgtctc?ttgactctca?tctattacta?cag?a?tac?cca?gtt?gat?aac?ata 3424

Tyr?Pro?Val?Asp?Asn?Ile

145

gtt?atc?cct?gca?cgt?ccg?acg?cct?att?gat?cct?cgc?atc?cta?aat?att 3472

Val?Ile?Pro?Ala?Arg?Pro?Thr?Pro?Ile?Asp?Pro?Arg?Ile?Leu?Ash?Ile

150 155 160

gag?aaa?atg?gca?aac?aat?ctt?gtt?ggc?att?gat?gag?cca?agg?gat?gag 3520

Glu?Lys?Met?Ala?Asn?Asn?Leu?Val?Gly?Ile?Asp?Glu?Pro?Arg?Asp?Glu

165 170 175

ctt?att?aag?atg?ttg?tca?caa?cat?gag?cgt?gac?aac?aat?ctt?aat?acg 3568

Leu?Ile?Lys?Met?Leu?Ser?Gln?His?Glu?Arg?Asp?Asn?Asn?Leu?Asn?Thr

Resistance gene Pi 36 of rice blast and application sequence table thereof

180 185 190

tcc?aat?agg?aag?aca?aag?ata?gta?tac?gtc?gtt?gga?atg?ggt?ggt?ctg 3616

Ser?Asn?Arg?Lys?Thr?Lys?Ile?Val?Tyr?Val?Val?Gly?Met?Gly?Gly?Leu

195 200 205 210

ggc?aaa?acc?acc?ctt?gcc?aca?gca?gta?tat?gag?aag?att?aaa?gtg?ggt 3664

Gly?Lys?Thr?Thr?Leu?Ala?Thr?Ala?Val?Tyr?Glu?Lys?Ile?Lys?Val?Gly

215 220 225

ttt?cct?ttg?aat?gct?ttt?gtt?cca?atc?ggt?caa?aat?cct?aat?atg?aag 3712

Phe?Pro?Leu?Asn?Ala?Phe?Val?Pro?Ile?Gly?Gln?Asn?Pro?Asn?Met?Lys

230 235 240

gca?atc?ttg?tgg?aac?att?ctt?cat?cgc?ctt?ggc?tcg?gag?aag?tac?ctg 3760

Ala?Ile?Leu?Trp?Asn?Ile?Leu?His?Arg?Leu?Gly?Ser?Glu?Lys?Tyr?Leu

245 250 255

aat?tgt?cca?aat?att?gag?atg?ttg?act?gta?cag?gag?ctc?atc?ggt?gaa 3808

Asn?Cys?Pro?Asn?Ile?Glu?Met?Leu?Thr?Val?Gln?Glu?Leu?Ile?Gly?Glu

260 265 270

ctc?aag?caa?ttc?atc?aag?gga?aag?ag?gtatgaatat?gacgacccac 3854

Leu?Lys?Gln?Phe?Ile?Lys?Gly?Lys?Ser

275 280

caaatttgtt?tttatatact?acctcttttt?cttaataaat?cacgccattg?acttttgaaa 3914

taacgtttga?ccttcaaaaa?tttagtgtaa?atatgctcaa?gtataagtca?taccttaaag 3974

tttctttaat?aataaaacaa?gtcacaacaa?aataaatagc?atttatataa?tttgtttgaa 4034

tatgactaat?ggttaaacgt?catatcaaaa?gtcaacatct?tctgttagaa?tacagaggga 4094

gtatatgtcc?ataacctatg?ctaccttacc?cgcttatgaa?tgaatatttg?cgctacacac 4154

aatcatagtc?ttaaagctat?ttaatttgtc?tttgcgcttg?ctatttgaaa?aaaaaatgat 4214

gtacctcttt?ttaatcgatc?acagtaatag?tccgggttta?cccgttcttt?aggctccact 4274

tacatcatga?gcaagctaaa?aatcgtgatc?aagatattaa?acctaaaatg?accttgatgt 4334

cacctagagg?ggtgtccatg?gagcgactcc?tcggacagcg?aggagtggag?acccctcccc 4394

gagtttgaag?attcagccag?ggggttagca?gtgcaagacg?atagaaaaag?ccaaacagag 4454

aaaagatttg?tggggcctga?tctccccgcc?aagcaaaagt?caccagagtt?tatacaggtt 4514

caagccaccc?ggaggtgtaa?caccctactc?ccgtgttggt?tttgttgttt?ttcttatatc 4574

agcttagaac?aagggatgcc?tttttgggct?acagacaaga?agttctgatc?caaaaaatcc 4634

aactcttcat?ccgtagcttg?tccccttcct?tttatagatc?aaggatgggc?tcacaattct 4694

acaaatctac?ttccttgtct?tgtctatcag?ctgtcttgtc?aatgcctgtt?ggttccctca 4754

cacagtcttc?gagtaaccca?ctgacatttg?aagcttgcat?tgcccccaag?cacccgggct 4814

tctgtccgag?acagctgggt?cgtgccagca?tgttcaccat?gtggcgagtg?gtgggcctgg 4874

tgagacccga?cctgcctgaa?acagcaccac?ggtttcgttt?ctacccgttt?ggctaaatca 4934

ggcagcatgg?ggcatgtgcg?acacgtgtcc?aagatgccac?tggttctaat?gactcagtga 4994

tggtgccttg?tccacatcct?ttcagctcca?gactagctgg?ggctccccca?taaacctgtt 5054

taatttatgg?cggagaggac?tacttcacaa?cagcccgtgg?agcacgccca?acaccccagc 5114

tggtcctgag?gtcgcgccct?tgcacattta?tggagatagt?ttagctattc?ttacacaagc 5174

ttcttgaaga?tatcttagat?aatatctaat?gtttcgacag?agacattcct?ccttaatcaa 5234

gggacgtaac?ctacatgcag?acaaaggtga?gcaagctaac?aaggcaagca?aaaggggata 5294

tcggcaaaag?tagttaatgg?gttttcacaa?acaacaacta?aactactagt?tgcaccaaat 5354

Resistance gene Pi 36 of rice blast and application sequence table thereof

agcaaaactg?gaggagtgag?agagagagat?accaccggga?ttcttgcaaa?ctgatatgtt 5414

actgaatcta?ctctccgttg?aggagctcac?aatgatatat?atatatacat?atatatatat 5474

atatatacat?atatatacat?atacatatat?atatacatac?atatacatac?atacatacat 5534

acatacatac?atacatacat?atatacatac?atacatacat?acatacatac?atacatacat 5594

acatacatac?atacatacat?acatacatac?atacatacat?acatacatac?atacatacat 5654

acatacacac?acacatacat?acatacatac?atacatacat?acatacatat?atatatacat 5714

acatacatac?atacatacat?acatacatac?atacatacat?acatacatac?atatatatac 5774

atacatacat?acatatatat?atatacatac?atacatatat?gtatacatac?atatatatat 5834

aatgtttcga?cactcttcgt?tgtagaggaa?tgtaaaactc?acaaggagta?aggtgtgccc 5894

gggtcctagg?acgaggccgg?acataggcat?acctcagttt?atctcttaat?catatgtctc 5954

caccctccac?cccttgtaga?aagtgtgacc?tatgaagatt?aaggtaagcc?caggacccag 6014

gtcaaggccg?tgtctgaggc?aaaccttagc?ttattcttct?taagatgtat?atcttgtagg 6074

tctctacgct?cgtctacgta?ggacttacaa?ggactaaggt?gagcccgaga?cccaggacaa 6134

gacagggtcc?gaggcatacc?ttaggctaca?ttcttaagat?gtagatttta?tacgtctcca 6194

cactcctctt?ctcagagcaa?tgtgtgactt?gtgcggacta?aggtgagccc?gagacccagg 6254

ataaggccga?gtctgaggca?taccttagtt?tattcccttt?aagatgtaga?tcttgtaggt 6314

ctctacgctc?ctctcaccga?gtctgaggca?cacgttacat?tettaagatg?tacttcagtg 6374

gacctgggtc?ccgaagcgga?actaggccta?ggaccaacct?tattactcag?agttttaagt 6434

cgttgtactt?ttgacatgca?tcattccccc?ttaatcaagg?ggagtaacct?acatgcagac 6494

aaaggtgggc?ccgggaccaa?ccaaggtggg?tccctagtga?cataacccta?tttttaagga 6554

tggtttaagc?atgccattta?tcttatttat?aattgttttg?ctgggggaaa?tgggtagcct 6614

aattcccatt?tcaccgacaa?ggggggtaaa?taagcgttta?taacttttat?gtaaatgtgg 6674

aggctaaaca?tttcagatat?tccaaaatat?ttttggatat?tctaggatat?tttcagatat 6734

tccgaaaatc?tcaggttttc?gagcaagcta?acaaggcaag?caaaggggat?atcggcaaaa 6794

gtagttaatg?ggtttgcaca?aacaacgact?aaactactag?ctgcaccaaa?tagcaaaact 6854

agaggagtga?gagagagaga?taccaccgag?attgttgcaa?actgatatgt?tactgaatct 6914

acactccgtt?gaggagttca?caatgagcca?agtcttttcc?aaccctatcc?tcgtgaagtt 6974

gcataaatgc?actcatcttt?tcattaaggg?tatctcttcc?ctttcagagg?tgagatctga 7034

ccttcacaaa?ctccctcggc?acaccaccta?caaatcgatg?tctcgaggtc?aactcctagc 7094

cgtccaggta?tcctcaacca?ccaagagtta?caaatgcaac?aaagatttct?tggggatgaa 7154

tcgactgctc?gacaaatctt?cacgaaatca?acaccaagca?ctcaaataaa?ctcaaatcaa 7214

ccactcacac?atacacgaaa?tccgagatgg?aagatcggtg?gagagtaggg?atggcaattt 7274

gacccgattg?tccgtttacc?catgggtaaa?aaccctaata?gagttgggtt?tgttctacat 7334

ttagtatcca?tgggtttctt?attgggtcaa?aacctgtacc?caatgggcaa?gcgggcatgg 7394

gcatgggtac?ccatgcccgc?ttcgcccatt?tacccgcgaa?aaacaactga?catgtgggcc 7454

ctcaatcaac?ttaatataaa?aagcaccatc?taattctagg?gttttcttcc?tttcctccac 7514

agccgctact?ccttctcttc?ccctttcctc?tacagctacc?actcctcttc?ctccacagac 7574

Resistance gene Pi 36 of rice blast and application sequence table thereof

catagccacc?actccaggct?gccaaggcgc?caggctgaca?cgggacagcc?ggacgagagg 7634

ggcgcgcaat?tcgccaccac?ctcccacctc?cgctcgtcgc?tggcggcccc?accctccagc 7694

cgacgacttt?catagcggcc?acgggggagg?gggggcaacc?aaggaagctg?cgaccgccgt 7754

cgccttctac?cccgtctgcg?ccgagctcct?ctccaaccag?tcgtcgatgt?cctctagcca 7814

tcggccgcca?gcccgccaca?ccttcctcca?gtcgcgcctc?ccacctccgg?tcgccgccgc 7874

ttcctccaga?cgcgcctccc?acctctggtt?cccagatgtg?acgggtaaac?gggcatgcct 7934

gcgggcacat?ggcgcctacg?ggggacgggc?attggaagtg?ctccttgccc?atcatgtagt 7994

aacgggcatg?cccgcggaca?tgaattacct?cgcggacacg?ggatgggtag?tcactacccg 8054

tgcccgttgt?gcccgactgc?catccctagt?ggaaagtaag?aagtgagagg?gcaaggctca 8114

aagtgaatct?caaatcaaca?caagcaaggg?gcacaagaaa?gcaatggagc?gagcaatctt 8174

gacttggggt?ggagggggtt?atttataacc?acaacctcaa?atctgattgt?tggaggcaaa 8234

tcaagattca?actttttgaa?aaattttgaa?aaccattttt?ggacaagtct?gaaaaacaca 8294

agaaagcaat?ttcatttgag?caaccatttt?ccgaatttcc?aaaaaaattt?cggaattatt 8354

ttcggaagtt?gctacaatac?ttttggaaat?tccaaaaagt?ataaattaca?gcacaaactc 8414

agcaaaaaaa?aggaaaaata?acatttcaga?aattctgaaa?atatttcgaa?aaaatctgaa 8474

atcaccagag?agctttttca?caaattttat?cattttggaa?attccaaaaa?ccattttcgg 8534

aaaattctag?aaaacaccaa?aagatgtgtt?ggccaccgcc?gtcacgtgag?catgtcacat 8594

ttgaactcat?gacggaggag?cacactgccc?acttgtcagc?gttatccctg?tcactattct 8654

agtgcaccac?tggttcctag?ctacaagacc?gtcgtgccca?cacattatcc?aaaagcacat 8714

gccaatgcat?aggctaatga?ataattaatt?gcaatatctc?acttttaatg?catgtttatc 8774

tctcttatct?agattttctt?cggcactaaa?aattattgct?ccttcacata?taaaaagaaa 8834

accacatctt?attgatgact?cgtaattttc?agtgattggg?gtgcttatac?agttcttcta 8894

ctattctagg?t?ttt?tta?tcg?tta?tag?atg?aca?tat?ggg?ata?agc?cat?cat 8944

Phe?Leu?Ser?Leu Met?Thr?Tyr?Gly?Ile?Ser?His?His

285 290 295

ggc?aaa?tac?tcg?aaa?gtg?gtt?tac?aag?ata?atg?att?acg?gaa?gta?aaa 8992

Gly?Lys?Tyr?Ser?Lys?Val?Val?Tyr?Lys?Ile?Met?Ile?Thr?Glu?Val?Lys

300 305 310

tac?ttg?taa?cta?ctc?gta?aat?ctg?agg?ttg?caa?caa?tta?tca?gcg?atg 9040

Tyr?Leu Leu?Leu?Val?Asn?Leu?Arg?Leu?Gln?Gln?Leu?Ser?Ala?Met

315 320 325

tgt?aca?ata?tga?aac?cac?ttt?ctc?atg?ata?act?cta?aag?aat?tat?tgt 9088

Cys?Thr?Ile Asn?His?Phe?Leu?Met?Ile?Thr?Leu?Lys?Asn?Tyr?Cys

330 335 340

ata?caa?gaa?ctg?gta?gtg?aag?gca?aat?ctc?ttg?aca?gtt?cat?caa?ctg 9136

Ile?Gln?Glu?Leu?Val?Val?Lys?Ala?Asn?Leu?Leu?Thr?Val?His?Gln?Leu

345 350 355

agg?cat?gtg?aca?aga?ttt?tga?aga?aat?gtg?ctg?gtg?tgc?cat?tag?cta 9184

Arg?His?Val?Thr?Arg?Phe Arg?Asn?Val?Leu?Val?Cys?His Leu

360 365 370

tca?tta?cga?tag?cta?gct?tgt?tgg?cta?gta?gat?cag?gtc?tgg?act?ggt 9232

Ser?Leu?Arg Leu?Ala?Cys?Trp?Leu?Val?Asp?Gln?Val?Trp?Thr?Gly

375 380 385

ctg?agg?tgt?aca?gag?cta?ttg?att?ttg?gag?aag?aag?aca?act?atg?aaa 9280

Leu?Arg?Cys?Thr?Glu?Leu?Leu?Ile?Leu?Glu?Lys?Lys?Thr?Thr?Met?Lys

390 395 400

Resistance gene Pi 36 of rice blast and application sequence table thereof

tgg?caa?ata?cta?aaa?gga?tat?tgt?ctt?tta?gct?act?acg?atc?tgc?ctt 9328

Trp?Gln?Ile?Leu?Lys?Gly?Tyr?Cys?Leu?Leu?Ala?Thr?Thr?Ile?Cys?Leu

405 410 415

cac?att?taa?aga?att?gtt?tgc?tct?atc?taa?gca?tgt?ttc?cag?aag?att 9376

His?Ile Arg?Ile?Val?Cys?Set?Ile Ala?Cys?Phe?Gln?Lys?Ile

420 425 430

ata?aaa?ttg?aca?aaa?atc?att?tga?tat?gga?tgt?gga?tag?ctg?aag?gtt 9424

Ile?Lys?Leu?Thr?Lys?Ile?Ile Tyr?Gly?Cys?Gly Leu?Lys?Val

435 440 445

ttg?tcc?ctg?aga?aac?aaa?aca?caa?att?tag?gat?tat?atg?agc?ttg?ggg 9472

Leu?Ser?Leu?Arg?Asn?Lys?Thr?Gln?Ile Asp?Tyr?Met?Ser?Leu?Gly

450 455 460

aga?gtt?act?tca?atg?agc?tga?taa?ata?gaa?gca?tga?tcc?agc?caa?ttg 9520

Arg?Val?Thr?Ser?Met?Ser Ile?Glu?Ala Ser?Ser?Gln?Leu

465 470

aga?atg?aat?ttt?ttg?ggt?gta?tag?aag?gtt?tgt?cgt?gtt?cca?tga?tat 9568

Arg?Met?Asn?Phe?Leu?Gly?Val Lys?Val?Cys?Arg?Val?Pro Tyr

475 480 485

ggt?gct?cga?tct?agc?tcg?ttc?att?gac?aag?tga?aca?aaa?ctt?tgt?cac 9616

Gly?Ala?Arg?Ser?Ser?Ser?Phe?Ile?Asp?Lys Thr?Lys?Leu?Cys?His

490 495 500

tgt?att?gga?taa?cga?tga?gca?acg?gaa?acc?tga?aag?cac?caa?tgc?tcg 9664

Cys?Ile?Gly Arg Ala?Thr?Glu?Thr Lys?His?Gln?Cys?Ser

505 510 515

tag?gtt?ggc?cct?gca?ccg?tac?gag?tat?cac?gag?cta?tcg?att?tgt?taa 9712

Val?Gly?Pro?Ala?Pro?Tyr?Glu?Tyr?His?Glu?Leu?Ser?Ile?Cys

520 525 530

tat?gga?tat?gaa?gaa?agt?gag?gtc?att?tgt?tgc?cac?tga?gtg?caa?taa 9760

Tyr?Gly?Tyr?Glu?Glu?Ser?Glu?Val?Ile?Cys?Cys?His Val?Gln

535 540

tgg?caa?taa?tag?tgt?ggc?acc?acc?aag?gtt?cca?agt?ttt?acg?tgt?gtt 9808

Trp?Gln Cys?Gly?Thr?Thr?Lys?Val?Pro?Ser?Phe?Thr?Cys?Val

545 550 555

gtc?ctt?gga?caa?atg?taa?tgg?tat?gga?gga?tta?tta?cat?aga?aag?tat 9856

Val?Leu?Gly?Gln?Met Trp?Tyr?Gly?Gly?Leu?Leu?His?Arg?Lys?Tyr

560 565 570

ttt?gca?gta?tgc?tgg?aag?gct?ggg?tca?cct?gag?gtg?cct?cca?gct?ttc 9904

Phe?Ala?Val?Cys?Trp?Lys?Ala?Gly?Ser?Pro?Glu?Val?Pro?Pro?Ala?Phe

575 580 585

ctc?aca?cac?aga?gtt?tca?tag?gct?ccc?taa?aga?att?agg?aga?tct?caa 9952

Leu?Thr?His?Arg?Val?Ser Ala?Pro Arg?Ile?Arg?Arg?Ser?Gln

590 595 600

gtt?tct?aa?aaat?act?gga?ctt?ggg?tga?ttg?tgg?cgg?tac?aat?aga?aga 10000

Val?Ser?Lys?Asn?Thr?Gly?Leu?Gly Leu?Trp?Arg?Tyr?Asn?Arg?Arg

605 610 615

gct?gcc?gga?gga?gtt?ggg?tct?cct?gac?aca?ttt?gtt?gtg?tct?acg?tat 10048

Ala?Ala?Gly?Gly?Val?Gly?Ser?Pro?Asp?Thr?Phe?Val?Val?Ser?Thr?Tyr

620 625 630

tcc?tcg?cag?att?gga?gat?gtt?gcc?agc?tgg?ttt?gat?cgg?aaa?act?gac 10096

Ser?Ser?Gln?Ile?Gly?Asp?Val?Ala?Ser?Trp?Phe?Asp?Arg?Lys?Thr?Asp

635 640 645 650

atc?gct?gca?aga?gct?atg?cat?aag?tct?tat?cga?aga?ggt?cgc?tgt?aag 10144

Ile?Ala?Ala?Arg?Ala?Met?His?Lys?Ser?Tyr?Arg?Arg?Gly?Arg?Cys?Lys

655 660 665

gca?ctt?tgt?gca?gga?gtt?ggg?caa?cct?cag?aga?act?gag?ggt?gct?cta 10192

Ala?Leu?Cys?Ala?Gly?Val?Gly?Gln?Pro?Gln?Arg?Thr?Glu?Gly?Ala?Leu

Resistance gene Pi 36 of rice blast and application sequence table thereof

670 675 680

tgc?caa?aat?tta?tat?agg?gct?gaa?aga?tga?gag?cat?gca?gag?aga?ttt 10240

Cys?Gln?Asn?Leu?Tyr?Arg?Ala?Glu?Arg Glu?His?Ala?Glu?Arg?Phe

685 690 695

tct?aca?gtc?ctt?agg?ctg?tct?aca?taa?ggt?cca?cac?tat?gaa?tat?ata 10288

Ser?Thr?Val?Leu?Arg?Leu?Ser?Thr Gly?Pro?His?Tyr?Glu?Tyr?Ile

700 705 710

tag?cat?tga?agt?aag?gga?atg?cac?cag?acc?aga?tgc?agc?agg?ttc?tgt 10336

His Ser?Lys?Gly?Met?His?Gln?Thr?Arg?Cys?Ser?Arg?Phe?Cys

715 720 725

gtc?ctg?tcc?tcg?gct?ctg?gca?gct?gtc?att?gcc?atg?cat?caa?gtt?ttt 10384

Val?Leu?Ser?Ser?Ala?Leu?Ala?Ala?Val?Ile?Ala?Met?His?Gln?Val?Phe

730 735 740

tag?cct?acc?tgt?gtg?gat?taa?ctc?atc?aac?tct?tgg?ttg?cct?ctc?gca 10432

Pro?Thr?Cys?Val?Asp Leu?Ile?Asn?Ser?Trp?Leu?Pro?Leu?Ala

745 750 755

tct?aga?cgt?gaa?agt?aca?ggt?tgt?gag?aga?gca?gga?cat?gga?aac?cct 10480

Ser?Arg?Arg?Glu?Ser?Thr?Gly?Cys?Glu?Arg?Ala?Gly?His?Gly?Asn?Pro

760 765 770

tgg?aag?gct?ccc?aat?gct?ctg?tta?cct?caa?att?gga?ttc?cca?ata?tac 10528

Trp?Lys?Ala?Pro?Asn?Ala?Leu?Leu?Pro?Gln?Ile?Gly?Phe?Pro?Ile?Tyr

775 780 785

cag?gct?aat?aag?cat?taa?gaa?gcc?tgc?tga?tga?tgg?cta?ctt?cca?aaa 10576

Gln?Ala?Asn?Lys?His Glu?Ala?Cys Trp?Leu?Leu?Pro?Lys

790 795 800

att?gag?att?ctt?taa?aac?tcc?tca?ttc?att?tgt?ccg?gtt?tga?tct?tca 10624

Ile?Glu?Ile?Leu Asn?Ser?Ser?Phe?Ile?Cys?Pro?Val Ser?Ser

805 810 815

tgg?ttg?cga?gtc?cag?cag?tgg?agc?atc?tag?ctt?cat?gcc?aag?act?tga 10672

Trp?Leu?Arg?Val?Gln?Gln?Trp?Ser?Ile Leu?His?Ala?Lys?Thr

820 825

aca?cat?tga?att?cag?tgt?cga?tgt?tcg?gtt?cct?aaa?aga?tgc?agc?aga 10720

Thr?His Ile?Gln?Cys?Arg?Cys?Ser?Val?Pro?Lys?Arg?Cys?Ser?Arg

830 835 840

cct?gca?tgc?tgg?tct?taa?caa?cct?gct?tgc?agg?ctt?caa?tga?ctt?tgg 10768

Pro?Ala?Cys?Trp?Ser Gln?Pro?Ala?Cys?Arg?Leu?Gln Leu?Trp

845 850 855

aag?aac?ttc?gct?caa?gag?tgt?cga?cgc?tag?gat?cca?ctg?caa?gga?tgc 10816

Lys?Asn?Phe?Ala?Gln?Glu?Cys?Arg?Arg Asp?Pro?Leu?Gln?Gly?Cys

860 865 870

cct?tgc?tgc?gga?ggt?gca?gga?agc?cga?ggt?ggc?att?ggc?aaa?tgc?agc 10864

Pro?Cys?Cys?Gly?Gly?Ala?Gly?Ser?Arg?Gly?Gly?Ile?Gly?Lys?Cys?Ser

875 880 885

aca?cgg?cca?tcc?caa?ccg?tcc?agt?cct?tcg?aac?tga?tat?ggc?ata?tga 10912

Thr?Arg?Pro?Ser?Gln?Pro?Ser?Ser?Pro?Ser?Asn Tyr?Gly?Ile

890 895 900

gag?gat?gat?gcg?ctc?acc?tga?tga?cga?taa?g?gtacgtgtat?gcacagtacg 10963

Glu?Asp?Asp?Ala?Leu?Thr Arg

905 910

taatgtactt?agatcatttc?aatcgatttt?ccttatgctg?gttttctgcc?tacatatata 11023

aaatctgatc?ttaattattt?cttgtgctta?tatatatttt?tcag?cc aac?aag?ctg 11078

Ala?Asn?Lys?Leu

gtc?cga?tca?aaa?att?ttt?tga?gat?aca?tgt?cta?tcc?gtc?gtc?gaa?tga 11126

Val?Arg?Ser?Lys?Ile?Phe Asp?Thr?Cys?Leu?Ser?Val?Val?Glu

915 920 925

Resistance gene Pi 36 of rice blast and application sequence table thereof

cca?tca?tcg?tta?cct?tag?cta?cct?ccg?gtt?gtt?gaa?gaa?gcc?acg?cct 11174

Pro?Ser?Ser?Leu?Pro Leu?Pro?Pro?Val?Val?Glu?Glu?Ala?Thr?Pro

930 935 940

gga?gaa?gct?tat?agt?caa?cat?ata?tgt?gtc?caa?gga?tgg?tat?ggt?tgg 11222

Gly?Glu?Ala?Tyr?Ser?Gln?His?Ile?Cys?Val?Gln?Gly?Trp?Tyr?Gly?Trp

945 950 955

gga?tgt?gga?tga?agc?tgt?ggc?agc?tgc?gag?gaa?cgt?agt?cga?cca?tca 11270

Gly?Cys?Gly Ser?Cys?Gly?Ser?Cys?Glu?Glu?Arg?Ser?Arg?Pro?Ser

960 965 970

tat?caa?cca?tcc?aac?act?tga?gat?aaa?tag?aat?gga?aga?aag?tat?ttc 11318

Tyr?Gln?Pro?Ser?Asn?Thr Asp?Lys Asn?Gly?Arg?Lys?Tyr?Phe

975 980 985

tga?cca?aca?tca?aca?g?gcaagatata?tctctcttct?tgagctcgtc?cccaatattg 11374

Pro?Thr?Ser?Thr

990

tactacagag?aaacccagtt?aatttgtaac?accaaccatc?acattctgaa?tcatgtttgc 11434

cttttaattg?tttttatgca?tactctacat?gagagtgcta?tatatatttt?gtttcacttg 11494

cagttgctca?tagtcatttc?acaagataca?tatgcatggt?ggtagactgc?taaaactata 11554

gttcatccta?acatagcatt?attttttgac?tgtttctag?gt ccc?tga?aaa?taa 11607

Gly?Pro Lys

995

ttg?a?gtggcaagct?gttcatttga?aggttaagat?tggcacagtg?atggcacaat 11661

Leu

attaatgaat?ccgagccaga?ctagacggga?agctgtcata?gcattgacta?atctgtaatc 11721

cgatttcaaa?atgcaggata?ttcggatcaa?tttcctcata?tgtcgtctac?tcttttactg 11781

taagtatgac?actttatctt?ttatctcatt?tatgtatctt?tcgtaagtgg?cacagtaata 11841

aggtgacatc?ccattgttat?tcccacacgt?ttgtaaccaa?attctttaat?aattgagtgc 11901

agttctggtg?catgtttgat?tctctgcatt?tggtccaagc?agaggttaca?gcacattatc 11961

aacggagaaa?ataactgaaa?aaaggtgatg?ataaacagaa?tattatgggt?gctgtagcat 12021

aattgactct?gcacctgatc?accctcctca?tgggttggta?agcacaacag?cttgccatct 12081

tattgctgta?caatcttttg?tgaatgatga?taggtgtaat?tggatatgtg?tgctggagaa 12141

aaaatgctca?atccaagtga?caaattgcgc?acttgttttg?atctttaatt?ccctttcaga 12201

gtgatctact?ctaaggacaa?tcttggatca?cccttggatg?aaaaacttaa?ggattggatg 12261

ttggacattt?tacctttgat?aggcctaaaa?acttcatgta?tatattatat?ccaaactaga 12321

ggttataagt?gtgttttggc?tatgtgcatc?atagctatgc?aaatgccggg?agtatgctca 12381

acatagttgt?atcgcctcat?tgtaattgac?tgcgttcaat?aaaatcttcc?attatctaaa 12441

aaatggaaag?cttcaatcca?ccaacagagt?catggccaca?tgattccctc?attggacacc 12501

gaaagattca?aagaaagcag?acttcaggct?gtaaaattgt?ttgtgaaaac?cttcatgttg 12561

catgaatgca?agagtgacct?tgaatatgtt?gcttaatttt?tcagattatg?tgtttcacat 12621

tttctaattt?agtatactgt?gaagtttgcg?ggggaatgta?tagatttagt?tgatgaattc 12681

agtagagcaa?acacaaagta?caggtacaaa?acaataacat?gatgggattc?agatctcaga 12741

aggtgcacag?attcgtaact?gtgaacctac?agaggcacaa?tgcaacaaca?ggtcaccaaa 12801

taatatctca?actgagtaac?aactaaaaat?cattttactt?gaacaacttg?cccaaataga 12861

Resistance gene Pi 36 of rice blast and application sequence table thereof

gtcatcaaaa?ggagaaataa?caacttgccc?aagaataaga?aaatctgatc?caccttaaga 12921

tgaccaccct?agtcatcaaa?atccacatca?cttacaaaac?agatttagga?tcataaccat 12981

caacaacttc?aataacgtaa?ctggtggcct?aggttgtaaa?agaaaacatt?gaaatatgag 13041

tcatggaatt?ccaattcaaa?agacttgagt?gtgcaaatgc?tgaaattaag?atgctcaaca 13101

ttctcagcca?ttttggggat?ggattttgat?ttgagggaga?ggattaataa?tggaaaataa 13161

gatcttcaca?atgatgtgga?ctcttctatc?gccttgtggg?caaatgattt?tgattttcct 13221

atgcttttca?cagttaactg?ctgccctgtt?ccttcgcatg?tgggatctaa?atctgcagta 13281

gcatttgcag?aattggtgtc?gtgatcatag?gcataagctc?catgctggta?aaatgaacaa 13341

ggaaacagtt?aaactcaatt?catgagaaga?aaagaaacag?caatgtggag?agggggagat 13401

ataccgaacc?ttgacaagat?gcagggaaag?tttctctatg?ttaggtgagt?gccgaagcaa 13461

gtacagtagt?ggatagcagc?catcactaaa?aaaccactca?ccaagtgcca?aactcgttag 13521

attgctgaat?atcccacacc?ttggaagatc?acgtagtaat?accttttgga?ccacctgccc 13581

acaagtttta?aactccaaag?atgttaaaga?taggaatata?taaacaacaa?ataagagcaa 13641

ttgtaattta?aagcatttag?cttacatctt?cgtagataga?tgaagacatc?aagtgcaatc 13701

ttgcagcgtt?tgaaagagca?ctgagaatag?tgcagtcaac?atcagaatgt?ccaaaagaga 13761

acctattaag?ggtaaactga?agctgattcc?actgatgata?tgtctaggag?ccgaagattt 13821

ctgtttgcaa?tctcctctac?atgcaggcag?ataaggtttg?gcatatttat?cacaagatgc 13881

tgaaaacctt?ctgggtcatc?ttgagttcta?tctgcagctg?taatggtcag?aatcttcaat 13941

gtagcagagc?aaaacatggt?ggccttgatg?gcacaatgtc?tcaactccag?atgcagtagc 14001

tccgggcaac?cagaaaagag?tttctcgaca?aaacggttat?caatagaaaa?tttgcaaagg 14061

tatacactct?tcaagtgcaa?ggaagtgaag?gggacaggat?atccatctac?agaaaggagc 14121

ttgccatcac?aataattgag?tatgccgaga?gttttaacgt?tgcacctaag?ggcatggcag 14181

acccatggat?ggatgtcaga?ataatcaagg?gaatcatcag?agctgtcata?ggaggtatgg 14241

atacagaaca?tatccaacag?ggcacagctg?cgctgcagga?gcaaattgtc?aacaaacttc 14301

ttaaaatgtt?tcactgtaat?gaagttgcac?gaatcaacat?tgaggtatcc?cacagatgcc 14361

cagacgttct?gccacctccg?agatagcaca?caagtctgca?cagcctcctt?cgctgttagg 14421

aatgtcatga?catggtgcaa?aagttcgtc 14450

<210>2

<211>1056

<212>NBS-LRR

＜213〉Oryza paddy rice (Orysa sativa L.)

<400>2

Met?Glu?Phe?Val?Thr?Gly?Ala?Met?Ser?Ser?Leu?Ile?Pro?Lys?Leu

5 10 15

Gly?Glu?Leu?Leu?Lys?Glu?Lys?Tyr?Asn?Leu?Gln?Lys?Asn?Ile?Arg

20 25 30

Gly?Lys?Ile?Glu?Ser?Leu?Ser?Ala?Glu?Leu?Arg?Arg?Ala?Gln?Ala

35 40 45

Val?Leu?Arg?Met?Val?Gly?Glu?Val?Pro?Gln?Asp?Gln?Gln?Asn?Glu

50 55 60

Leu?Val?Lys?Leu?Trp?Ala?Ser?Asp?Leu?Arg?Glu?Ala?Ser?Tyr?Asp

Resistance gene Pi 36 of rice blast and application sequence table thereof

65 70 75

Met?Glu?Asp?Ile?Ile?Asp?Ala?Phe?Leu?Val?His?Val?Asp?Asp?Asp

80 85 90

Gly?Pro?Lys?Pro?Ala?Asp?Pro?His?Val?Leu?Arg?Arg?Leu?Gly?Lys

95 100 105

Gln?Val?Lys?Lys?Leu?Phe?Lys?Lys?Thr?Lys?His?Arg?Val?Thr?Ile

110 115 120

Ala?Asp?Ala?Ile?Gln?6lu?Met?Glu?Lys?Lys?Leu?Leu?Glu?Ile?Asp

125 130 135

Ala?Arg?His?Gly?Arg?Tyr?Pro?Val?Asp?Asn?Ile?Val?Ile?Pro?Ala

140 145 150

Arg?Pro?Thr?Pro?Ile?Asp?Pro?Arg?Ile?Leu?Asn?Ile?Glu?Lys?Met

155 160 165

Ala?Asn?Asn?Leu?Val?Gly?Ile?Asp?Glu?Pro?Arg?Asp?Glu?Leu?Ile

170 175 180

Lys?Met?Leu?Ser?Gln?His?Glu?Arg?Asp?Asn?Asn?Leu?Asn?Thr?Ser

185 190 195

Asn?Arg?Lys?Thr?Lys?Ile?Val?Tyr?Val?Val?Gly?Met?Gly?Gly?Leu

200 205 210

Gly?Lys?Thr?Thr?Leu?Ala?Thr?Ala?Val?Tyr?Glu?Lys?Ile?Lys?Val

215 220 225

Gly?Phe?Pro?Leu?Asn?Ala?Phe?Val?Pro?Ile?Gly?Gln?Asn?Pro?Asn

230 235 240

Met?Lys?Ala?Ile?Leu?Trp?Asn?Ile?Leu?His?Arg?Leu?Gly?Ser?Glu

245 250 255

Lys?Tyr?Leu?Asn?Cys?Pro?Asn?Ile?Glu?Met?Leu?Thr?Val?Gln?Glu

260 265 270

Leu?Ile?Gly?Glu?Leu?Lys?Gln?Phe?Ile?Lys?Gly?Lys?Arg?Phe?Phe

275 280 285

Ile?Val?Ile?Asp?Asp?Ile?Trp?Asp?Lys?Pro?Ser?Trp?Gln?Ile?Leu

290 295 300

Glu?Ser?Gly?Leu?Gln?Asp?Asn?Asp?Tyr?Gly?Ser?Lys?Ile?Leu?Val

305 310 315

Thr?Thr?Arg?Lys?Ser?Glu?Val?Ala?Thr?Ile?Ile?Ser?Asp?Val?Tyr

320 325 330

Asn?Met?Lys?Pro?Leu?Ser?His?Asp?Asn?Ser?Lys?Glu?Leu?Leu?Tyr

335 340 345

Thr?Arg?Thr?Gly?Ser?Glu?Gly?Lys?Ser?Leu?Asp?Ser?Ser?Ser?Thr

350 355 360

Glu?Ala?Cys?Asp?Lys?Ile?Leu?Lys?Lys?Cys?Ala?Gly?Val?Pro?Leu

365 370 375

Ala?Ile?Ile?Thr?Ile?Ala?Ser?Leu?Leu?Ala?Ser?Arg?Ser?Gly?Leu

380 385 390

Asp?Trp?Ser?Glu?Val?Tyr?Arg?Ala?Ile?Asp?Phe?Gly?Glu?Glu?Asp

395 400 405

Asn?Tyr?Glu?Met?Ala?Asn?Thr?Lys?Arg?Ile?Leu?Ser?Phe?Ser?Tyr

410 415 420

Tyr?Asp?Leu?Pro?Ser?His?Leu?Lys?Asn?Cys?Leu?Leu?Tyr?Leu?Ser

425 430 435

Met?Phe?Pro?Glu?Asp?Tyr?Lys?Ile?Asp?Lys?Asn?His?Leu?Ile?Trp

440 445 450

Met?Trp?Ile?Ala?Glu?Gly?Phe?Val?Pro?Glu?Lys?Gln?Asn?Thr?Asn

455 460 465

Leu?Gly?Leu?Tyr?Glu?Leu?Gly?Glu?Ser?Tyr?Phe?Asn?Glu?Leu?IIe

470 475 480

Asn?Arg?Ser?Met?Ile?Gln?Pro?Ile?Glu?Asn?Glu?Phe?Phe?Gly?Cys

485 490 495

Ile?Glu?Gly?Cys?Arg?Val?His?Asp?Met?Val?Leu?Asp?Leu?Ala?Arg

500 505 510

Ser?Leu?Thr?Ser?Glu?Gln?Asn?Phe?Val?Thr?Val?Leu?Asp?Asn?Asp

515 520 525

Glu?Gln?Arg?Lys?Pro?Glu?Ser?Thr?Asn?Ala?Arg?Arg?Leu?Ala?Leu

530 535 540

His?Arg?Thr?Ser?Ile?Thr?Ser?Tyr?Arg?Phe?Val?Asn?Met?Asp?Met

545 550 555

Lys?Lys?Val?Arg?Ser?Phe?Val?Ala?Thr?Glu?Cys?Asn?Asn?Gly?Asn

560 565 570

Asn?Ser?Val?Ala?Pro?Pro?Arg?Phe?Gln?Val?Leu?Arg?Val?Leu?Ser

575 580 585

Leu?Asp?Lys?Cys?Ser?Gly?Met?Glu?Asp?Tyr?Tyr?Ile?Glu?Ser?Ile

590 595 600

Leu?Gln?Tyr?Ala?Gly?Arg?Leu?Gly?His?Leu?Arg?Cys?Leu?Gln?Leu

605 610 615

Ser?Ser?His?Thr?Glu?Phe?His?Arg?Leu?Pro?Lys?Glu?Leu?Gly?Asp

620 625 630

Resistance gene Pi 36 of rice blast and application sequence table thereof

Leu?Lys?Phe?Leu?Lys?Ile?Leu?Asp?Leu?Gly?Asp?Cys?Gly?Gly?Thr

635 640 645

Ile?Glu?Glu?Leu?Pro?Glu?Glu?Leu?Gly?Leu?Leu?Thr?His?Leu?Leu

650 655 660

Cys?Leu?Arg?Ile?Pro?Arg?Arg?Leu?Glu?Met?Leu?Pro?Ala?Gly?Leu

665 670 675

Ile?Gly?Lys?Leu?Thr?Ser?Leu?Gln?Glu?Leu?Cys?Ile?Ser?Leu?Ile

680 685 690

Glu?Glu?Val?Ala?Val?Arg?His?Phe?Val?Gln?Glu?Leu?Gly?Asn?Leu

695 700 705

Arg?Glu?Leu?Arg?Val?Leu?Tyr?Ala?Lys?Ile?Tyr?Ile?Gly?Leu?Lys

710 715 720

Asp?Glu?Ser?Met?Gln?Arg?Asp?Phe?Leu?Gln?Ser?Leu?Gly?Cys?Leu

725 730 735

His?Lys?Val?His?Thr?Met?Asn?Ile?Tyr?Ser?Ile?Glu?Val?Arg?Glu

740 745 750

Cys?Thr?Arg?Pro?Asp?Ala?Ala?Gly?Ser?Val?Ser?Cys?Pro?Arg?Leu

755 760 765

Trp?Gln?Leu?Ser?Leu?Pro?Cys?Ile?Lys?Phe?Phe?Ser?Leu?Pro?Val

770 775 780

Trp?Ile?Asn?Ser?Ser?Thr?Leu?Gly?Cys?Leu?Ser?His?Leu?Asp?Val

785 790 795

Lys?Val?Gln?Val?Val?Arg?Glu?Gln?Asp?Met?Glu?Thr?Leu?Gly?Arg

800 805 810

Leu?Pro?Met?Leu?Cys?Tyr?Leu?Lys?Leu?Asp?Ser?Gln?Tyr?Thr?Arg

815 820 825

Leu?Ile?Ser?Ile?Lys?Lys?Pro?Ala?Asp?Asp?Gly?Tyr?Phe?Gln?Lys

830 835 840

Leu?Arg?Phe?Phe?Lys?Thr?Pro?His?Ser?Phe?Val?Arg?Phe?Asp?Leu

845 850 855

His?Gly?Cys?Glu?Ser?Ser?Ser?Gly?Ala?Ser?Ser?Phe?Met?Pro?Arg

860 865 870

Leu?Glu?His?Ile?Glu?Phe?Ser?Val?Asp?Val?Arg?Phe?Leu?Lys?Asp

875 880 885

Ala?Ala?Asp?Leu?His?Ala?Gly?Leu?Asn?Asn?Leu?Leu?Ala?Gly?Phe

890 895 900

Asn?Asp?Phe?Gly?Arg?Thr?Ser?Leu?Lys?Ser?Val?Asp?Ala?Arg?Ile

905 910 915

His?Cys?Lys?Asp?Ala?Leu?Ala?Ala?Glu?Val?Gln?Glu?Ala?Glu?Val

920 925 930

Ala?Leu?Ala?Asn?Ala?Ala?His?Gly?His?Pro?Asn?Arg?Pro?Val?Leu

935 940 945

Arg?Thr?Asp?Met?Ala?Tyr?Glu?Arg?Met?Met?Arg?Ser?Pro?Asp?Asp

950 955 960

Asp?Lys?Pro?Thr?Ser?Trp?Ser?Asp?Gln?Lys?Phe?Phe?Glu?Val?His

965 970 975

Val?Tyr?Pro?Ser?Ser?Asn?Asp?His?His?Arg?Tyr?Leu?Ser?Tyr?Leu

980 985 990

Arg?Leu?Leu?Lys?Lys?Pro?Arg?Leu?Glu?Lys?Leu?Ile?Val?Asn?Ile

995 1000 1005

Tyr?Val?Ser?Lys?Asp?Gly?Met?Val?Gly?Asp?Val?Asp?Glu?Ala?Val

1010 1015 1020

Ala?Ala?Ala?Arg?Asn?Val?Val?Asp?His?His?Ile?Asn?His?Pro?Thr

1025 1030 1035

Leu?Glu?Ile?Asn?Arg?Met?Glu?Glu?Ser?Ile?Ser?Asp?Gln?His?Gln

1040 1045 1050

Gln?Val?Pro?Glu?Asn?Asn

1055

Claims (9)

1, a kind of resistance gene Pi 36 of rice blast encoded protein matter, it is characterized in that its aminoacid sequence shown in SEQ ID NO:2, or this sequence is replaced, disappearance or add one or several amino-acid residue and the amino acid polypeptide with identical function that forms.

2, protein according to claim 1 is characterized in that aminoacid sequence is shown in SEQ ID NO:2.

3, the nucleotide sequence of the described proteinic resistance gene Pi 36 of rice blast of coding claim 1.

4, resistance gene Pi 36 of rice blast according to claim 3, its nucleotide sequence is shown in SEQID NO:1.

5, a kind of carrier that contains claim 3 or 4 described genes.

6, the described carrier transgenic plant transformed of claim 5.

7, the molecule marker of claim 3 or 4 described genes generations.

8, claim 1 or the 2 described protein application in preparation resisting rice blast bacteria medicine.

9, the described molecule marker of claim 7 has application in the paddy rice of disease resistance in seed selection to rice blast.

Images